Vol. 280, Issue 5, C1038-C1044, May 2001
Evaluation of ovarian POMC mRNA through
quantitative RT-PCR analysis in Rana
esculenta
M.
Nabissi1,
L.
Soverchia1,
I.
Lihrmann2,
H.
Vaudry2,
G.
Mosconi1, and
A. M.
Polzonetti-Magni1
1 Dipartimento di Scienze Morfologiche e Biochimiche
Comparate, Universita' degli Studi di Camerino, 62032 Camerino,
Italia; and 2 Laboratory of Cellular and Molecular
Endocrinology, European Institute for Peptide Research, Institut
National de la Santé et de la Recherche Médicale
U413, UA CNRS, University of Rouen, France
 |
ABSTRACT |
The evaluation of changes
in the expression of specific genes requires accurate measurement of
the corresponding mRNA concentration, especially when the gene is
expressed at a very low level. We previously showed that the
proopiomelanocortin (POMC) gene is expressed in the ovary of the frog
Rana esculenta, and, to evaluate its mRNA content in frog
ovary, we have now developed a sensitive quantitative RT-PCR method.
This study provides evidence for the validation of this method and for
the effects of captivity and hypophysectomy on POMC gene expression in
the ovary of this anuran. Our data indicate that ovarian POMC gene is
involved in short-term captivity stress response and seems not
influenced by pituitary. These results are discussed taking into
account the knowledge of the role played by opioids in stress response;
moreover, a local control of POMC gene expression is also suggested.
frog; ovary; proopiomelanocortin gene expression; captivity; hypophysectomy
| |
INTRODUCTION |
PROOPIOMELANOCORTIN
(POMC) is a multifunctional precursor protein that generates, through
tissue-specific proteolytic processing, a number of biologically active
peptides, including adrenocorticotropic hormone (ACTH),
-melanocyte-stimulating hormone (-MSH), and 
-endorphin (7). Molecular cloning of the POMC cDNAs
from various representative species has revealed that the POMC
structure has been highly preserved during evolution (15, 23,
28). The POMC gene is primarily expressed in corticotrope cells
of the pars distalis and in melanotrope cells of the pars intermedia of
the pituitary as well as in discrete neuronal populations in the
central nervous system (12, 17). The occurrence of
POMC-derived peptides and POMC mRNA has also been detected in various
peripheral organs such as the heart (6, 27), pancreas
(29), adrenal medulla (6, 8),
gastrointestinal tract (24), and skin (11,
31). Moreover, the expression of the POMC gene has also been demonstrated in the male and female genital tract in various mammalian species; in particular, the presence of a POMC mRNA shorter
than the pituitary transcript has been observed in testis (3,
25) and ovary (2).
In Rana esculenta ovary, previous studies demonstrated the
presence of both POMC transcript (21) and POMC-derived
peptide, -endorphin; the involvement of this opioid in the control
of ovarian function was demonstrated (1).
In the present study, a competitive RT-PCR technique for quantifying
POMC gene expression in frog ovary was developed. With this technique,
the effects of captivity and hypophysectomy on ovarian POMC gene
expression were evaluated to determine whether ovarian POMC gene
is involved in captivity stress response and whether pituitary
regulates its expression.
| |
MATERIALS AND METHODS |
Animals.
Adult female frogs were collected during the postreproductive
period in a mountain pond (Colfiorito, Umbria). The animals were
maintained in deep water tanks at 18°C under natural photoperiod and
fed with fly larvae.
In vivo experiments.
After 1 day of captivity, 10 frogs were hypophysectomized, and the
animals were killed either after 2 days (Hd; 5 frogs) or after 2 wk
(Hw; 5 frogs). Fifteen animals were used as controls and killed the day
after capture (Co; 5 frogs), after 3 days of captivity (Cd; 5 frogs),
or after 16 days of captivity (Cw; 5 frogs). Hypophysectomy was carried
out in the 16-day captive frogs, which were killed 2 days after the
operation (Hdr; 5 frogs). The ovarian tissues from the five frogs from
each of the six groups were immediately processed for RT-PCR. Animal
manipulations were performed according to the recommendations of the
ethical committees at our institutions and under the supervision of
authorized investigators.
In vitro experiments.
Five female frogs were anesthetized with ice and killed. The ovaries
were removed and washed with culture medium (Dulbecco's modified
Eagle's medium; Sigma) containing glutamine (GIBCO, Netherlands), 10 mM HEPES (Sigma), and 45 mM NaHCO3.
Four pieces of tissue (100 mg each) from individual animals were placed
on a sterile plate and incubated for 6 h in a thermostat incubator
(18°C) with 1 ml of culture medium supplemented with homologous
pituitary homogenate (HPH; [1/10] eq/ml), bullfrog luteinizing
hormone (fLH; 100 ng/ml), and bullfrog follicle-stimulating hormone
(fFSH; 100 ng/ml). The control contained culture medium alone.
Gonadotropins of amphibian origin were applied, i.e., Rana catesbeiana FSH and LH (fFSH, fLH); the doses employed came from previous data obtained when fFSH and fLH were applied in vitro in the
R. esculenta ovarian tissue (26). From the same
five frogs, pituitaries were removed for preparing HPH.
fLH and fFSH were provided by Hayashi et al. (13).
After 6 h, the incubation was stopped by tissue freezing in liquid
nitrogen. At this point, the tissues were ready for total RNA
extraction (TRIzol RNA isolation reagent; GIBCO BRL) and RT-PCR quantification.
RNA and DNA extraction.
Total RNA and DNA were extracted from 1 g of frog ovary obtained
from each animal of the five groups using TRIzol RNA isolation reagent,
based on the acid guanidinium thiocyanate-phenol-chloroform extraction
method (5). Final RNA and DNA concentrations were determined by optical density measurement at 260 nm, and total RNA
integrity was verified by ethidium bromide staining of 28S and 18S
ribosomal RNA bands on a denaturing agarose gel. Total RNAs were
divided into aliquots and stored at 
80°C. Aliquots were randomly
chosen for quantification assay.
Oligonucleotides.
POMC primers were designed based on the sequence of POMC cDNA from
Rana ridibunda. The upstream primer (sense), 5'
TGACAACAACAACGGGGGCT 3' (20 mer), was localized in the 
-MSH region
and the downstream primer (antisense), 5' TGGCATTCTTGAAAAGAGT 3' (19 mer), in the -endorphin region. Primers were designed such that the
predicted size of the PCR product was 471 bp for POMC cDNA.
Competitive RT-PCR.
For the quantification assay, the absolute number of POMC internal
standard (cRNA) molecules was calculated using
spectrophotometric absorbance at 260 nm, the molecular weight of the
cRNA (398, 310 g/mol), and Avogadro's number. The cRNA was diluted at
7.5 × 105 molecules/µl and stored at 80°C.
Different total RNA concentrations (0.5-2 µg) and 7.5 × 105 molecules of cRNA were mixed and reverse transcribed by
100 units of Moloney murine leukemia virus RT (GIBCO BRL) in 25 µl of
the reaction mixture containing 1 µg of
oligo(dT)12-18, 0.5 mM dNTP, 1× RT buffer, 10 mM
dithiothreitol, and 20 units of RNase inhibitor. The RT reactions were
carried out at room temperature for 15 min and at 37°C for 90 min,
followed by 10 min at 95°C. An aliquot (10 µl) of the resulting
cDNA products was subsequently amplified with 2.5 units of
Taq DNA polymerase (GIBCO BRL) in 50 µl of master mix
containing 1× PCR buffer, 1.5 mM MgCl2, 2.5 mM dNTP, and
POMC primers (50 pmol each). PCR amplification was carried out for 37 cycles in an automated thermocycler (MJR Research) with thermocycle
profile (denaturation at 94°C for 40 s, primers annealing at
62°C for 40 s, and primer extension at 72°C for 40 s)
followed by a post-PCR incubation at 72°C for 7 min. PCR products were then purified, and the dried pellets were resuspended in 10 µl
of NcoI 1× buffer with 5 units of NcoI (GIBCO
BRL) and incubated for 1 h at 37°C. Five microliters for each
sample were electrophoresed on 2% agarose gel in Tris-acetic
acid-EDTA buffer 0.5×, and the band density was quantified
using a PhosphorImager (Bio-Rad). For cycle course experiments,
7.5 × 105 molecules of cRNA and 0.5 µg of total RNA
were reverse transcribed and submitted to sequential cycles
(25-45) of amplification. Different negative controls
were performed. First, cRNA and the same total RNA mixture as that used
for the quantification assay were added to the RT reaction mixture
without RT and subsequently amplified to confirm the absence of DNA
contamination in the cRNA and total RNA. Second, all the components of
the RT reaction were prepared without RNA and subsequently amplified to
confirm the absence of contamination in the reagents used. The data
were considered useful only if no bands were observed in the negative
controls. The absolute number of target molecules was estimated
considering that the point at which the endogenous curve intersected
the standard curve indicated that the same number of cRNA molecules was
present in the sample.
Data analysis.
The data were expressed as the means ± SE of five different
quantification experiments for each group. RT-PCR results were analyzed
by one-way analysis of variance with StatView (Brain Power).
P < 0.05 indicated a statistically significant
difference between the means.
Cloning.
Three micrograms of total RNA from R. esculenta ovary were
reverse transcribed and amplified using POMC primers, as described above. The RT-PCR result showed the presence of a single band of ~470
bp. The band was purified using QIAquick PCR purification Kit (QIAGEN),
and ~25 ng of PCR products were used to be cloned with pGEM-T vector
system (Promega). Ten positive clones and the respective constructed
plasmids were chosen.
Sequencing.
DNA sequence analysis was performed by dye-labeled terminators using a
DNA sequencing kit (Perkin Elmer). Nucleotide sequences were read in
both directions.
| |
RESULTS |
Quantification of POMC mRNA: competitive RT-PCR.
We previously developed a method for the quantification of POMC mRNA by
RT-PCR using a synthetic mutant POMC RNA as internal standard
(21). The specific mRNA and the internal standard were coamplified in one reaction in which the same primers were used. The
internal standard (cRNA) was an engineered mRNA with a restriction site
(for NcoI) deleted within it so that the standard DNA
amplified from it could be distinguished by a restriction enzyme
analysis from DNA amplified from the endogenous POMC mRNA (Fig.
1). To increase the sensitivity of
our competitive RT-PCR assay for the quantification of the POMC
mRNA in the ovary of R. esculenta, different sets of primers
were designed based on the sequence of the POMC cDNA of R. ridibunda (15). The aim of this experiment was to
find a set of primers able to select, with high specificity, the
template (POMC mRNA) in such a manner as to quantify the PCR products
from the RT-PCR assay directly on the gel, avoiding Southern blot
analysis (because each additional step can increase measurement errors)
as described (21). The best results were obtained using a
20-mer sense primer (5' TGA CAA CAA CAA CGG GGG CT 3') and a 19-mer
antisense primer (5' TGG CAT TCT TGA AAA GAG T 3'), localized, respectively, in position 332-351 of the -MSH region and in
position 783-801 of the -endorphin region of the R. ridibunda POMC cDNA.
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
A: schematic representation of the synthesis
of deletion of proopiomelanocortin (POMC) cDNA mutant. *Indicates the
nucleotide added during the fill-in reaction. B: schematic
representation of the competitive RT-PCR assay.  , Site
of mutation in the internal standard (cRNA NcoI-). Standard,
internal standard; endog., PCR product from mRNA POMC of Rana
esculenta.
|
|
The RT-PCR product, using total RNA from R. esculenta ovary,
showed a clear band of ~470 bp, using a higher annealing temperature (62°C) than in the previous method (55°C; results not shown). To
demonstrate the high specificity of this set of primers in selecting
the POMC mRNA, the RT-PCR products from ovarian total RNA were cloned.
The 25 clones obtained were tested for the presence of the POMC cDNA
insert by a dot-blot analysis using a R. ridibunda POMC DNA
probe. All the clones proved positive to this analysis (results not
shown), confirming the high specificity of the set of primers used.
Moreover, the plasmids from ten positive clones were sequenced,
revealing the presence of a unique insert with 100% homology with the
primers delimiting the region of the POMC cDNA from R. ridibunda (Fig. 2). A cycle course
experiment was also performed, using POMC cRNA and 0.5 µg of total
RNA from R. esculenta ovary, to identify problems of
efficiency differences and to determine the optimal number of PCR
cycles for the quantification assay. As shown, the slopes of the curve
for the endogenous and standard products are virtually identical,
indicating that the reaction efficiencies for these two templates are
the same; the exponential phase of the reaction was observed up to 37 cycles, followed by a plateau phase (Fig.
3). Thus PCR analyses were subsequently carried out for 37 cycles.
View larger version (32K):
[in this window]
[in a new window]
|
Fig. 2.
Nucleotide sequence analysis of the ovarian POMC PCR product. In
the box is shown the restriction site of NcoI. Numbers
(left) correspond to the first nucleotide of the line;
numbers (right) correspond to the last nucleotide of the
line. Bioactive domains are underlined with arrows.
|
|
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3.
Quantification assay to identify efficiency differences
between endogenous and standard molecules. Total RNA (0.5 µg) from
R. esculenta ovary () and 7.5 × 105 molecules of standard ( ) were reverse
transcribed and submitted to sequential cycles of amplification. The
amplification products were separated using agarose gel and detected by
ethidium bromide staining. The signal was quantified by scanning
photography. The amount of PCR products from cRNA and the amount of PCR
products from POMC mRNA (A.U., arbitral unit) were plotted against the
number of cycles carried out for each sample. Each point represents the
average of duplicate reactions.
|
|
Effects of captivity and hypophysectomy on POMC gene expression.
Figure 4, A-F, represents
the procedure giving the results for each of the five samples making up
the different experimental groups. Twenty-four hours after capture (Co
group), the amount of POMC mRNA was 7.5 × 105
molecules/µg of total RNA (Fig. 4A). The same analysis was
performed in frogs kept in captivity for 3 and 16 days (Cd and Cw) and
in frogs hypophysectomized 2 days and 2 wk before being killed (Hd and
Hw). The 16-day captivity Cw group was considered as a control of the
hypophysectomized frogs killed 2 days after surgery (Hdr); moreover,
POMC gene expression was compared with the variation of total RNA in
all experimental groups and control. The results (Table
1) indicated that POMC gene expression
significantly (P < 0.05) decreased in the ovary of
frogs kept in captivity for 3 days (Cd, Fig. 4B), whereas in
16 days of captivity (Cw, Fig. 4C), and in both 2 days (Hd,
Fig. 4D) and 2 wk (Hw, Fig. 4E) of hypophysectomy, no significant changes of ovarian POMC mRNA were found
when compared with the parallel control group taken in captivity; i.e.,
Cd and Cw. In addition, to separate the effects induced by pituitary
gland removal from those caused by captivity itself, hypophysectomy in
16-day captive animals was carried out (Hdr). Two days after surgery,
no significant changes were found in the ovarian POMC mRNA, compared
with the values obtained in frogs kept in captivity for 16 days (Cw,
Fig. 4F).
View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
A-F: quantitation of POMC mRNA by RT-PCR
in experimental groups. Co, the day after capture; Cd, 3 days of
captivity; Cw, 16 days of captivity; Hd, 2 days after hypophysectomy;
Hw, 2 wk after hypophysectomy; and Hdr, 16 days of captivity and 2 days
after surgery. The amount of standard RNA (cRNA) was kept constant
(7.5 × 105 molecules), and the amount of endogenous
RNA (total RNA) was varied (0.5-2 µg, "e" band). The
amplification products were separated using agarose gel and detected by
ethidium bromide staining. The signal was quantified by scanning
photography. The amount of PCR product from cRNA and the amount of PCR
products (sum of 2 e bands) from POMC mRNA were plotted against
the amount of total RNA included in the cDNA reaction mix. Each point
represents the average of duplicate reactions.
|
|
The total RNA content behaved in the same way as POMC mRNA,
significantly (P < 0.05) decreasing in a short-term
stress paradigm, such as 3 days of captivity (Cd), and significantly
(P < 0.05) increasing in the ovary of 2-wk
hypophysectomized frogs (Table 1).
The results of in vitro experiments are shown in Table
2. Neither total pituitary (HPH) nor fLH
nor fFSH induced significant changes in the content of POMC mRNA
assessed in the culture media.
| |
DISCUSSION |
The POMC encoding for peptides such as ACTH, -MSH, and
endorphins has been found to be involved in the stress response and/or adaptation by activating the central neuroendocrine cascade in amphibians (16, 19) as well as in teleosts (10,
20). As concerns amphibians, Mosconi et al. (19)
found that the captivity stress paradigm applied in R. esculenta is consistent with the activation of the central opioid
system, which mediates the stress-induced inhibition of gonadal
function. In addition to being found in the amphibian brain, opioid
peptides have also been identified in the peripheral organs, including
the gonads. This suggests the presence of a gonadal opioid system in
both mammalian and nonmammalian vertebrates (1). With this
in view, we aimed to clarify the role of ovarian POMC in the frog
R. esculenta, and, for that purpose, a competitive RT-PCR
technique for quantifying POMC gene expression was developed.
An investigation on regulation of gene expression depends in part on
the ability to measure mRNA species accurately. Because of its
extraordinarily high sensitivity, PCR is being widely used for
amplifying cDNA copies of low-abundance mRNA. For the quantitation of
rare mRNA, the quantitative RT-PCR is considered a very useful technique (22, 30, 32), making it possible to study genes that might be expressed at very low levels. One of the main problems of
quantitative RT-PCR is that the amount of PCR products increases at
each cycle of amplification in an exponential manner, so that any of
the variables that influence the reaction can alter the amount of the
final PCR product. An approach to controlling the variability inherent
in RT-PCR involves the use of a competitive template that is highly
similar to, but somehow discriminable from, the intended target
sequence to be quantitated, so that it amplifies at the same efficiency
as the target (14). Our competitive RT-PCR used a
synthetic mutant cRNA with a sequence homology of the DNA amplified
from it and equally as high as that of the DNA amplified from
endogenous mRNA (99% homology). Moreover, considering that we utilized
a set of highly selective primers and a number of cycles of
amplification that avoid taking any measurements after the plateau
phase of the amplification, our competitive RT-PCR assay can be
considered a valid and reliable method. Therefore, the POMC mRNA was
evaluated in the ovary of both short- and long-term captive frogs
since, in our wild frog population, captivity was found to be a very
powerful stressor in which the central opioid system is involved
(19). Hypophysectomy was performed to clarify the
relationships between pituitary and ovarian POMC gene expression.
By applying the captivity stress paradigm, we demonstrate that
short-term captivity decreases both total and POMC mRNA, suggesting that captive frogs need less peptide alarm compared with wild ones.
Conversely, in long-term captivity frogs, POMC mRNA levels were similar
to those measured in controls, indicating that adaptation mechanisms
occur during chronic stress. Regarding the control of pituitary on
ovarian POMC gene transcription, no effects at all were found in POMC
mRNA content, which remained unaffected in both the ovary of
hypophysectomized frogs and in the cultured tissue in which total
pituitary homogenate and/or bullfrog gonadotropins were added. It seems
of interest to emphasize the in vivo results, in light of experiments
carried out, to separate the effects of captivity from those caused by
pituitary gland removal. The total mRNA content paralleled that of the
POMC mRNA one; perhaps, in 2-wk hypophysectomized frogs, its increase
could be due to the activation of ovarian transcriptional machinery as
an adaptative response to pituitary gland removal.
In conclusion, the quantification of ovarian POMC gene expression
through a quantitative RT-PCR technique was achieved in the frog
R. esculenta; ovarian POMC gene is involved in the
short-term captivity stress response and seems uninfluenced by
pituitary. Although different results have been found in mammals
(4, 18), the data reported here, in agreement with the
findings by Facchinetti et al. (9) demonstrating (in the
same frog) the local opiate regulation of testicular activity, suggest
the presence of an ovarian opioid system locally regulated in
autocrine/paracrine fashion. That kind of mechanism seems preponderant
at an early stage of the evolutionary tree, while endocrine
communication prevails together with the increasing complexity
occurring during phylogenesis.
| |
ACKNOWLEDGEMENTS |
We thank Dr. H. Hayashi for the frog gonadotropins.
| |
FOOTNOTES |
This study was supported by grants from the University of Camerino and
Ministero dell'Università e della Ricerca Scientifica e
Tecnologica, Italy (to A. M. Polzonetti-Magni).
Address for reprint requests and other correspondence: A. M. Polzonetti-Magni, Dipartimento di Scienze Morfologiche e Biochimiche Comparate, via Camerini 2, 62032 Camerino (MC), Italia
(E-mail: alberta{at}camserv.unicam.it).
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 5 May 1999; accepted in final form 15 December 2000.
| |
REFERENCES |
1.
Carnevali O and Mosconi G. Ovarian opioid system in non-mammalian
vertebrates. In: Trends in Comparative Biochemistry and
Physiology, Research Trends, edited by Brittain T, Huddart H,
Nassel DR, Takeuchi H, and Taylor EW. Trivandrum, India: 1998, vol. 4, p. 227-233.
2.
Chen, CL,
Chang CC,
Krieger DT,
and
Bardin CW.
Expression and regulation of proopiomelanocortin-like gene in the ovary and placenta: comparison with the testis.
Endocrinology
118:
2382-2389,
1986[Abstract].
3.
Chen, CL,
Mather JP,
Morris PL,
and
Bardin CW.
Expression of proopiomelanocortin-like gene in the testis and epididymis.
Proc Natl Acad Sci USA
81:
5672-5675,
1984[Abstract/Free Full Text].
4.
Chen, CLC,
and
Madigan MB.
Regulation of testicular proopiomelanocortin gene expression.
Endocrinology
121:
590-596,
1987[Abstract].
5.
Chomczynski, P,
and
Sacchi N.
Single-step of RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[ISI][Medline].
6.
De Bold, CR,
Nicholson WE,
and
Orth DN.
Immunoreactive proopiomelanocortin (POMC) peptides and POMC-like messenger ribonucleic acid are present in many rat nonpituitary tissues.
Endocrinology
122:
2648-2657,
1988[Abstract].
7.
Eipper, BA,
and
Mains RE.
Structure and function of proadrenocorticotropin/endorphin and related peptides.
Endocr Rev
1:
1-27,
1980[Medline].
8.
Evans, CJ,
Erdelyi E,
Weber E,
and
Barchas JD.
Identification of proopiomelanocortin-derived peptides in the human adrenal medulla.
Science
221:
957-962,
1983[Abstract/Free Full Text].
9.
Facchinetti, F,
Genazzani AR,
Vallarino M,
Pestarino M,
Polzonetti-Magni AM,
Carnevali O,
Ciarcia G,
Fasano S,
D'Antonio M,
and
Pierantoni R.
Opioids and testicular activity in the frog, Rana esculenta.
J Endocrinol
137:
49-57,
1993[Abstract].
10.
Facchinetti, F,
Radi D,
Mosconi G,
Carnevali O,
Pestarino M,
and
Polzonetti-Magni AM.
Acetyl salmon endorphin-like immunoreactivity in the ovary of two teleostean species: changes with environmental condition.
Peptides
18:
957-963,
1997[ISI][Medline].
11.
Farooqui, JZ,
Medrano EE,
Abdel Malek Z,
and
Nordlund J.
The expression of proopiomelanocortin and various POMC-derived peptides in mouse and human skin.
Ann NY Acad Sci
680:
508-510,
1993[ISI][Medline].
12.
Gee, CE,
Chen CLC,
Roberts JL,
Thompson R,
and
Watson SJ.
Identification of proopiomelanocortin neurons in rat hypothalamus by in situ cDNA-RNA hybridization.
Nature
306:
374-376,
1983[Medline].
13.
Hayashi, H,
Hayashi T,
and
Hanaoka Y.
Amphibian lutropin and follitropin from the bullfrog Rana catesbeiana. Complete amino acid sequence of the alpha subunit.
Eur J Biochem
203:
185-191,
1992[ISI][Medline].
14.
Henger, PN.
Quantitative PCR: an accurate measure of mRNA?
Trends Biochem Sci
20:
476-477,
1995[ISI][Medline].
15.
Hilario, E,
Lihrmann I,
and
Vaudry H.
Characterization of the cDNA encoding proopiomelanocortin in the frog Rana ridibunda.
Biochem Biophys Res Commun
173:
653-659,
1990[ISI][Medline].
16.
Jenks, BG,
Leeders HJ,
Martens GJM,
and
Roubos EW.
Adaptation physiology: the functioning of pituitary melanotrope cells during background adaptation of the amphibian Xenopus laevis.
Zoolog Sci
10:
1-11,
1993.
17.
Lundblad, JR,
and
Roberts JL.
Regulation of proopiomelanocortin gene expression in pituitary.
Endocr Rev
9:
135-158,
1988[ISI][Medline].
18.
Melner, MH,
Young SL,
Czerwiec FS,
Lyn D,
Puett D,
Roberts JL,
and
Koos RD.
The regulation of granulosa cell proopiomelanocortin messenger ribonucleic acid by androgens and gonadotropins.
Endocrinology
119:
2082-2088,
1986[Abstract].
19.
Mosconi, G,
Carnevali O,
Facchinetti F,
Neri I,
and
Polzonetti-Magni AM.
Opioid peptide modulation of stress-induced plasma steroid changes in the frog Rana esculenta.
Horm Behav
28:
130-138,
1994[Medline].
20.
Mosconi, G,
Gallinelli A,
Polzonetti-Magni AM,
and
Facchinetti F.
Acetyl salmon endorphin-like and interrenal stress response in male gilthead seabream, Sparus aurata.
Neuroendocrinology
68:
129-134,
1998[ISI][Medline].
21.
Nabissi, M,
Carnevali O,
Soverchia L,
Lihrmann I,
Vaudry H,
and
Polzonetti-Magni AM.
Proopiomelanocortin gene expression in the ovary of the frog, Rana esculenta.
Ann NY Acad Sci
839:
639-641,
1998[Free Full Text].
22.
Nagano, M,
and
Kelly PA.
Tissue distribution and regulation of rat prolactin receptor gene expression.
J Biol Chem
269:
13337-13345,
1994[Abstract/Free Full Text].
23.
Okuta, A,
Ando H,
Ueda H,
and
Urano A.
Two types of cDNAs encoding proopiomelanocortin of sockeye salmon, Oncorhynchus nerka.
Zoolog Sci
13:
421-427,
1996[ISI][Medline].
24.
Orwoll, ES,
and
Kendall C.
-Endorphin and adrenocorticotropin in extrapituitary sites: gastrointestinal tract.
Endocrinology
107:
438-442,
1980[Abstract].
25.
Pintar, JE,
Schacter BS,
Herman AB,
Durgerian S,
and
Krieger DT.
Characterization and localization of proopiomelanocortin messenger RNA in adult rat testis.
Science
225:
632-634,
1984[Abstract/Free Full Text].
26.
Polzonetti-Magni, AM,
Mosconi G,
Carnevali O,
Yamamoto K,
Hanaoka Y,
and
Kikuyama S.
Gonadotropins and reproductive function in the anuran amphibian, Rana esculenta.
Biol Reprod
58:
88-93,
1997[Abstract/Free Full Text].
27.
Saito, E,
and
Odell WD.
Corticotropin/lipotropin common precursor-like material in normal and extrapituitary tissue.
Proc Natl Acad Sci USA
80:
3792-3796,
1983[Abstract/Free Full Text].
28.
Salbert, G,
Chauveau I,
Bonnec G,
Valotaire Y,
and
Jego P.
One of the two trout proopiomelanocortin messenger RNAs potentially encodes new peptides.
Mol Endocrinol
6:
1605-1613,
1992[Abstract].
29.
Sanchez-Franco, F,
Patel YC,
and
Reichin S.
Immunoreactive adrenocorticotropin in the gastrointestinal tract and pancreatic islets of the rat.
Endocrinology
108:
2235-2240,
1981[Abstract].
30.
Scheuermann, RH,
and
Bauer SR.
Polymerase chain reaction-based mRNA. Quantification using an internal standard: analysis of oncogene expression.
Methods Enzymol
218:
446-473,
1993[ISI][Medline].
31.
Thody, AJ,
Ridley K,
Penny RJ,
Chalmers R,
Fisher C,
and
Shuster S.
MSH peptides are present in mammalian skin.
Peptides
4:
813-816,
1983[ISI][Medline].
32.
Wang, A,
Doyle MV,
and
Mark DF.
Quantitation of mRNA by the polymerase chain reaction.
Proc Natl Acad Sci USA
86:
9717-9721,
1989[Abstract/Free Full Text].
Am J Physiol Cell Physiol 280(5):C1038-C1044
0363-6143/01 $5.00
Copyright © 2001 the American Physiological Society
TOP
ABSTRACT
INTRODUCTION
