|
|
||||||||
Departments of Medicine and Pharmacology, University of Vermont, Burlington Vermont 05405
| |
ABSTRACT |
|---|
|
|
|---|
Small conductance Ca2+-activated K+
(SK) channels have been cloned from mammalian brain, but little is
known about the molecular characteristics of SK channels in
nonexcitable tissues. Here, we report the isolation from rat liver of
an isoform of SK3. The sequence of the rat liver isoform differs from
rat brain SK3 in five amino acid residues in the NH3
terminus, where it more closely resembles human brain SK3. SK3
immunoreactivity was detectable in hepatocytes in rat liver and in HTC
rat hepatoma cells. Human embryonic kidney (HEK-293) cells transfected
with liver SK3 expressed 10 pS K+ channels that were
Ca2+ dependent (EC50 630 nM) and were blocked
by the SK channel inhibitor apamin (IC50 0.6 nM); whole
cell SK3 currents inactivated at membrane potentials more positive than
40 mV. Notably, the Ca2+ dependence, apamin sensitivity,
and voltage-dependent inactivation of SK3 are strikingly similar to the
properties of hepatocellular and biliary epithelial SK channels evoked
by metabolic stress. These observations raise the possibility that SK3
channels influence membrane K+ permeability in
hepatobiliary cells during liver injury.
cloning; hepatocytes; immunofluorescence; ion channels; patch clamp; transfection
| |
INTRODUCTION |
|---|
|
|
|---|
SMALL CONDUCTANCE Ca2+-activated K+ (SK) channels serve diverse and critical cellular functions that range from shaping neuronal action potentials to activating lymphocytes (9, 10). Such channels have traditionally been defined by their biophysical and pharmacological profiles, but this viewpoint will likely undergo revision in light of the identification of a family of SK channels (SK1, SK2, SK3) in mammalian brain (10). The structural features of SK1, SK2, and SK3 are highly conserved within the predicted pore-forming region, and heterologous expression studies in Xenopus oocytes and mammalian cells have revealed that SK1 and SK2 currents exhibit similar voltage insensitivity, rectification, and Ca2+ dependence (9, 10, 21).
SK3 is structurally more related to SK2 than to SK1, but it differs considerably in sequence at the amino terminus, where it contains polyglutamine (CAG trinucleotide) repeats. Polymorphisms in the length of these repeats, analogous to those found in neurodegenerative disorders such as Huntington's disease, have been suggested in SK3 to be associated with major psychoses (6), but this association has been controversial (23). Little is known about the functional properties of SK3, and information about its expression in nonneuronal tissues has been limited.
In liver, SK channels have been functionally identified in hepatocytes and hepatobiliary cell lines, where their physiological role has been linked to regulation of plasma membrane permeability in response to Ca2+-mobilizing hormones as well as metabolic stress (4, 12, 25, 26); however, the SK isoforms that participate in these processes have not been identified. Interestingly, the biophysical properties of SK channels activated by metabolic stress (25, 26) differ from those of SK1 and SK2 (10), suggesting that a distinct SK channel is activated under such conditions. Here we report the detection in rat liver of an isoform of SK3. Our findings indicate that the properties of this SK3 isoform are remarkably similar to those of hepatobiliary SK channels that are activated by metabolic stress. These data suggest that SK3 channels may act to sense the metabolic state of the cell and play important protective roles during liver injury.
| |
METHODS |
|---|
|
|
|---|
Cloning of an SK3 isoform from rat liver. Primers designed from the published coding sequence of rat brain SK3 (GenBank AAB81653) were used to amplify, in nested PCR (FailSafe PCR, Epicentre Technologies), cDNA isolated from HTC rat hepatoma cells. The primers used were ATGAGCTCCTGCAAATACAGC and GCAACTGCTTGAACTTGTGTA in the first round of PCR and CTGTTTGAAAAGAGAAAGCGA and CAGGGTGTTGGCTTGGTCACT in the second round. A band migrating at the expected 1059 nucleotides was sequenced to confirm the presence of SK3. RNA was isolated from the livers of male Sprague-Dawley rats by the method of Cathala et al. (5), and the mRNA was isolated through the use of a commercial kit (Message Maker, GIBCO BRL). A cDNA pool was prepared by use of oligo dT primers and Superscript II reverse transcriptase (GIBCO BRL). PCR primers corresponding to the 5' and 3' ends of the full-length coding sequence of rat brain SK3 (ATGGACACTTCTGGGCACTTC and TTAGCAACTGCTTGAACTTGT) were used to amplify the rat liver cDNA with Pfu Turbo DNA polymerase (Stratagene). A 2193 nucleotide PCR product was cloned into the vector pPCR-Script (Stratagene). Both strands of the liver SK3 product were analyzed by automated sequencing (Vermont Cancer Center DNA Analysis Facility). The rat liver SK3 was subcloned from pPCR-Script into the mammalian expression vector pTracer-CMV2 (Invitrogen) via EcoRI and NotI sites. All plasmid DNAs were column purified (Qiagen) before transfection.
Cell culture and transfections. Human embryonic kidney HEK-293 cells (American Type Culture Collection) were cultured in high-glucose DMEM:F-12 HAM with 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine in a humidified 5% CO2 atmosphere. HTC cells were cultured as previously described (13). Transient and stable transfections were performed with NovaFECTOR (VennNova) according to the manufacturer's directions. HEK-293 stable cell lines of SK3-pTracer-CMV2 or empty vector (pTracer-CMV2) were created by selection of transfectants with Zeocin (Invitrogen). Multiple clones were positive by flow cytometry analysis for the vector-encoded green fluorescent protein fusion. For the stable SK3 clones, expression was confirmed by indirect immunofluorescence with anti-SK3 antibody (Alomone) staining and by electrophysiology.
Indirect immunofluorescence. Immunofluorescence studies were performed on cultured cells and on cryosections of rat liver. Cultured cells were split and grown overnight on poly-D-lysine-coated coverslips or chamber slides before fixation. Fixation was performed with 4% formaldehyde (Polysciences) in phosphate-buffered saline (PBS) for 20 min at room temperature, followed by permeabilization (0.2% Triton X-100, 0.3 M sucrose in PBS) for 10 min. Cells were blocked [10% fetal bovine serum (FBS), 1% BSA in PBS] for 1 h at room temperature, washed, and incubated with primary SK3 antibody (Alomone, diluted 1:500 in 1% BSA in PBS) for 1 h at room temperature. The affinity-purified SK3 antibody (Alomone) was raised against amino acids 2-21 in SK3; this sequence is not present in other known SK isoforms. The specificity of the antibody was confirmed in two ways. First, the immunofluorescence signal in all cells studied was competitively blocked with an SK3-antigen peptide (Alomone), used as recommended by the manufacturer (data not shown). Second, HEK-293 cells that overexpressed either SK1 or SK2 did not show an increased fluorescence signal when treated with the SK3 antibody (data not shown).
After incubation with antibody, cells were washed and incubated with fluorophore-conjugated secondary antibody (Jackson Labs, diluted 1:2,000 in 1% BSA in PBS) for 30 min. After the final washes, the coverslips or disassembled chamber slides were mounted with Aqua Polymount (Polysciences), and the slides were kept in the dark at room temperature overnight. Rat liver cryosections (5-µm thickness) were fixed with formaldehyde and stained as above, or, for detection of the plasma membrane Na+-K+-ATPase
1-subunit, they
were fixed with ice-cold methanol and stained according to the
manufacturer's recommendations (Upstate Biotechnology). YOPRO
(Molecular Probes) was employed as a nuclear marker.
Cell imaging techniques. Prepared slides were analyzed on a Biorad MRC 1024 ES laser scanning confocal microscope with the use of T1 and T2A filters in the triple sequential method. Scans of cells or tissues stained with the same antibody were considered comparable when the data were collected at the same iris, gain, and black level settings. Scans of the same section stained with different antibodies were collected at the same iris setting. All data were converted to TIFF format, and the figures were arranged using Adobe Photoshop software without further image processing.
Electrophysiological techniques. Membrane currents were recorded using patch-clamp recording techniques as previously described for HTC hepatoma cells (13, 14). The only modification was that HEK-293 cells were plated on poly-D-lysine-coated glass coverslips 24 h before use and subsequently placed in a perfusion chamber (Warner 26G) on the stage of an inverted microscope equipped with Hoffman modulation contrast optics. Solution changes were made by perfusion at 2 ml/min.
For whole cell recordings, the bath solution contained (in mM): 140 NaCl, 4 KCl, 1 CaCl2, 2 MgCl2, 1 KH2PO4, 10 glucose, and 10 HEPES, pH 7.4. The pipette solution contained (in mM): 10 NaCl, 130 KCl, 2 MgCl2, 1 EGTA, and 10 HEPES (pH 7.30), plus CaCl2 in concentrations calculated using computer-based algorithms (3), to achieve free cytosolic [Ca2+] ([Ca2+]i) between 100 nM and 3 µM. Under these conditions, K+ currents can be reliably measured at a holding potential of 0 mV, the reversal potential for Cl
(7). In selected
experiments, extracellular [K+] was varied by isosmotic
substitution of KCl for NaCl. Reversal potentials in these studies were
measured from membrane currents elicited by voltage ramp protocols (400 ms duration) between
100 and 0 mV. In experiments involving channel
blockade, cells were exposed to solutions containing different
concentrations of blocker, which allowed each cell to serve as its own
control. Percent block B was calculated from the equation
|
| |
RESULTS |
|---|
|
|
|---|
An SK3 channel isoform from rat liver.
Amplification of rat liver cDNA with primers derived from rat brain SK3
yielded a 2193 nucleotide product that corresponds to the first SK3
isoform isolated from liver (GenBank AF284345). The sequence is very
similar to that of the previously documented rat brain isoform
(10), with two deleted CAG repeats and six other
nucleotide differences. Five of these six differences change the
encoded amino acid, and all of these changes are clustered in the
NH3 terminus of the protein (Fig.
1). Of note, four of the five amino acid
changes are identical to the corresponding amino acid in human brain
SK3 isoform (GenBank accession no. AAC26099.1).
|
|
|
Biophysical and pharmacological properties of SK3 currents.
To determine the functional characteristics of SK3, we recorded
membrane currents in HEK-293 cells under conditions in which [Ca2+]i was increased to 1 µM by dialysis
with the patch pipette solution. Cells stably expressing SK3 exhibited
robust membrane currents, which appeared within 1 min after rupture of
the membrane patch (Fig. 4). By contrast,
in cells transfected with vector alone, membrane currents were small
(Fig. 4). Currents in SK3-expressing cells reversed polarity at
approximately
70 mV, close to the reversal potential for
K+ under the ionic conditions employed. This suggested that
the currents were K+ selective. To confirm this, we
examined the influence of varying extracellular [K+] on
the reversal potential of membrane currents. As illustrated in Fig.
5A, the reversal potential
varied linearly as a logarithmic function of extracellular
[K+]. The slope of the line, 50 ± 3 mV
(n = 6), is very close to the value (59 mV) of a
K+-selective current, as predicted by the Nernst equation.
This indicates that SK3 currents correspond to the opening of
K+ channels.
|
|
40 mV, SK3 currents demonstrated little or no inactivation (Fig.
4A), despite the dependence of tail currents on membrane voltage over this range (Fig. 5C). Taken together, these
findings suggest that activation of SK3 channels is voltage dependent. At membrane potentials more positive than
40 mV, currents exhibited slow inactivation (Fig. 4A). Within this range of membrane
potentials, the relation between the rate of inactivation and voltage
was nonlinear (Fig. 5D). The time constant for inactivation
peaked at +20 mV, and it fell approximately twofold at a holding
potential of +100 mV.
Ca2+ dependence of SK3 currents. SK channels are Ca2+ dependent, and SK3 has calmodulin-binding domains that are thought to mediate gating by Ca2+ of the structurally related channel SK2 (27). Expression studies in Xenopus oocytes suggested that macroscopic SK3 currents are also Ca2+ dependent, but this had not been examined at the single channel level. We therefore addressed this issue in SK3-expressing HEK-293 cells.
In excised inside-out membrane patches from SK3-expressing cells, single channel openings exhibited Ca2+ dependence (Fig. 6A), with channel opening rising steeply at bath (cytosolic) [Ca2+] >300 nM (the single channel open probability at
100 mV, n = 3 patches, was 0.006 ± 0.001 at 100 nM, 0.021 ± 0.009 at 300 nM, 0.328 ± 0.186 at 700 nM, and 0.682 ± 0.183 at 1 µM).
No such currents were detected in cells transfected with vector alone
(data not shown). From the current-voltage relation (Fig.
6B), the single channel conductance of SK3 was estimated to
be 10.0 ± 0.15 pS (n = 7). The Ca2+
dependency of whole cell SK3 currents was similar to that of single
channels (Fig. 6C). The half-maximally effective
(EC50) [Ca2+]i was estimated to
be 630 nM, close to that reported in macropatches excised from
SK3-expressing Xenopus oocytes (27). These
findings indicate that the Ca2+ dependence of SK3 is
similar to that of SK1 and SK2.
|
| |
DISCUSSION |
|---|
|
|
|---|
Ca2+-activated K+ channels exhibit broad tissue distribution and have been classified primarily on the basis of their intrinsic conductance. However, other features, including intracellular targeting and voltage sensitivity are likely to be critical determinants in matching channel function to the demands of specific tissues. Traditionally, SK channels have been thought to be voltage independent, and this viewpoint has been supported by examination of the functional properties of SK1 and SK2 (9, 10, 21, 27). Our findings suggest that the isoform of SK3 that we have isolated from liver, although structurally related to SK1 and SK2, is an exception to this general rule.
SK3 transcripts have been previously detected in neurons, striated muscle, and lymph nodes (6, 10, 18, 24), but there has been limited information about SK3 expression outside of brain. In this report, we have shown that SK3 can be detected in liver and HTC hepatoma cells. Consistent with the detection of SK3 message by PCR in these cellular sources, endogenous SK3 immunoreactivity was found in hepatocytes and HTC cells as well. The pattern of intracellular localization of SK3, punctate clusters distributed throughout the cell with occasional discontinuous accumulations at the plasma membrane, was similar in the endogenous sources (HTC cells, hepatocytes in situ) and in the SK3-overexpressing HEK-293 cells. Precedent for such predominantly intracellular localization of a plasma membrane active protein has been documented for both inward rectifier and voltage-gated K+ channels (17, 19, 22), and various mechanisms that permit targeting to the plasma membrane have been described. These mechanisms include incorporation of channel proteins into secretory vesicles, association with auxiliary channel subunits, and interaction with membrane-associated guanylate kinases (1, 15, 17, 20, 22). Whether SK3 channels are recruited to the plasma membrane by analogous or distinct mechanisms remains to be determined.
The rat liver isoform isolated in this work differs very little from the rat brain isoform at the nucleotide level (only 6 of 2,193 bases). Of these six nucleotide differences, five alter the encoded amino acid. Interestingly, these five amino acids all occur in the NH3-terminal region of the molecule, the least conserved region between members of the SK family. The functional significance of these changes is unclear, since four of these five altered amino acids are found in the human brain SK3 sequence. In addition to the six nucleotide changes, two CAG trinucleotide repeats have been deleted from the second polyglutamine stretch in the liver isoform compared with the rat brain isoform. Because the second polyglutamine stretch of human SK3 has been shown to exhibit genetic polymorphism (6), and aberrant phenotypes associated with polyglutamine-containing proteins are found only at repeats of greater length (23), it is not obvious that the loss of two glutamines in this stretch in liver SK3 would alter channel function relative to brain.
The work presented here represents the first characterization of key functional properties of SK3 channels. Like SK1 and SK2, SK3 channels are small conductance, K+ selective, and Ca2+ dependent. In particular, the EC50 for Ca2+ as estimated in this work (630 nM) is similar to that reported for SK channels heterologously expressed in Xenopus oocytes (27). In addition, the apamin sensitivity of SK3 is much closer to that of SK2 than that of SK1 (9, 21). This is not surprising, because the sequences of SK3 and SK2 are nearly identical in the domains thought to confer apamin sensitivity (8).
Although the conductance and Ca2+ sensitivity of SK3
channels are similar to those of SK1 and SK2, SK3 channels exhibit a
distinct voltage dependence. The nonlinear relation between voltage and SK3 whole cell currents does not appear to result from rectification of
single-channel currents (since the single-channel current-voltage relation was linear). Rather, analysis of SK3 tail currents suggests that the nonlinear behavior of whole cell currents is more likely due
to a voltage dependence of channel opening. Previous reported recordings of SK3 currents have been confined to a potential of
80
mV, and such currents have shown no inactivation (27).
Although our observations confirm this, our work extends the analysis
over a broad range of membrane potentials. Specifically, our data
demonstrate voltage-dependent inactivation at potentials more positive
than
40 mV. This is in contrast with SK1 and SK2, which form
voltage-independent channels (10). SK3 currents exhibit
maximum amplitudes at +20 mV and decrease at more positive potentials.
This is likely to be an intrinsic property of SK3 channels and not a
modification of channel gating by putative voltage-dependent changes in
[Ca2+]i in HEK-293 cells. Two lines of
evidence support this view. First, membrane currents in HEK-293 cells
expressing either SK1 or SK2 (which would be similarly affected by any
voltage-modulated changes in [Ca2+]i) do not
display the voltage dependence of SK3 currents observed in the present
study (9, 21). Second, endogenous mechanisms that might
mediate voltage-dependent decay of [Ca2+]i,
such as Ca2+ influx through voltage-gated Ca2+
channels, have not been observed in HEK-293 cells (2).
What might account for the voltage-dependent inactivation of SK3? The amino terminus of SK3, which diverges most in sequence from SK1 and SK2, contains predominantly negatively charged residues, and the time course of inactivation is slower than in N3-type inactivation (i.e., "ball and chain") in which a net positively charged amino terminal domain is thought to block the channel pore upon membrane depolarization (11). Thus it is more likely that other mechanisms, which could involve more subtle voltage-dependent conformational changes near the pore mouth or other carboxy terminal domains (i.e., C-type inactivation) or voltage-dependent block by an intracellular cation, are responsible for the distinct voltage-dependent properties of SK3. Alternatively, the amino terminal sequence differences in SK3 could lead to distinct regulation by kinases and other modulatory factors.
The distinctive voltage dependence and time-dependent inactivation seen in the liver isoform of SK3 are strikingly similar to those of K+ channels activated by chemical hypoxia in hepatoma and biliary cell lines (25, 26). Like SK3, the K+ channels activated under such conditions have been shown to be small conductance, Ca2+ dependent, and apamin sensitive (25, 26). These properties suggest that SK3 channels in liver participate in cellular responses to metabolic stress. If so, the voltage-dependent inactivation in SK3 would limit loss of intracellular K+ during conditions associated with prolonged membrane depolarization as a result of liver injury (16, 28). In this way, SK3 channels could play fundamental roles in hepatic cytoprotection under pathological conditions.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge Drs. Thomas Jetton and Joseph Patlak for helpful discussions, and we thank Drs. Joseph Brayden, Anthony Morielli, Gary Mawe, and Mark Nelson for critically reading the manuscript.
| |
FOOTNOTES |
|---|
This work was supported, in part, by National Institutes of Health Grants DK-47849 (to S. D. Lidofsky) and CA-22435 (Vermont Cancer Center DNA Analysis Facility).
Address for reprint requests and other correspondence: S. Lidofsky, Burgess 414 MFU, Univ. of Vermont, Burlington VT 05401 (steven.lidofsky{at}uvm.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 10 July 2000; accepted in final form 2 November 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arnold, DB,
and
Clapham DE.
Molecular determinants for subcellular localization of PSD-95 with an interacting K+ channel.
Neuron
23:
149-157,
1999[Web of Science][Medline].
2.
Bangalore, R,
Mehrke G,
Gingrich K,
Hofmann F,
and
Kass RS.
Influence of L-type Ca channel
2/
-subunit on ionic and gating current in transiently transfected HEK 293 cells.
Am J Physiol Heart Circ Physiol
270:
H1521-H1528,
1996
3.
Brooks, SP,
and
Storey KB.
Bound and determined: a computer program for making buffers of defined ion concentrations.
Anal Biochem
201:
119-126,
1992[Web of Science][Medline].
4.
Capiod, T,
and
Ogden DC.
The properties of calcium-activated potassium ion channels in guinea-pig isolated hepatocytes.
J Physiol (Lond)
409:
285-295,
1989
5.
Cathala, G,
Savouret JF,
Mendez B,
West BL,
Karin M,
Martial JA,
and
Baxter JD.
A method for isolation of intact, translationally active ribonucleic acid.
DNA (NY)
2:
329-335,
1983[Web of Science][Medline].
6.
Chandy, KG,
Fantino E,
Wittekindt O,
Kalman K,
Tong LL,
Ho TH,
Gutman GA,
Crocq MA,
Ganguli R,
Nimgaonkar V,
Morris-Rosendahl DJ,
and
Gargus JJ.
Isolation of a novel potassium channel gene hSKCa3 containing a polymorphic CAG repeat: a candidate for schizophrenia and bipolar disorder?
Mol Psychiatry
3:
32-37,
1998[Web of Science][Medline].
7.
Fitz, JG,
and
Sostman AH.
Nucleotide receptors activate cation, potassium, and chloride currents in a liver cell line.
Am J Physiol Gastrointest Liver Physiol
266:
G544-G553,
1994
8.
Ishii, TM,
Maylie J,
and
Adelman JP.
Determinants of apamin and D-tubocurarine block in SK potassium channels.
J Biol Chem
272:
23195-23200,
1997
9.
Jager, H,
Adelman JP,
and
Grissmer S.
SK2 encodes the apamin-sensitive Ca2+-activated K+ channels in the human leukemic T cell line, Jurkat.
FEBS Lett
469:
196-202,
2000[Web of Science][Medline].
10.
Kohler, M,
Hirschberg B,
Bond CT,
Kinzie JM,
Marrion NV,
Maylie J,
and
Adelman JP.
Small-conductance, calcium-activated potassium channels from mammalian brain.
Science
273:
1709-1714,
1996
11.
Kukuljan, M,
Labarca P,
and
Latorre R.
Molecular determinants of ion conduction and inactivation in K+ channels.
Am J Physiol Cell Physiol
268:
C535-C556,
1995
12.
Lidofsky, SD.
Convergent and parallel activation of low-conductance potassium channels by calcium and cAMP-dependent protein kinase.
Proc Natl Acad Sci USA
92:
7115-7119,
1995
13.
Lidofsky, SD,
and
Roman RM.
Alanine uptake activates hepatocellular chloride channels.
Am J Physiol Gastrointest Liver Physiol
273:
G849-G853,
1997
14.
Lidofsky, SD,
Sostman A,
and
Fitz JG.
Regulation of cation-selective channels in liver cells.
J Membr Biol
157:
231-236,
1997[Web of Science][Medline].
15.
Lim, ST,
Antonucci DE,
Scannevin RH,
and
Trimmer JS.
A novel targeting signal for proximal clustering of the Kv2.1 K+ channel in hippocampal neurons.
Neuron
25:
385-397,
2000[Web of Science][Medline].
16.
Minei, JP,
Fong Y,
Marano MA,
Moldawer LL,
Jones WG,
Wei H,
Richardson RP,
Yurt RW,
Shires GT, III,
Lowry SF,
and
Shires GT.
Hepatocellular membrane function during chronic burn injury.
J Surg Res
46:
311-316,
1989[Web of Science][Medline].
17.
Morishige, K,
Inanobe A,
Yoshimoto Y,
Kurachi H,
Murata Y,
Tokunaga Y,
Maeda T,
Maruyama Y,
and
Kurachi Y.
Secretagogue-induced exocytosis recruits G protein-gated K+ channels to plasma membrane in endocrine cells.
J Biol Chem
274:
7969-7974,
1999
18.
Pribnow, D,
Johnson-Pais T,
Bond CT,
Keen J,
Johnson RA,
Janowsky A,
Silvia C,
Thayer M,
Maylie J,
and
Adelman JP.
Skeletal muscle and small-conductance calcium-activated potassium channels.
Muscle Nerve
22:
742-750,
1999[Web of Science][Medline].
19.
Reinhardt, J,
Golenhofen N,
Pongs O,
Oberleithner H,
and
Schwab A.
Migrating transformed MDCK cells are able to structurally polarize a voltage-activated K+ channel.
Proc Natl Acad Sci USA
95:
5378-5382,
1998
20.
Shi, G,
Nakahira K,
Hammond S,
Rhodes KJ,
Schechter LE,
and
Trimmer JS.
Beta subunits promote K+ channel surface expression through effects early in biosynthesis.
Neuron
16:
843-852,
1996[Web of Science][Medline].
21.
Strobaek, D,
Jorgensen TD,
Christophersen P,
Ahring PK,
and
Olesen SP.
Pharmacological characterization of small-conductance Ca2+-activated K+ channels stably expressed in HEK 293 cells.
Br J Pharmacol
129:
991-999,
2000[Web of Science][Medline].
22.
Tiffany, AM,
Manganas LN,
Kim E,
Hsueh YP,
Sheng M,
and
Trimmer JS.
PSD-95 and SAP97 exhibit distinct mechanisms for regulating K+ channel surface expression and clustering.
J Cell Biol
148:
147-158,
2000
23.
Vincent, JB,
Paterson AD,
Strong E,
Petronis A,
and
Kennedy JL.
The unstable trinucleotide repeat story of major psychosis.
Am J Med Genet
97:
77-97,
2000[Web of Science][Medline].
24.
Wang, W,
Watanabe M,
Nakamura T,
Kudo Y,
and
Ochi R.
Properties and expression of Ca2+-activated K+ channels in H9c2 cells derived from rat ventricle.
Am J Physiol Heart Circ Physiol
276:
H1559-H1566,
1999
25.
Wang, Y,
Roman R,
Schlenker T,
Hannun YA,
Raymond J,
and
Fitz JG.
Cytosolic Ca2+ and protein kinase C
couple cellular metabolism to membrane K+ permeability in a human biliary cell line.
J Clin Invest
99:
2890-2897,
1997[Web of Science][Medline].
26.
Wang, Y,
Sostman A,
Roman R,
Stribling S,
Vigna S,
Hannun Y,
Raymond J,
and
Fitz JG.
Metabolic stress opens K+ channels in hepatoma cells through a Ca2+- and protein kinase C
-dependent mechanism.
J Biol Chem
271:
18107-18113,
1996
27.
Xia, XM,
Fakler B,
Rivard A,
Wayman G,
Johnson-Pais T,
Keen JE,
Ishii T,
Hirschberg B,
Bond CT,
Lutsenko S,
Maylie J,
and
Adelman JP.
Mechanism of calcium gating in small-conductance calcium-activated potassium channels.
Nature
395:
503-507,
1998[Medline].
28.
Zhang, XK,
Gauthier T,
Burczynski FJ,
Wang GQ,
Gong YW,
and
Minuk GY.
Changes in liver membrane potentials after partial hepatectomy in rats.
Hepatology
23:
549-551,
1996[Web of Science][Medline].
This article has been cited by other articles:
![]() |
M. L. Palmer, K. R. Schiller, and S. M. O'Grady Apical SK potassium channels and Ca2+-dependent anion secretion in endometrial epithelial cells J. Physiol., February 1, 2008; 586(3): 717 - 726. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Tuteja, D. Xu, V. Timofeyev, L. Lu, D. Sharma, Z. Zhang, Y. Xu, L. Nie, A. E Vazquez, J. N. Young, et al. Differential expression of small-conductance Ca2+-activated K+ channels SK1, SK2, and SK3 in mouse atrial and ventricular myocytes Am J Physiol Heart Circ Physiol, December 1, 2005; 289(6): H2714 - H2723. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kolski-Andreaco, H. Tomita, V. G. Shakkottai, G. A. Gutman, M. D. Cahalan, J. J. Gargus, and K. G. Chandy SK3-1C, a Dominant-negative Suppressor of SKCa and IKCa Channels J. Biol. Chem., February 20, 2004; 279(8): 6893 - 6904. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Tamarina, Y. Wang, L. Mariotto, A. Kuznetsov, C. Bond, J. Adelman, and L. H. Philipson Small-Conductance Calcium-Activated K+ Channels Are Expressed in Pancreatic Islets and Regulate Glucose Responses Diabetes, August 1, 2003; 52(8): 2000 - 2006. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Roman, A. P. Feranchak, M. Troetsch, J. C. Dunkelberg, G. Kilic, T. Schlenker, J. Schaack, and J. G. Fitz Molecular characterization of volume-sensitive SKCa channels in human liver cell lines Am J Physiol Gastrointest Liver Physiol, January 1, 2002; 282(1): G116 - G122. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. G. Shakkottai, I. Regaya, H. Wulff, Z. Fajloun, H. Tomita, M. Fathallah, M. D. Cahalan, J. J. Gargus, J.-M. Sabatier, and K. G. Chandy Design and Characterization of a Highly Selective Peptide Inhibitor of the Small Conductance Calcium-activated K+ Channel, SkCa2 J. Biol. Chem., November 9, 2001; 276(46): 43145 - 43151. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hosseini, D. C H Benton, P. M Dunn, D. H Jenkinson, and G. W J Moss SK3 is an important component of K+ channels mediating the afterhyperpolarization in cultured rat SCG neurones J. Physiol., September 1, 2001; 535(2): 323 - 334. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |