Am J Physiol Cell Physiol Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 280: C1076-C1082, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, G. P. H.
Right arrow Articles by Tse, C.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, G. P. H.
Right arrow Articles by Tse, C.-M.
Vol. 280, Issue 5, C1076-C1082, May 2001

Characterization of nucleoside transport systems in cultured rat epididymal epithelium

George P. H. Leung1, Jeffrey L. Ward1, Patrick Y. D. Wong2, and Chung-Ming Tse1

1 Division of Gastroenterology, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; and 2 Department of Physiology, The Chinese University of Hong Kong, Hong Kong, People's Republic of China


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The nucleoside transport systems in cultured epididymal epithelium were characterized and found to be similar between the proximal (caput and corpus) and distal (cauda) regions of the epididymis. Functional studies revealed that 70% of the total nucleoside uptake was Na+ dependent, while 30% was Na+ independent. The Na+-independent nucleoside transport was mediated by both the equilibrative nitrobenzylthioinosine (NBMPR)-sensitive system (40%) and the NBMPR-insensitive system (60%), which was supported by a biphasic dose response to NBMPR inhibition. The Na+-dependent [3H]uridine uptake was selectively inhibited 80% by purine nucleosides, indicating that the purine nucleoside-selective N1 system is predominant. Since Na+-dependent [3H]guanosine uptake was inhibited by thymidine by 20% and Na+-dependent [3H]thymidine uptake was broadly inhibited by purine and pyrimidine nucleosides, this suggested the presence of the broadly selective N3 system accounting for 20% of Na+-dependent nucleoside uptake. Results of RT-PCR confirmed the presence of mRNA for equilibrative nucleoside transporter (ENT) 1, ENT2, and concentrative nucleoside transporter (CNT) 2 and the absence of CNT1. It is suggested that the nucleoside transporters in epididymis may be important for sperm maturation by regulating the extracellular concentration of adenosine in epididymal plasma.

sperm maturation


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

NUCLEOSIDE TRANSPORTERS are involved in nucleotide biosynthesis by salvage pathways. This is especially important in tissues or cells that lack or have low capacity for de novo nucleotide biosynthesis (14, 25). These transporters also play key roles in many physiological processes such as coronary vasodilation (34), neurotransmission (36), and platelet aggregation (1). Pharmacologically, they serve as an entry for cellular uptake of many synthetic nucleoside analogs that are used in the treatment of cancer and viral diseases. The development of nucleoside transporter inhibitors also provides therapeutic benefits in cardiovascular disorders and parasitic infections (3).

Based on Na+ dependence, two major classes of nucleoside transport systems in mammalian cells have been described (15). The equilibrative transport systems are Na+ independent and are inhibited by coronary vasodilators such as nitrobenzylthioinosine (NBMPR). This class of nucleoside transport systems is broadly selective, accepting both purine and pyrimidine nucleosides. They are further subdivided into two types on the basis of their sensitivities to inhibition by NBMPR (7, 15). The equilibrative-sensitive system (ES) is potently inhibited by a nanomolar concentration of NBMPR. In contrast, the equilibrative-insensitive system (EI) is resistant to NBMPR up to 1 µM. Both the ES and EI transporters have been cloned and are named equilibrative nucleoside transporter (ENT) 1 and ENT2 (16, 17, 45), respectively. Kinetic characterization of cloned human ENT1 (hENT1) and ENT2 (hENT2) reveals that although both hENT1 and hENT2 are broadly selective, hENT2 exhibits a low affinity for guanosine and cytidine but a high affinity for inosine (40). Pharmacologically, hENT1 and hENT2 have a 7,000-fold difference in sensitivity to NBMPR and a 71-fold difference in sensitivity to dipyridamole (40). Interestingly, although rat ENT1 (rENT1) exhibits a similar IC50 to NBMPR inhibition as hENT1, rENT1 is resistant to inhibition by dipyridamole and dilazep. This difference is due to subtle differences in human and rat ENT1 proteins between the putative transmembrane domains 3-6 (35).

In contrast, the concentrative transport systems are Na+ dependent. This class of nucleoside transport systems is able to concentrate nucleosides against a concentration gradient. There are five subclasses based on substrate selectivity. N1 is purine nucleoside selective but also accepts uridine (11, 38). N2 is pyrimidine nucleoside selective (21, 31). N3 has broad selectivity for both purine and pyrimidine nucleosides (43, 44). N4 is pyrimidine nucleoside selective, but it also transports adenosine and guanosine (18). N5 is NBMPR sensitive and appears to be guanosine specific (13). Recently, both N1 and N2 systems have been cloned by functional complementation in oocytes. The former is termed concentrative nucleoside transporter 2 (CNT2) and the latter is CNT1 (11, 21, 31, 38).

Acquisition of sperm fertility occurs during their transit through the epididymis. Adenosine, a substrate of nucleoside transporters, has been known to stimulate sperm motility (2, 37). However, little is known regarding the epithelial transport of nucleosides in the reproductive tissues. Therefore, the present study was carried out to characterize the nucleoside transport systems in the epithelium of proximal region (caput and corpus) and distal region (cauda) of the epididymis. This study may aid our understanding of the role of epididymis in providing a microenvironment for the maturation of spermatozoa.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Culture of rat epididymal epithelium. The primary culture of rat epididymal epithelial cells has been described previously (12, 42). Briefly, immature male Sprague-Dawley rats weighing 150-175 g were killed by cervical dislocation and the lower abdomen was opened. Proximal region (caput and corpus) and distal region (cauda) of epididymis were dissected out. The tissues were finely chopped with scissors and then digested with 0.25% (wt/vol) trypsin, followed by 0.1% (wt/vol) collagenase I. The cells were suspended in Eagle's minimum essential medium supplemented with nonessential amino acids (0.1 mM), glutamine (4 mM), 5alpha -dihydrotestosterone (1 nM), sodium pyruvate (1 mM), 10% fetal bovine serum, penicillin (100 IU/ml), and streptomycin (100 µg/ml) and were incubated for 5-6 h at 32°C in 5% CO2. During this period, fibroblasts and smooth muscle cells were removed as these cells attached to the bottom of the cultured flask while the epididymal epithelial cells remained suspended. The resulting epithelial cells in suspension were seeded into 24-well culture plates. These epithelial cells became attached onto the plate after 12 h. Four days after seeding, the cultures reached confluency and were used for the experiments. These confluent cultures have been previously characterized by us (8) and by Kierszenbaum and coworkers (22). They are shown to resemble intact epididymal epithelia with respect to morphology, tight junction, and absorptive and secretory functions (6, 8, 22). These cells are capable of secreting acidic epididymal glycoprotein, a spermatozoa coating protein secreted by principal cells of rat epididymis (22).

RNA isolation and RT-PCR. Total RNA was isolated from cultured cells of the proximal and distal regions of epididymis using TRIzol reagent (GIBCO BRL). Two micrograms of total RNA was used for first-strand cDNA synthesis using random hexamer primers and SuperScript II RNase H- Reverse Transcriptase (SuperScript Preamplification System, GIBCO BRL). The resulting first-strand cDNA was directly used for PCR amplification.

Different sets of primers were designed and synthesized for PCR analysis. The two primers used for amplifying ENT1 were TCATGCGAAAGCACCGAG (sense primer corresponding to nucleotides 166-183) and GGCACAGATCATGGCAAC (antisense primer corresponding to nucleotides 565-582), which generated a 416-bp ENT1 PCR product. The two primers for ENT2 were TGAGTCGGTGCGTATTCTG (sense primer corresponding to nucleotides 279-297) and AGGCTTCTTGGTCAGGTAG (antisense primer corresponding to nucleotides 660-678), which generated a 399-bp ENT2 product. The two primers for CNT1 were CAACACACAGAGGCAAAGAGAG (sense primer corresponding to nucleotides 9-30) and ACACCAGCAGCAAGGGCTAG (antisense primer corresponding to nucleotides 466-485), which yielded a PCR product of 476 bp. The two primers for amplifying CNT2 were AGGCCTGGAGCTCATGGAAGTC (sense primer corresponding to nucleotides 66-87) and GGCTCCCATGAACACCCTCTTAAG (antisense primer corresponding to nucleotides 442-465), which yielded a PCR product of 399 bp. Reactions were carried out with the following parameters: denaturation at 94°C for 30 s, annealing at 55°C for 1 min, and extension at 72°C for 1.5 min. A total of 30 cycles were performed.

PCR products were analyzed by agarose gel electrophoresis and visualized by staining with ethidium bromide. Amplification products of the expected sizes were purified from the gel, cloned into the vector pCR 2.1 (Invitrogen, Carlsbad, CA), and subjected to fluorescent sequencing according to the manufacturer's protocols (PE/Applied Biosystem 377 automated DNA sequencer).

Nucleoside uptake. All experiments were carried out in HEPES-buffered Ringer solution containing (in mM) 135 NaCl, 5 KCl, 3.33 NaH2PO4, 0.83 Na2HPO4, 1.0 CaCl2, 1.0 MgCl2, 10 glucose, and 5 HEPES (pH 7.4). Na+-free buffer contained (in mM) 140 N-methyl-D-glucamine, 5 HEPES, 5 KH2PO4, 1.0 CaCl2, 1.0 MgCl2, and 10 glucose (pH 7.4).

Confluent monolayers of cells were washed three times in HEPES-buffered solution. Three hundred microliters of HEPES-buffered solution containing [3H]nucleoside (10 µM, 4 µCi/ml) was then added to each well. After incubation of 1.5-3 min, as described in the figures, the plates were washed three times rapidly with ice-cold phosphate-buffered saline containing (in mM) 137 NaCl, 2.68 KCl, 8.1 Na2PO4, and 1.47 KH2PO4 (pH 7.4). Cells were solubilized in 0.5 ml of 5% Triton X-100. The radioactivity was measured by a beta -scintillation counter. The protein content was determined spectrophotometrically using a commercial bicinchoninic acid assay (Pierce Biochemicals, Rockford, IL).

To determine passive nucleoside uptake, monolayers were incubated in the Na+-free buffer containing [3H]nucleoside in the presence of 0.5 mM NBMPR and excess unlabeled nucleosides (4 mM). NBMPR (100 mM) was initially dissolved in DMSO and was diluted to working concentration (up to 0.5 mM) in [3H]nucleoside-containing uptake solution. As a control, 0.5% DMSO was also included in all uptake solution wherever necessary. Control experiments confirmed that 0.5% DMSO had no effect on total [3H]nucleoside uptake by cultured epididymal epithelial cells.

Materials. All the nucleosides, NBMPR, collagenase I, and trypsin were purchased from Sigma Chemical (St. Louis, MO). [5-3H]uridine (0.81 TBq/mmol), [8-3H]guanosine (273 GBq/mmol), and [methyl-3H]thymidine (740 GBq/mmol) were from ICN Pharmaceuticals (Irvine, CA). Cell culture media and supplements were from GIBCO BRL (Grand Island, NY).

Statistical analysis. Data are expressed as means ± SE. Student's t-test and analysis of variance were used for paired and multiple variants, respectively. P < 0.05 was considered statistically significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Time course of uridine uptake in proximal and distal regions of epididymis. [3H]uridine uptake (10 µM) was measured as a function of time in the presence and in the absence of Na+ (Fig. 1). Cultured epithelial cells isolated from both the proximal and distal regions of epididymis demonstrated Na+-dependent [3H]uridine uptake. The remaining Na+-independent [3H]uridine uptake was completely inhibited by 0.5 mM NBMPR (Fig. 1). This result suggested the presence of both Na+-dependent and -independent nucleoside transport. At 3 min, Na+-dependent and -independent uridine uptake was 34.7 ± 1.2 pmol/mg protein and 16.2 ± 0.2 pmol/mg protein, respectively, which represents 68 and 32% of total uridine uptake, respectively, for the proximal region. Na+-dependent and -independent uridine uptake was 26.4 ± 2.6 pmol/mg protein and 10.7 ± 3.5 pmol/mg protein, respectively, which represents 71 and 29% of total uridine uptake, respectively, for the distal region. The Na+-dependent uridine uptake was not affected by 0.5 mM NBMPR (data not shown).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1.   Time course of [3H]uridine uptake. [3H]uridine uptake (10 µM, 4 µCi/ml) was measured in proximal (A) and distal (B) regions of rat epididymal epithelial cells in the presence and absence of Na+ and in the absence of Na+ with the addition of 0.5 mM nitrobenzylthioinosine (NBMPR) as indicated. Values are means ± SE of triplicate determinations of a representative experiment. Similar results were obtained in 3 separate experiments.

It has been previously determined that cultured epididymal epithelial cells have an intracellular volume of 24 µl/mg cell protein (10, 19). At 3 min, the total intracellular accumulation of [3H]uridine in cultured cells from the proximal region was 51 pmol/mg protein (Fig. 1) or 2.1 µM. If the Na+-dependent and -independent [3H]uridine uptake were measured separately, the intracellular accumulation of [3H]uridine would be 1.4 µM and 0.7 µM, respectively. Therefore, at early time points, intracellular accumulation of [3H]uridine is far less than extracellular concentration (10 µM), and thus the uptake closely approximates the initial rate measurement. In the subsequent inhibition studies, 1.5- and 3-min [3H]nucleoside uptake were used as initial rate measurements for Na+-dependent and -independent [3H]nucleoside uptake, respectively, in cultured epididymal epithelial cells.

Na+-independent uridine uptake. To test whether the Na+-independent nucleoside transport consisted of both ES and EI, we pharmacologically defined the ES system as the nucleoside transport that was inhibited by 100-nM NBMPR, and the NBMPR-resistant activity (resistant to 100 nM but sensitive to 0.5 mM) as EI transport. As shown in Fig. 2, ES and EI transport systems contributed ~40 and 60%, respectively, in epithelial cells isolated from both the proximal and distal regions of epididymis. To further confirm that the proximal region contained both ES and EI systems, the dose response of NBMPR inhibition of [3H]uridine transport was determined (Fig. 3A). This dose-response curve was biphasic with a plateau between 10 nM and 1 µM, consistent with the coexistence of ES and EI. If this dose-response curve was dissected into ES (sensitive to 100 nM; Fig. 3B) and EI (resistant to 100 nM; Fig. 3C) transport components, the IC50 was 2.3 nM and 14 µM, respectively. These values are consistent with studies on cloned rENT1 and rENT2 (45). Similar results were obtained for epithelial cells isolated from the distal region of epididymis (data not shown).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   NBMPR-sensitive and -insensitive uridine uptake. Initial rate (3 min) of [3H]uridine uptake (10 µM, 4 µCi/ml) was measured in the proximal and distal regions of cultured epididymal epithelial cells in Na+-free buffer in the absence of inhibitor (control) and in the presence of 100 nM or 0.5 mM NBMPR as indicated. Values are means ± SE from 3 independent experiments.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   Dose response of NBMPR inhibition on Na+-independent uridine uptake in proximal region of epididymal epithelia. Initial rate (3 min) of [3H]uridine uptake (10 µM, 4 µCi/ml) was measured in the absence of Na+ and in the presence of varying concentrations of NBMPR (0 to 30 µM). A: biphasic dose-response relationship for NBMPR inhibition of [3H]uridine uptake. B: equilibrative-sensitive system component of Na+-independent uridine uptake. C: equilibrative-insensitive system component of Na+-independent uridine uptake. Values are means ± SE of triplicate determinations of a representative experiment. Similar results were obtained in 3 separate experiments.

Na+-dependent uridine uptake. As shown in Fig. 1, Na+-dependent uridine uptake is present in both the proximal and distal regions of epididymis. Since five Na+-dependent nucleoside transport systems have been described based on substrate selectivity, we tested the effect of purine and pyrimidine nucleosides on Na+-dependent [3H]uridine uptake. All the subsequent experiments were carried out in the presence of 0.5 mM NBMPR to avoid any contribution from Na+-independent transport systems. As shown in Fig. 4, [3H]uridine uptake (10 µM) in epididymal epithelial cells was inhibited by ~70 and 80% by the purine nucleosides guanosine and inosine (both at 100 µM), respectively. In contrast, the pyrimidine nucleosides cytidine and thymidine (both at 100 µM) inhibited [3H]uridine uptake in epididymal epithelial cells by ~20%. This suggested that the purine nucleoside-selective N1 transport system is the dominant system expressed in the proximal and distal regions of epididymis. The pyrimidine nucleoside-sensitive component of [3H]uridine uptake would represent either the pyrimidine nucleoside-selective N2 system or the broadly selective N3 system. To distinguish between these two systems, we tested the ability of thymidine and inosine (both at 100 µM) to inhibit [3H]guanosine uptake (10 µM; Fig. 5). As expected, inosine inhibited >80% of [3H]guanosine uptake. However, thymidine (100 µM) also inhibited 20% of [3H]guanosine uptake, suggesting the presence of the broadly selective N3 transport system.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Inhibition of Na+-dependent [3H]uridine uptake by nucleosides. [3H]uridine uptake (10 µM, 4 µCi/ml, 1.5 min) was measured in the proximal and distal regions of cultured epididymal epithelial cells in the presence of Na+ and 0.5 mM NBMPR without (control) or with simultaneous addition of 100 µM of nonradioactive cytidine, thymidine, guanosine, or inosine. Values are means ± SE of 3 separate experiments.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of Na+-dependent [3H]guanosine uptake by thymidine and inosine. [3H]guanosine uptake (10 µM, 4 µCi/ml, 1.5 min) was measured in the proximal and distal regions of cultured epididymal epithelial cells in the presence of Na+ and 0.5 mM NBMPR without (control) or with simultaneous addition of 100 µM of nonradioactive thymidine or inosine. Values are means ± SE of 3 separate experiments.

To further confirm the existence of the N3 system in epithelial cells isolated from both regions of the epididymal, we examined the effect of thymidine, cytidine, inosine, guanosine, adenosine, and uridine (all at 100 µM) on [3H]thymidine uptake (10 µM). As shown in Fig. 6, the [3H]thymidine uptake in both the proximal and distal regions of epididymis was broadly inhibited (>70%) by all purine and pyrimidine nucleosides tested. There was no difference in the nucleoside inhibition profile between the proximal and distal regions.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition of Na+-dependent [3H]thymidine uptake by nucleosides. [3H]thymidine uptake (10 µM, 4 µCi/ml, 1.5 min) was measured in the proximal and distal regions of cultured epididymal epithelial cells in the presence of Na+ and 0.5 mM NBMPR without (control) or with simultaneous addition of 100 µM of nonradioactive thymidine, cytidine, inosine, guanosine, adenosine, or uridine. Values are means ± SE of 3 independent experiments.

Identification of nucleoside transporters in proximal and distal regions of rat epididymis by RT-PCR. Since the Na+-dependent pyrimidine nucleoside-selective N2 (CNT1), purine nucleoside-selective N1 (CNT2), and Na+-independent ES (ENT1) and EI (ENT2) nucleoside transport systems have been cloned, RT-PCR was used to confirm the expression of ENT1, ENT2, and CNT2, and the absence of CNT1, in the cultured epithelial cells isolated from the proximal and distal regions of epididymis (Fig. 7). The rat ileum cDNA was used as a positive control because all four of these nucleoside transporters were expressed in this tissue (39). As predicted, PCR products of ENT1 (416 bp), ENT2 (399 bp), and CNT2 (399 bp) were amplified by RT-PCR from RNA isolated from cultured epithelial cells in the proximal and distal regions of epididymis. In contrast, there was no amplified CNT1 PCR product from cultured epithelial cells in the proximal and distal regions of epididymis. Therefore, these results complemented our functional studies that the rat epididymal epithelial cells expressed ES (ENT1), EI (ENT2), and N1 (CNT2) systems.


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 7.   RT-PCR analysis of equilibrative nucleoside transporter (ENT) 1, ENT2, concentrative nucleoside transporter (CNT) 1, and CNT2 mRNA in the proximal region (PR) and distal region (DR) of epididymis. PCR products are seen only in reactions using oligonucleoside primer pairs for ENT1, ENT2, and CNT2, but not CNT1. Positive controls with rat ileum cDNA indicate the expected sizes of amplified fragment (CNT1, 416 bp; CNT2, 399 bp; ENT1, 476 bp; ENT2, 399 bp). DNA size markers are indicated (right).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Both Na+-independent equilibrative and Na+-dependent concentrative nucleoside transport systems are involved in the transport of nucleosides across mammalian cell membranes. The housekeeping equilibrative nucleoside transporters, in particular the ES system, are found in almost all cell types, whereas the concentrative transporters are limited to specialized cells such as liver, intestinal and renal epithelia, and lymphoma cells (4, 5, 24, 29). The present study demonstrated the presence of ES (ENT1; 12.8% in the proximal region and 12.5% in the distal region), EI (ENT2; 19.2% in the proximal region and 16.5% in the distal region), N1 (CNT2; 54.4% in the proximal region and 56.8% in the distal region), and N3 systems (13.6% in the proximal region and 14.2% in the distal region). To our knowledge, this is the first description of nucleoside transport in epididymis. The presence of the N3 system in epididymis, previously described in choroids plexus and intestine (20, 43, 44), further suggests the existence of this yet to be cloned broadly selective Na+-dependent nucleoside transporter.

The Na+-dependent transport was predominant and contributed 68 and 71% of the total nucleoside uptake in epithelial cells isolated from the proximal and distal regions of epididymis, respectively (Fig. 1). The presence of the N1 system was supported by 1) [3H]uridine uptake preferentially inhibited by guanosine and inosine (Fig. 4), and 2) [3H]guanosine uptake preferentially inhibited by inosine (Fig. 5). In both cases, the pyrimidine nucleosides thymidine and cytidine inhibited the [3H]nucleoside uptake by ~20%, with such inhibition of uridine and guanosine uptake likely reflecting the presence of the N3 system. The existence of the N3 system was supported by 1) 20% of [3H]guanosine uptake was inhibited by thymidine (Fig. 5), and 2) [3H]thymidine uptake was inhibited by both purine and pyrimidine nucleosides (Fig. 6). It has been described that the N4 system has similar substrate selectivity as the pyrimidine nucleoside-selective N2 system except that N4 is able to transport guanosine but not inosine. Our study showed that inosine inhibited [3H]thymidine uptake in epididymal epithelial cells by 80%, eliminating the possibility of the N4 system. Additionally, Na+-dependent uridine transport was not affected by NBMPR (data not shown), eliminating the possibility of the N5 system. The presence of the N1 system was further confirmed by RT-PCR by which CNT2 message was found in the proximal and distal regions of epididymal epithelial cells (Fig. 7). The absence of the N2 system was confirmed by the absence of CNT1 message in epididymal epithelial cells.

On the other hand, Na+-independent transport contributed 32 and 29% of the total nucleoside uptake in epithelial cells isolated from the proximal and distal regions of the epididymis. Using differential sensitivity to NBMPR, we demonstrated that the NBMPR-sensitive and -insensitive components were present in epithelial cells isolated from both the proximal and distal regions of the epididymis (Fig. 2), which accounted for 40 and 60% of the Na+-independent nucleoside transport, respectively. The coexistence of the ES and EI transport systems in epithelial cells isolated from the proximal and distal regions of epididymis was further strengthened by the biphasic dose-response curve for NBMPR inhibition of [3H]uridine uptake. Furthermore, the result of RT-PCR confirmed the presence of ENT1 and ENT2 messages in these epithelial cells (Fig. 7).

The physiological role of nucleoside transporters in epididymis is not well understood. In this study, we demonstrated that the epididymis has both Na+-dependent and -independent nucleoside transporters. Unfortunately, we do not yet have the antibodies against these transporters to localize the transporters in epididymal epithelial cells. Nevertheless, in a scenario similar to other polarized epithelial cells, it is likely that the Na+-dependent nucleoside transporters are localized to the luminal membranes, whereas the Na+-independent transporters are on the basolateral membranes (9, 30). It has been shown that the physiologically important nucleoside adenosine regulates Cl- secretion via an apical adenosine receptor in epididymal epithelial cells (41). Adenosine also modulates sperm motility (2, 37), which involves an adenosine receptor, possibly the A2 subtype, on the spermatozoa (32, 33). The adenosine is likely derived from the hydrolysis of nucleotides by 5'-ectonucleotidase, which has been found on the plasma membranes of spermatozoa (26-28) and epididymal epithelial cells (23). The Na+-dependent nucleoside transporters are therefore probably involved in fine tuning the physiological effect of adenosine on spermatozoa and on apical Cl- channels of epididymal epithelial cells by salvaging adenosine from the epididymal fluid. This is consistent with our observation that the purine nucleoside-selective N1 system is predominantly expressed in epididymis and also with the observation by others that spermatozoa are incapable of adenosine transport (37). As in other epithelial cells, the basolateral Na+-independent nucleoside transporters are likely to be important for nucleoside salvage from interstitial fluid.

In conclusion, we have demonstrated the presence of Na+-dependent (N1 and N3) and -independent (ES and EI) nucleoside transport systems in epididymal epithelial cells. These transporters might be important for sperm maturation as spermatozoa transit along the epididymis.


    ACKNOWLEDGEMENTS

This work was supported by National Institutes of Health (NIH) Grant R01-CA-85428 and American Heart Association, Maryland Affiliate, Grant-in-Aid S98645M (to C.-M. Tse), NIH Award K08-DK-02737 (to J. L. Ward), and by the Research Grant Council of Hong Kong (to P. Y. D. Wong).


    FOOTNOTES

Present address of G. P. H. Leung: Department of Physiology, The Chinese University of Hong Kong, Hong Kong, People's Republic of China.

Address for reprint requests and other correspondence: C.-M. Tse, Division of Gastroenterology, Dept. of Medicine, Johns Hopkins Univ. School of Medicine, 918 Ross Research Bldg., 720 Rutland Ave., Baltimore, MD 21205 (E-mail: mtse{at}welch.jhu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 17 April 2000; accepted in final form 22 November 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Agarwal, KC, Zielinski BA, and Maitra RS. Significance of plasma adenosine in the antiplatelet activity of forskolin: potentiation by dipyridamole and dilazep. Thromb Haemost 61: 106-110, 1989[Web of Science][Medline].

2.   Aitken, RJ, Mattei A, and Irvine S. Paradoxical stimulation of human sperm motility by 2-deoxyadenosine. J Reprod Fertil 78: 515-527, 1986[Abstract/Free Full Text].

3.   Baldwin, SA, Mackey JR, Cass CE, and Young JD. Nucleoside transporters: molecular biology and implications for therapeutic development. Mol Med Today 5: 216-224, 1999[Web of Science][Medline].

4.   Belt, JA, and Noel LD. Nucleoside transport in Walker 256 rat carcinosarcoma and S49 mouse lymphoma cells. Differences in sensitivity to nitrobenzylthioinosine and thiol reagents. Biochem J 232: 681-688, 1985[Web of Science][Medline].

5.   Betcher, SL, Forrest JN, Jr, Knickelbein RG, and Dobbins JW. Sodium-adenosine cotransport in brush-border membranes from rabbit ileum. Am J Physiol Gastrointest Liver Physiol 259: G504-G510, 1990[Abstract/Free Full Text].

6.   Byers, SW, Hadley MA, Djakiew D, and Dym M. Growth and characterization of polarized monolayers of epididymal epithelial cells and sertoli cells in dual environment culture chambers. J Androl 7: 59-68, 1986[Abstract/Free Full Text].

7.   Cass, CE, Young JD, and Baldwin SA. Recent advances in the molecular biology of nucleoside transporters of mammalian cells. Biochem Cell Biol 76: 761-770, 1998[Web of Science][Medline].

8.   Chan, HC, and Wong PYD The epididymal epithelial cell. In: Epithelial Cell Culture, edited by Harris A.. Cambridge, UK: Cambridge Univ. Press, 1996, p. 79-96.

9.   Chandrasena, G, Giltay R, Patil SD, Bakken A, and Unadkat JD. Functional expression of human intestinal Na+-dependent and Na+-independent nucleoside transporters in Xenopus laevis oocytes. Biochem Pharmacol 53: 1909-1918, 1997[Web of Science][Medline].

10.   Chapman, DA, and Killian GJ. Glycosidase activities in principal cells, basal cells, fibroblasts and spermatozoa isolated from the rat epididymis. Biol Reprod 31: 627-636, 1984[Abstract].

11.   Che, M, Ortiz DF, and Arias IM. Primary structure and functional expression of a cDNA encoding the bile canalicular, purine-specific Na+-nucleoside cotransporter. J Biol Chem 270: 13596-13599, 1995[Abstract/Free Full Text].

12.   Cuthbert, AW, and Wong PY. Electrogenic anion secretion in cultured rat epididymal epithelium. J Physiol 378: 335-345, 1986[Abstract/Free Full Text].

13.   Flanagan, SA, and Meckling-Gill KA. Characterization of a novel Na+-dependent, guanosine-specific, nitrobenzylthioinosine-sensitive transporter in acute promyelocytic leakemic cells. J Biol Chem 272: 18026-18032, 1997[Abstract/Free Full Text].

14.   Fontenelle, LJ, and Henderson JF. An enzymatic basis for the inability of erythrocytes to synthesize purine ribonucleotides de novo. Biochim Biophys Acta 177: 175-176, 1969[Medline].

15.   Griffith, DA, and Jarvis SM. Nucleoside and nucleobase transport systems of mammalian cells. Biochim Biophys Acta 1286: 153-181, 1996[Medline].

16.   Griffiths, M, Beaumont N, Yao SY, Sundarnam M, Boumah CE, Davies A, Kwong FY, Coe I, Cass CE, Young JD, and Baldwin SA. Cloning of a human nucleoside transporter implicated in the cellular uptake of adenosine and chemotherapeutic drugs. Nat Med 3: 89-93, 1997[Web of Science][Medline].

17.   Griffiths, M, Yao SY, Abidi F, Philips SE, Cass CE, Young JD, and Baldwin SA. Molecular cloning and characterization of a nitrobenzylthioinosine-insensitive (ei) equilibrative nucleoside transporter from human placenta. Biochem J 328: 739-743, 1997.

18.   Gutierrez, MM, and Giacomini KM. Substrate selectivity, potential sensitivity, and stoichiometry of Na+-nucleoside transport in brush border membrane vesicle from human kidney. Biochim Biophys Acta 1149: 202-208, 1993[Medline].

19.   Hofmann, DS, and Killian GJ. Isolation of epithelial cells from the corpus epididymis and analysis for glycerylphosphorycholine, sialic acid, and protein. J Exp Zool 217: 93-102, 1981[Web of Science][Medline].

20.   Huang, QQ, Harvey CM, Paterson AR, Cass CE, and Young JD. Functional expression of Na+-dependent nucleoside transport systems of rat intestine in isolated oocytes of Xenopus laevis. Demonstration that rat jejunum expresses the purine-selective systems N1 (cif) and a second, novel system N3 having broad specificity for purine and pyrimdine nucleosides. J Biol Chem 268: 20613-20619, 1993[Abstract/Free Full Text].

21.   Huang, QQ, Yao SY, Ritzel MW, Paterson AR, Cass CE, and Young JD. Cloning and functional expression of a complementary DNA encoding a mammalian nucleoside transport protein. J Biol Chem 269: 17757-17760, 1994[Abstract/Free Full Text].

22.   Kierszenbaum, A, Lea O, Pertrusz P, French FS, and Tres LL. Isolation, culture, and immunocytochemical characterization of epididymal epithelial cells from pubertal and adult rats. Proc Natl Acad Sci USA 78: 1675-1679, 1981[Abstract/Free Full Text].

23.   Konrad, K, Schiemann P, Renneberg H, Wennemuth G, Fini C, and Aumuller G. Expression and enzyme activity of ecto-5'-nucleotidase in the human male genital tract. Biol Reprod 59: 190-196, 1998[Abstract/Free Full Text].

24.   Le Hir, M, and Dubach UC. Concentrative transport of purine nucleosides in brush border vesicles of the rat kidney. Eur J Clin Invest 15: 121-127, 1985[Web of Science][Medline].

25.   Mackinnon, AM, and Deller DJ. Purine nucleotide biosynthesis in gastrointestinal mucosa. Biochim Biophys Acta 319: 1-4, 1973[Medline].

26.   Majumder, GC, and Biswas R. Evidence for the occurrence of an ecto-(adenosine triphosphatase) in rat epididymal spermatozoa. Biochem J 183: 737-743, 1979[Web of Science][Medline].

27.   Minelli, A, Moroni M, Trinari D, and Mezzasoma I. Hydrolysis of extracellular adenine nucleotides by equine epididymal spermatozoa. Comp Biochem Physiol B Biochem Mol Biol 117: 531-534, 1997[Medline].

28.   Monks, NJ, and Fraser LR. Enzymes of adenosine metabolism in mouse sperm suspension. J Reprod Fertil 83: 389-399, 1988[Abstract/Free Full Text].

29.   Pastor-Anglada, M, Felipe A, Casado FJ, del Santo B, Mata JF, and Valdes R. Nucleoside transporters and liver cell growth. Biochem Cell Biol 76: 771-777, 1998[Web of Science][Medline].

30.   Patil, SD, and Unadkat JD. Sodium-dependent nucleoside transport in the human intestinal brush-border membrane. Am J Physiol Gastrointest Liver Physiol 272: G1314-G1320, 1997[Abstract/Free Full Text].

31.   Ritzel, MW, Yao SY, Huang MY, Elliott JF, Cass CE, and Young JD. Molecular cloning and functional expression of cDNAs encoding a human Na+-nucleoside cotransporter (hCNT1). Am J Physiol Cell Physiol 272: C707-C714, 1997[Abstract/Free Full Text].

32.   Shen, MR, Linden J, Chen SS, and Wu SN. Identification of adenosine receptors in human spermatozoa. Clin Exp Pharmacol Physiol 20: 527-534, 1993[Web of Science][Medline].

33.   Shen, MR, Linden J, Chiang PH, Chen SS, and Wu SN. Adenosine stimulates human sperm motility via A2 receptors. J Pharm Pharmacol 45: 650-653, 1993[Web of Science][Medline].

34.   Shryock, JC, and Belardinelli L. Adenosine and adenosine receptors in the cardiovascular system: biochemistry, physiology and pharmacology. Am J Cardiol 79: 2-10, 1997.

35.   Sundaram, M, Yao SY, Ng AM, Griffiths M, Cass CE, Baldwin SA, and Young JD. Chimeric constructs between human and rat equilibrative nucleoside transporters (hENT1 and rENT1) reveal hENT1 structural domains interacting with coronary vasoactive drugs. J Biol Chem 273: 21519-21525, 1998[Abstract/Free Full Text].

36.   Tamaoki, J, Tagaya E, Chiyotani A, Takemura H, Nagai A, Konno K, Onuki T, and Nitta S. Effect of adenosine and adrenergic neurotransmission and modulation by endothelium in canine pulmonary artery. Am J Physiol Heart Circ Physiol 272: H1100-H1105, 1997[Abstract/Free Full Text].

37.   Vijayaraghavan, S, and Hoskin DD. Regulation of bovine sperm motility and cyclic adenosine 3'-5'-monophosphate by adenosine and its analogues. Biol Reprod 34: 468-477, 1986[Abstract].

38.   Wang, J, Su SF, Dresser MJ, Schaner ME, Washington CB, and Giacomini KM. Na+-dependent purine nucleoside transporter from human kidney: cloning and functional characterization. Am J Physiol Renal Physiol 273: F1058-F1065, 1997.

39.   Ward, J, and Tse CM. Identification of the nucleoside transporters in human small intestine and colonic epithelial cell lines (Abstract). Gastroenterology 114: A431, 1998[Web of Science].

40.   Ward, JL, Sherali A, Mo ZP, and Tse CM. Kinetic and pharmacological properties of cloned human equilibrative nucleoside transporters, ENT1 and ENT2, stably expressed in nucleoside transporter-deficient PK15 cells. J Biol Chem 275: 8375-8381, 2000[Abstract/Free Full Text].

41.   Wong, PY. Control of anion and fluid secretion by apical P2-purinoceptor in the rat epididymis. Br J Pharmacol 95: 1315-1321, 1988[Web of Science][Medline].

42.   Wong, PY. Mechanism of adrenergic stimulation of anion secretion in cultured rat epididymal epithelium. Am J Physiol Renal Fluid Electrolyte Physiol 254: F121-F133, 1988[Abstract/Free Full Text].

43.   Wu, X, Gutierrez MM, and Giacomini KM. Further characterization of the sodium-dependent nucleoside transporter (N3) in choroid plexus from rabbit. Biochim Biophys Acta 1191: 190-196, 1994[Medline].

44.   Wu, X, Yuan G, Brett CM, Hui AC, and Giacomini KM. Sodium-dependent nucleoside transport in choroid plexus from rabbit. Evidence for a single transporter for purine and pyrimidine nucleosides. J Biol Chem 267: 8813-8818, 1992[Abstract/Free Full Text].

45.   Yao, SY, Ng AM, Muzyka WR, Griffiths M, Cass CE, Baldwin SA, and Young JD. Molecular cloning and functional characterization of nitrobenzylthioinosine (NBMPR)-sensitive (es) and NBMPR-insensitive (ei) equilibrative nucleoside transporter proteins (rENT1 and rENT2) from rat tissues. J Biol Chem 272: 28423-28430, 1997[Abstract/Free Full Text].


Am J Physiol Cell Physiol 280(5):C1076-C1082
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
S. M Schuh, B. Hille, and D. F Babcock
Adenosine and Catecholamine Agonists Speed the Flagellar Beat of Mammalian Sperm by a Non-Receptor-Mediated Mechanism
Biol Reprod, December 1, 2007; 77(6): 960 - 969.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Kato, T. Maeda, T. Akaike, and I. Tamai
Nucleoside Transport at the Blood-Testis Barrier Studied with Primary-Cultured Sertoli Cells
J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 601 - 608.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, G. P. H.
Right arrow Articles by Tse, C.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, G. P. H.
Right arrow Articles by Tse, C.-M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online