|
|
||||||||
1 School of Health Sciences and 2 Centre for Cellular and Molecular Biology, Deakin University, Burwood 3125, Australia; 3 Department of Physiology, Monash University, Clayton 3168, Australia; and 4 Institute of Cell Biology, ETH-Hönggerberg, CH-8093 Zürich, Switzerland
| |
ABSTRACT |
|---|
|
|
|---|
The present study examined the gene
expression and cellular localization of the creatine transporter
(CreaT) protein in rat skeletal muscle. Soleus (SOL) and red (RG) and
white gastrocnemius (WG) muscles were analyzed for CreaT mRNA, CreaT
protein, and total creatine (TCr) content. Cellular location of the
CreaT protein was visualized with immunohistochemical analysis of
muscle cross sections. TCr was higher (P
0.05) in WG
than in both RG and SOL, and was higher in RG than in SOL. Total CreaT
protein content was greater (P
0.05) in SOL and RG
than in WG. Two bands (55 and 70 kDa) of the CreaT protein were found
in all muscle types. Both the 55-kDa (CreaT-55) and the 70-kDa
(CreaT-70) bands were present in greater (P
0.05)
amounts in SOL and RG than in WG. SOL and RG had a greater amount
(P
0.05) of CreaT-55 than CreaT-70. Immunohistochemical analysis revealed that the CreaT was mainly associated with the sarcolemmal membrane in all muscle types. CreaT
mRNA expression per microgram of total RNA was similar across the three
muscle types. These data indicate that rat SOL and RG have an enhanced
potential to transport Cr compared with WG, despite a higher TCr in the latter.
phosphocreatine; metabolism; creatine supplementation.
| |
INTRODUCTION |
|---|
|
|
|---|
CREATINE (Cr) in its free and phosphorylated forms (i.e., creatine phosphate, CrP) plays an important role in skeletal muscle energy provision (48), acid-base regulation (18), and possibly protein synthesis (19). Recent evidence indicates that supplementing the diet with Cr can increase human (9, 16, 39) and rat (1) skeletal intramuscular total creatine content (TCr = Cr + CrP) by ~10-20%. Interestingly, following Cr supplementation, improvements have been observed in muscular dystrophy in mdx mice (33, 36), as well as some neuromuscular diseases (43) including amyotrophic lateral sclerosis (21) and animal models of Huntington's disease (26). Additionally, in healthy human subjects, improvements in muscular strength (45) and high-intensity exercise performance (1, 3) have been observed with dietary Cr supplementation. In humans, the magnitude of muscle TCr content increase following Cr supplementation is quite varied and in some individuals nonexistent (11). In these individuals, a failure to load Cr may preclude any potential beneficial effects of Cr supplementation (39). The mechanism for this variability is unknown but is likely to be related to mechanisms controlling the protein required to transport Cr into muscle cells.
About 90% of Cr uptake in cultured cells occurs by the secondary
active transport of Cr by a specific transporter that is both sodium
(6, 24, 30) and chloride (5, 13) dependent and that belongs to the Na+/Cl
-dependent
neurotransmitter transporter family (28).
Guerrero-Ontiveros and Wallimann (12) demonstrated that
the Cr transporter (CreaT) protein in rat skeletal muscle consists of
two isoforms (CreaT-70 and CreaT-55). Recent findings have revealed
that CreaT-70 seems to be a glycosylated version of CreaT-55
(47). At present it is unclear what, if any, is the
functional significance of the cellular presence of the two forms of
the CreaT protein.
Total intramuscular Cr content depends on the balance of uptake and
efflux of Cr. In vitro studies, with the use of cultured cells
(8, 24, 30), and in vivo human studies (10,
16) clearly indicate that muscle cells are capable of regulating
their intracellular Cr content. The mechanisms by which these cells perform this task are only partially understood. The in vitro data
indicate that the regulation of muscle CreaT activity occurs in several
ways (24, 30). Acute regulation (minutes to hours) of the
CreaT activity involves factors that regulate the sodium concentration
across the muscle cell membrane (30) and factors that may
directly stimulate and/or inhibit the CreaT protein (8, 24, 28,
30). Previous research (8, 23, 24) clearly indicates that at least some of the CreaT protein must be located at
the sarcolemma; however, no studies have been conducted to determine
the existence of an intracellular CreaT protein pool. The existence of
an intracellular pool would leave open the possibility that acute CreaT
regulation may also involve movement of the protein to and from the
sarcolemma, as in the case of the GLUT-4 (glucose) transporter
translocation (22). Additionally, chronic regulation (days
to weeks) of the CreaT may occur in rat skeletal muscle by altering the
number of transporters expressed by the cell (12). Importantly, CreaT content in rat quadriceps muscle is attenuated after
chronic Cr feeding, whereas chronic ingestion of the Cr analog
-guanidinoproprionic acid resulted in an upregulation of CreaT
protein content (12). Interestingly, in failing
human myocardium as well as in experimental heart failure, both of
which are paralleled by generally lowered TCr levels, CreaT protein expression is downregulated (29).
Because Cr supplementation has been shown to result in an increase in muscle Cr content (1) as well as attenuation in the content of the CreaT (12), intramuscular Cr content may be a regulator in the amount of transporter protein present within muscle. This raises the possibility that there are differences in the CreaT content in predominantly glycolytic (type IIb) and oxidative (type I and IIa) rat muscle because glycolytic muscle has a greater basal Cr content than oxidative muscle (1, 20, 41, 42). Alternatively, there may be alterations in the expression of the two isoforms of the transporter between the different fiber types. Interestingly, a recent study (32) reported that, after Cr loading in rats, TCr content was increased in soleus muscle (SOL; predominantly type I fibers) but was not altered in white gastrocnemius muscle (WG; predominantly type IIb fibers). Furthermore, using incubated rat muscle strips, Willott et al. (49) demonstrated that, at normal extracellular Cr concentrations (e.g., 100 µM), SOL displayed a greater rate of Cr uptake than the extensor digitorum longus muscle (EDL; predominantly type IIb and IIx fibers). However, at high extracellular Cr levels (1 mM), the rate of Cr uptake was similar between both muscles. It was concluded that SOL had a lower Michaelis-Menten constant (Km) for Cr uptake than did the EDL; however, the maximal Cr uptake rate between the two muscles was similar. These authors suggested that the differences in Cr uptake between the fiber types could not be explained at the level of CreaT expression because of the similar maximal rates of Cr uptake. These findings remain uncertain because Willott et al. (49) did not analyze for differences between fast- and slow-twitch muscles and their content of CreaT-55 and CreaT-70. Differential expression of these isoforms may explain their kinetic data.
The major aims of the present study were to determine the content of CreaT protein isoforms between the predominantly oxidative and glycolytic muscle in rat, as well as the localization of the protein. Furthermore, this study aimed to determine whether any differences in CreaT protein content between primarily oxidative and glycolytic muscle could be explained by alterations in the levels of CreaT mRNA.
| |
METHODS |
|---|
|
|
|---|
Animals and muscle sampling. Male Wistar rats (n = 6, 16-22 wk of age) were kept under standard laboratory conditions (12:12-h light-dark cycle, ad libitum standard lab chow) and immediately killed after having been anesthetized with chloroform. Portions of the SOL (40-100 mg), red gastrocnemius (RG; 80-120 mg), and WG (80-100 mg) muscles were rapidly dissected and snap-frozen in liquid N2 within 5 min of death. A further portion was aligned, mounted in embedding matrix (Tissue Tek Oct), and frozen in isopentane cooled by liquid N2 for subsequent immunohistochemical analysis. In addition, a portion of the plantaris muscle (PL; n = 1) was treated as just described. The first portions of muscle were cut under liquid N2, weighed, and divided for subsequent analyses of TCr, CreaT protein, and CreaT mRNA.
Enzymatic assays. Muscle samples were freeze dried for 24 h, weighed, and powdered, removing any visible connective tissue. The samples were extracted with 0.5 M perchloric acid and 1 mM EDTA, neutralized with 2.1 M KHCO3 (15), and assayed enzymatically with the use of fluorometric detection (25) to determine Cr and CrP levels. TCr content was taken as the sum of these two metabolites.
Immunoblotting.
Muscle samples (15-40 mg) were hyposmotically swelled in 2-3
volumes of ice-cold deionized, distilled water for 15 min. The same
volume of extraction buffer (50 mM sodium dihydrophosphate monohydrate,
10 mM 2-mercaptoethanol, pH 8.8, and freshly added 1% Triton-X 100)
was added, and the samples were homogenized (Polytron PT1200;
Kinematica, Luzern, Switzerland) for ~10 s. Samples were then
incubated on ice for 60-90 min before being spun at 10,000 g at 4°C for 10 min. The supernatant was collected, and an
aliquot was set aside for subsequent total protein analysis (BCA Assay Kit; Pierce, Rockford, IL) with bovine serum albumin (BSA) as the
standard, whereas the remainder was stored at
80°C until further
analysis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis was
performed by using a Multiphor II (Pharmacia Biotech, Uppsala, Sweden)
system. Denatured protein (25 µg) was loaded onto 7.5% gels, and
after electrophoresis (50 mA, 80 min), the protein was semi-dry
transferred to 0.45-µm nitrocellulose membrane (50 mA, 90 min). The
membrane was placed in a blocking buffer comprising 5% skim milk
powder in Tris-buffered saline and 0.25% Tween (TBST) for 2 h and
exposed overnight at 4°C to the NH2- and COOH-terminal anti-CreaT antibodies (12) diluted 1:8,000 in blocking
buffer. After several washes in blocking buffer, the horseradish
peroxidase-conjugated secondary antibody (anti-rabbit) was applied
(1:10,000 dilution in blocking buffer) for 60 min. After four washes in
TBST, the membrane was placed in chemiluminescent substrate (Pierce
SuperSignal Chemiluminescent) for 60 s and then exposed to
light-sensitive film (Kodak BioMax Light) for 2 min and developed
(FPM100A; Fuji, Tokyo, Japan). Band density was analyzed with the use
of Kodak 1D software.
Immunohistochemistry.
From the second frozen portion of muscle, 10-µm sections were
sectioned at
16°C, mounted on microscope slides, and stored at
80°C. When the samples had been thawed, the sections were fixed in
4% paraformaldehyde, and after a series of washes [twice for 5 min in
phosphate-buffered saline (PBS), once for 10 min in 5% Triton X-100,
and twice for 5 min in PBS], nonspecific binding sites were blocked by
overnight incubation with 3% BSA at 4°C. For double labeling, the
sections were incubated with the primary antibodies: rabbit anti-CreaT
antibody (12), diluted 1:2000 in 1% BSA, and mouse
anti-muscle myosin heavy chain 1 (MHC1) monoclonal antibody (Chemicon
International, Temecula, CA), diluted 1:500 in 1% BSA overnight at
4°C. After PBS washes (twice 5 min), sections were incubated with the
secondary antibodies: FITC-conjugated anti-rabbit antibody (Silenus;
Amrad Biotech, Boronia, Australia) and Texas Red-conjugated anti-mouse
antibody (Molecular Probes, Eugene, OR), both diluted 1:200 in 1% BSA
for 90 min. Negative control sections followed the above protocol
except that they were incubated with preimmune serum diluted 1:2,000 in
1% BSA for the second overnight incubation period. A drop of
Fluoroguard (Bio-Rad, Hercules, CA) was added to the sections, and a
coverslip was applied. Epifluorescence was viewed with an Olympus AX70
microscope with an UplanFL ×20 0.5-NA objective. Digital images were
collected (Pulnix TM-6CN monochrome charge-coupled device camera;
Optimas 5.2 software). For single labeling, the procedure was the same as described above except that only anti-CreaT primary antibody was
applied and confocal laser images were collected with an Olympus BX50
microscope with a PlanApo ×60 1.4-NA oil-immersion objective. Images were collected with the use of Optiscan F900E software.
Real-time PCR.
Total RNA was extracted from frozen muscle by using a modification of
the acid guanidinium thiocyanate-phenol-chloroform extraction (RNAzol
B; TelTest, Friendswood, TX). Tissue was homogenized (Polytron X-100)
in RNAzol B (20-40 mg/500 µl) for ~10 s. The final RNA pellet
was resuspended in 10-15 µl of RNase-free water. Total RNA
concentration was determined spectrophotometrically at 260 nm, and
samples were treated with DNase (DNase I, amplification grade, catalog
no. 18047-019; Life Technologies, Gaithersburg, MD). Oligo(dT)
single-stranded DNA was synthesized by using AMV reverse transcriptase
(kit A3500; Promega, Madison, WI) according to the manufacturer's
instructions. Primers complementary to selected regions of the gene
encoding for the CreaT (GenBank accession no. L31409) were designed to
produce a single 86-bp product with the use of Primer Express software
(PE Biosystems, Foster City, CA). The forward primer sequence (5'-3')
was GCCGGCAGCATCAATGTC, and the reverse primer sequence (5'-3') was
GGTGTTGCAGTAGAAGACGATCAC. Real-time RT-PCR (GeneAmp 7700 Sequence
Detection System; PE Biosystems) was set up by using 25-µl reaction
volumes of SYBR Green Buffer (PE Biosystems), 3 µM forward primer, 3 µM reverse primer, and 1 ng of cDNA template per tube. Measurements
included a no-template control where no cDNA template was added to the
sample tube. Primers specific to the rat
-actin gene (forward primer
sequence, GACAGGATGCAGAAGGAGATTACT; reverse primer sequence,
TGATCCACATCTGCTGGAAGGT) were used as the control to account for any
variations due to efficiencies of the RT and PCR steps. Real Time
RT-PCR was run for 1 cycle (50°C for 2 min, 95°C for 10 min) and 40 cycles (95°C for 15 s, 60°C for 60 s), and
fluorescence was measured after each of the repetitive cycles. The
fluorescence resulted from the incorporation of SYBR green dye into the
double-stranded DNA produced during the PCR reaction. Products were run
on a 1.8% agarose gel, stained with ethidium bromide, and visualized
under ultraviolet light to confirm that only a single product was
present. CreaT PCR product was purified with the use of centri-step
columns (Princeton Separations, Adelphia, NJ), and DNA sequence was
confirmed on an ABI Prism model 373 Sequencer (PE Biosystems). The
real-time data were analyzed as previously described (17).
Statistics.
The results were analyzed with BioMedical Data Processing software, and
ANOVA was used to analyze differences between tissue types.
Newman-Keuls post hoc analysis was used to locate differences among
means when the ANOVA revealed that significant differences existed. The
level of statistical significance was set at P
0.05.
| |
RESULTS |
|---|
|
|
|---|
The TCr contents for the different fiber types are displayed in
Fig. 1. TCr was greater
(P
0.05) in WG than in both RG and SOL, and RG had a
greater (P
0.05) TCr content than SOL. Immunoblots revealed greater (P
0.05) total CreaT protein
content in SOL and RG than in WG (Figs. 2
and 3A). Both
CreaT-55 and CreaT-70 were present in greater (P
0.05) amounts in SOL and RG than in WG (Fig. 3B). SOL and RG
had a greater amount (P
0.05) of CreaT-55 than
CreaT-70. Immunohistochemistry located the CreaT protein primarily at
the sarcolemma of all muscle fiber types (Figs.
4-6), with
some internal fluorescent signal evident (Fig. 6). The MHC1 analysis revealed that the
percent composition of type I fibers was estimated to be 81, 52, and
0% for the SOL, RG, and WG, respectively (Fig. 4). The negative
controls for both the CreaT (Fig. 7) and
MHC1 (data not shown) immunohistochemical analysis produced no or very
little signal compared with experimental conditions, thereby indicating
the specificity of the technique. Real-time RT-PCR analysis revealed no
differences among the expression of mRNA in SOL, RG, and WG when
equivalent amounts of RNA were analyzed (Fig.
8).
|
|
|
|
|
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In the present study, we have demonstrated for the first time
that, in rat, expression of the CreaT protein is greater in the
predominantly oxidative SOL and RG than in the predominantly glycolytic
WG skeletal muscle. These results indicate that rat SOL and RG muscle
may have an enhanced potential to transport Cr compared with WG. This
finding is consistent with previous research that has reported a
greater accumulation of TCr in rat slow-twitch compared with
fast-twitch muscle following Cr supplementation (32).
While we have found that the CreaT protein is associated with the
sarcolemma in both type I and II fibers, some internal staining is
evident. Further research is required to identify the intracellular
structures with which the protein may be associated. Furthermore, we
have also demonstrated that the content of two identified isoforms
(CreaT-55 and CreaT-70) differed within and among muscles. Additional
investigations are required to understand the functional significance
of these findings. Finally, we have reported that for a given amount of
total RNA, the CreaT mRNA content, when normalized for
-actin, was
not different among the SOL, RG, and WG.
In the present study, a lower abundance (Fig. 3A) of total CreaT protein was seen in WG than in the SOL and RG. Because the SOL and RG contain very few type IIb fibers, while the WG consists almost exclusively of type IIb fibers (7), these data indicate that the CreaT protein content is attenuated in type IIb fibers compared with the other fiber types. At least for the SOL and WG, these data also support the concept that an elevation in intracellular Cr results in a decreased expression of the CreaT protein. Our data (Fig. 1) and those of others (20, 41, 42) demonstrate that WG muscle has a greater TCr content than SOL, with RG displaying intermediate TCr levels. Unfortunately, we were unable to determine basal Cr levels in the present study because of minor delays in tissue sampling (~5 min after death). Nevertheless, previous research has found that Cr levels in the various muscles follow the same pattern as observed for TCr (20, 41, 42). This is probably important, because intracellular Cr rather than CrP levels are involved in acutely regulating Cr uptake (8, 23). Although no data are available, it is reasonable to assume that Cr, rather than CrP, may also act as the initial signal to alter CreaT expression. Our findings are also consistent with the work of Guerrero-Ontiveros and Wallimann (12), who found a reduced CreaT protein content in the rat hindlimb muscles following chronic high-dose Cr supplementation. As previously mentioned, Cr supplementation would be expected to result in an increase in muscle Cr content (1). The mechanism by which an elevation in intracellular Cr downregulates gene expression is unknown. An attractive hypothesis, however, may be offered: AMP-activated protein kinase (AMPK), an important enzyme in regulation of muscle energy pathways, is the first enzyme, besides creatine kinase, that has been shown recently to respond to the Cr/CrP ratio (35). Thus, via an elevation of total free Cr content, activated AMPK may initiate a signaling pathway leading to alterations in gene expression.
Interestingly, the RG CreaT protein content does not fit neatly into the theory that intracellular Cr is the sole signal controlling CreaT protein content. As mentioned above, RG is expected to have an intermediate Cr level compared with SOL and WG, but this is not reflected in the amount of CreaT protein given the similar levels observed in RG and SOL. It is unclear why this is the case; however, one possibility may lie in the fact that the RG consists of a mixture of type IIa (35%), type IIx (13%), and type I (51%) muscle fibers, whereas the SOL and WG are predominantly composed of type I and IIb fibers, respectively. In the RG, the type II fibers are likely to have the higher intracellular Cr content, resulting in an elevated Cr in the whole muscle section, but the presence of a large percentage of type I fibers may mask any reduction in CreaT protein content.
Our data indicate that the proportion of CreaT-55 and CreatT-70, thought to represent different glycosylation states of the CreaT (47), varies between muscle types (Fig. 3B). There is a greater amount of CreaT-55 compared with CreaT-70 in the SOL and RG fibers. In the WG, there was a trend (P = 0.08) for greater amounts of CreaT-70 than CreaT-55. Although no information specific to the CreaT is available about the functional significance of glycosylation, it has been suggested that variations in glycosylation sites between the taurine subfamily of proteins to which the CreaT belongs may contribute to the heterogeneity between these transmembrane transporters (40). The majority of plasma membrane proteins are glycosylated, and the role of these covalently bound carbohydrate units is varied (46), with N-linked glycosylation being associated with various functions, including stability (44), rate of activity (31), folding (46), and maturing of functional proteins (27). Alternatively, the presence of glycosylation may not necessarily alter protein function (2). It is clear that further work needs to be undertaken to determine the function of glycosylation in the regulation of the CreaT in skeletal muscle.
We have also demonstrated that the CreaT is associated predominantly
with the sarcolemma (Fig. 4). Previous in vitro studies have shown that
the plasma membrane is a site of regulation of Cr uptake (8, 24,
28, 30) and, hence, is at least one of the locations of CreaT.
Though our data confirm the sarcolemmal location of the CreaT, they
also indicate the detection of some internal fluorescence (Fig. 6).
With the use of the current technique, however, it is not possible for
this signal to be located to a particular organelle. Further
investigation is required to identify whether the protein is associated
with specific intracellular structure(s). Such examination may
ascertain whether acute translocation of the transporter is a possible
mechanism regulating CreaT activity. Interestingly, other transporters
from the taurine subfamily (e.g.,
-aminobutyric acid, betaine, and
taurine) have been shown in vitro to translocate away from
(37) or toward (4, 38) the plasma membrane in
response to acute activation of protein kinase C (PKC) by phorbol
12-myristate 13-acetate (PMA). In cultured cells expressing the CreaT
protein, a 15% decrease (28) to almost complete loss
(5) of Cr uptake was observed after incubation with PMA,
although a direct effect of PMA on the CreaT could not be determined.
Whether or not activation of PKC results in movement of the CreaT
within the cell is not known.
The immunoblotting technique on whole muscle sections revealed no difference in the CreaT protein content in the SOL and RG muscles, but these muscles displayed a higher CreaT content compared with the WG (Fig. 3A). As mentioned above, these data indicate that type IIb fibers have fewer CreaT than type I, IIa, and IIx muscle fibers. In support of the whole muscle analysis, there are no obvious differences in CreaT signal intensity surrounding the type I and II fibers in the SOL and RG sections. The type II fibers in these sections are highly likely to be IIa or IIx, but not IIb, fibers (7). Although the fluorescence intensity surrounding the fibers in the WG section appears to be less than that of the other muscle sections, such a comparison is not valid because comparisons can only be made across single sections that contain both type I and IIb fibers (34). To ascertain whether such differences could be detected by using the employed immunohistochemical analysis, we probed PL sections. The PL was chosen because it is a muscle that has a reasonable percentage of all the fiber types (7). No attenuation of signal could be observed around any particular fibers (Fig. 5).
Traditionally, mRNA content for any given gene is measured from an
equalized amount of total RNA and expressed as a ratio to a
constitutively expressed housekeeping gene. In the present study,
highly sensitive real-time RT-PCR technology was utilized to determine
the relative abundance of the CreaT gene relative to
-actin
(17). The
-actin gene was used as a proxy measure of
the mRNA abundance in the sample, because RNA extraction protocols do
not allow quantitative extraction of either total RNA or mRNA (R. Murphy and R. Snow, unpublished observations). Hence, in the current study it is not possible to express CreaT mRNA content relative
to either total RNA or mRNA in the skeletal muscle sample or, indeed,
relative to the sample mass. When CreaT mRNA content was expressed
relative to the commonly used housekeeping gene
-actin, no
differences in apparent CreaT mRNA were demonstrated among SOL, RG, and
WG. This is in contrast to a study in which CreaT mRNA was measured, by
using the Northern blot technique, in glycolytic compared with slow
oxidative fibers in the rabbit, where there appeared to be a greater
CreaT mRNA content in the glycolytic muscle (13).
Differences in methodology and species may explain these discrepancies.
A recent study (14) indicates that there is about a
fivefold increase in the total RNA content of type I fibers compared with type IIb fibers, with intermediate levels in both IIa and IIx
fibers in rat skeletal muscle. In that study (14), the use of single fibers and biochemical RNA analysis permitted the
quantitative analysis of total RNA. The mRNA levels of
housekeeping genes reflected these differences in total RNA among the
fiber types. Because data derived from the real-time RT-PCR methodology
can only be validly expressed as a ratio of the CreaT to a housekeeping
gene (e.g.,
-actin), we can only speculate that the total quantity of CreaT mRNA is greater in the predominantly type I SOL than in the
predominantly type IIb WG muscle. This finding, in turn, may suggest a
greater capacity for CreaT protein synthesis in SOL compared with WG.
The finding of increased CreaT abundance in the SOL compared with the
WG indicates that if degradation rates between fibers do not differ,
then there is an increased rate of synthesis matched by the absolute
increase in CreaT mRNA. Further analysis of transcription rate or CreaT
turnover is required to determine which interpretation is valid.
In conclusion, the present study has demonstrated that CreaT protein expression is greater in SOL and RG than in WG muscle, indicating that the more oxidative muscles have a greater potential for more rapid Cr uptake. Whether these differences are reflected at the gene transcription level is open to interpretation. We have also shown that, while the CreaT is associated primarily with the sarcolemma in all fiber types, some intracellular stores may be evident. Future studies need to be undertaken to determine the functional significance of the CreaT-55 and CreaT-70 isoforms and the mechanisms regulating the differential expression of these forms of the protein in the various muscles investigated.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Megan Wallace and Ian Phillips, Dept. of Physiology, Monash University, for assistance in the immunoblotting techniques; Dr. Kelly Windmill, School of Health Sciences, for assistance with the real-time RT-PCR applications; and Stephen Firth and Agnes Michalczyk, Centre for Cellular and Molecular Biology, School of Biological and Chemical Sciences, Deakin University.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: R. J. Snow, School of Health Sciences, Deakin Univ., Burwood 3125 Australia (E-mail: rsnow{at}deakin.edu.au).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 27 April 2000; accepted in final form 15 September 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Brannon, TA,
Adams GR,
Conniff CL,
and
Baldwin KM.
Effects of creatine loading and training on running performance and biochemical properties of rat skeletal muscle.
Med Sci Sports Exerc
29:
489-495,
1997[ISI][Medline].
2.
Carpenter, L,
Poole RC,
and
Halestrap AP.
Cloning and sequencing of the monocarboxylate transporter from mouse Ehrlich Lettre tumour cell confirms its identity as MCT1 and demonstrates that glycosylation is not required for MCT1 function.
Biochim Biophys Acta
1279:
157-163,
1996[Medline].
3.
Casey, A,
Constantin Teodosiu D,
Howell S,
Hultman E,
and
Greenhaff PL.
Creatine ingestion favorably affects performance and muscle metabolism during maximal exercise in humans.
Am J Physiol Endocrinol Metab
271:
E31-E37,
1996
4.
Corey, JL,
Davidson N,
Lester HA,
Brecha N,
and
Quick MW.
Protein kinase C modulates the activity of a cloned gamma-aminobutyric acid transporter expressed in Xenopus oocytes via regulated subcellular redistribution of the transporter.
J Biol Chem
269:
14759-14767,
1994
5.
Dai, WX,
Vinnakota S,
Qian XJ,
Kunze DL,
and
Sarkar HK.
Molecular characterization of the human CRT-1 creatine transporter expressed in Xenopus oocytes.
Arch Biochem Biophys
361:
75-84,
1999[ISI][Medline].
6.
Daly, MM,
and
Seifter S.
Uptake of creatine by cultured cells.
Arch Biochem Biophys
203:
317-324,
1980[ISI][Medline].
7.
Delp, MD,
and
Duan C.
Composition and size of type I, IIA, IID/X, and IIB fibers and citrate synthase activity of rat muscle.
J Appl Physiol
80:
261-270,
1996
8.
Dodd, JR,
Zheng T,
and
Christie DL.
Creatine accumulation and exchange by HEK293 cells stably expressing high levels of creatine transporter.
Biochim Biophys Acta
1472:
128-136,
1999[Medline].
9.
Green, AL,
Hultman E,
Macdonald IA,
Sewell DA,
and
Greenhaff PL.
Carbohydrate ingestion augments skeletal muscle creatine accumulation during creatine supplementation in humans.
Am J Physiol Endocrinol Metab
271:
E821-E826,
1996
10.
Green, AL,
Simpson EJ,
Littlewood JJ,
Macdonald IA,
and
Greenhaff PL.
Carbohydrate ingestion augments creatine retention during creatine feeding in humans.
Acta Physiol Scand
158:
195-202,
1996[ISI][Medline].
11.
Greenhaff, PL,
Bodin K,
Soderlund K,
and
Hultman E.
Effect of oral creatine supplementation on skeletal muscle phosphocreatine resynthesis.
Am J Physiol Endocrinol Metab
266:
E725-E730,
1994
12.
Guerrero-Ontiveros, ML,
and
Wallimann T.
Creatine supplementation in health and disease. Effects of chronic creatine ingestion in vivo: down-regulation of the expression of creatine transporter isoforms in skeletal muscle.
Mol Cell Biochem
184:
427-437,
1998[ISI][Medline].
13.
Guimbal, C,
and
Kilimann MW.
A Na+-dependent creatine transporter in rabbit brain, muscle, heart, and kidney. cDNA cloning and functional expression.
J Biol Chem
268:
8418-8421,
1993
14.
Habets, PE,
Franco D,
Ruijter JM,
Sargeant AJ,
Pereira JA,
and
Moorman AF.
RNA content differs in slow and fast muscle fibers: implications for interpretation of changes in muscle gene expression.
J Histochem Cytochem
47:
995-1004,
1999
15.
Harris, RC,
Hultman E,
and
Nordesjo LO.
Glycogen, glycolytic intermediates and high-energy phosphates determined in biopsy samples of musculus quadriceps femoris of man at rest. Methods and variance of values.
Scand J Clin Lab Invest
33:
109-120,
1974[ISI][Medline].
16.
Harris, RC,
Soderlund K,
and
Hultman E.
Elevation of creatine in resting and exercised muscle of normal subjects by creatine supplementation.
Clin Sci (Colch)
83:
367-374,
1992[Medline].
17.
Heid, CA,
Stevens J,
Livak KJ,
and
Williams PM.
Real time quantitative PCR.
Genome Res
6:
986-994,
1996
18.
Hultman, E,
and
Sahlin K.
Acid-base balance during exercise.
Exerc Sport Sci Rev
8:
41-127,
1980[Medline].
19.
Ingwall, JS.
Creatine and the control of muscle-specific protein synthesis in cardiac and skeletal muscle.
Circ Res
38:
115-123,
1976
20.
Kelso, TB,
Hodgson DR,
Visscher AR,
and
Gollnick PD.
Some properties of different skeletal muscle fiber types: comparison of reference bases.
J Appl Physiol
62:
1436-1441,
1987
21.
Klivenyi, P,
Ferrante RJ,
Matthews RT,
Bogdanov MB,
Klein AM,
Andreassen OA,
Mueller G,
Wermer M,
Kaddurah Daouk R,
and
Beal MF.
Neuroprotective effects of creatine in a transgenic animal model of amyotrophic lateral sclerosis.
Nat Med
5:
347-350,
1999[ISI][Medline].
22.
Kristiansen, S,
Hargreaves M,
and
Richter EA.
Exercise-induced increase in glucose transport, GLUT-4, and VAMP-2 in plasma membrane from human muscle.
Am J Physiol Endocrinol Metab
270:
E197-E201,
1996
23.
Loike, JD,
Somes M,
and
Silverstein SC.
Creatine uptake, metabolism, and efflux in human monocytes and macrophages.
Am J Physiol Cell Physiol
251:
C128-C135,
1986
24.
Loike, JD,
Zalutsky DL,
Kaback E,
Miranda AF,
and
Silverstein SC.
Extracellular creatine regulates creatine transport in rat and human muscle cells.
Proc Natl Acad Sci USA
85:
807-811,
1988
25.
Lowry, OH,
and
Passoneau JV.
A Flexible System of Enzymatic Analysis. New York: Academic, 1972.
26.
Matthews, RT,
Yang L,
Jenkins BG,
Ferrante RJ,
Rosen BR,
Kaddurah Daouk R,
and
Beal MF.
Neuroprotective effects of creatine and cyclocreatine in animal models of Huntington's disease.
J Neurosci
18:
156-163,
1998
27.
Mitsumoto, Y,
and
Klip A.
Development regulation of the subcellular distribution and glycosylation of GLUT1 and GLUT4 glucose transporters during myogenesis of L6 muscle cells.
J Biol Chem
267:
4957-4962,
1992
28.
Nash, SR,
Giros B,
Kingsmore SF,
Rochelle JM,
Suter ST,
Gregor P,
Seldin MF,
and
Caron MG.
Cloning, pharmacological characterization, and genomic localization of the human creatine transporter.
Receptors Channels
2:
165-174,
1994[ISI][Medline].
29.
Neubauer, S,
Remkes H,
Spindler M,
Horn M,
Wiesmann F,
Prestle J,
Walzel B,
Ertl G,
Hasenfuss G,
and
Wallimann T.
Downregulation of the Na+-creatine cotransporter in failing human myocardium and in experimental heart failure.
Circulation
100:
1847-1850,
1999
30.
Odoom, JE,
Kemp GJ,
and
Radda GK.
The regulation of total creatine content in a myoblast cell line.
Mol Cell Biochem
158:
179-188,
1996[ISI][Medline].
31.
Olivares, L,
Aragon C,
Gimenez C,
and
Zafra F.
The role of N-glycosylation in the targeting and activity of the GLYT1 glycine transporter.
J Biol Chem
270:
9437-9442,
1995
32.
Op't Eijnde, R,
Richter EA,
Kiens B,
and
Hespel P.
Effect of creatine on glucose disposal in rat skeletal muscle.
J Sports Sci
17:
561-562,
1999.
33.
Passaquin A, Renard M, Kay L, Challet C, Mokhtarian A, Wallimann T, and
Ruegg U. Creatine supplementation reduces skeletal muscle
degeneration and enhances mitochondrial function in mdx mice.
Neuromus Dis. In press.
34.
Pilegaard, H,
Terzis G,
Halestrap A,
and
Juel C.
Distribution of the lactate/H+ transporter isoforms MCT1 and MCT4 in human skeletal muscle.
Am J Physiol Endocrinol Metab
276:
E843-E848,
1999
35.
Ponticos, M,
Lu QL,
Morgan JE,
Hardie DG,
Partridge TA,
and
Carling D.
Dual regulation of the AMP-activated protein kinase provides a novel mechanism for the control of creatine kinase in skeletal muscle.
EMBO J
17:
1688-1699,
1998[ISI][Medline].
36.
Pulido, SM,
Passaquin AC,
Leijendekker WJ,
Challet C,
Wallimann T,
and
Ruegg UT.
Creatine supplementation improves intracellular Ca2+ handling and survival in mdx skeletal muscle cells.
FEBS Lett
439:
357-362,
1998[ISI][Medline].
37.
Qian, Y,
Galli A,
Ramamoorthy S,
Risso S,
DeFelice LJ,
and
Blakely RD.
Protein kinase C activation regulates human serotonin transporters in HEK-293 cells via altered cell surface expression.
J Neurosci
17:
45-57,
1997
38.
Quick, MW,
Corey JL,
Davidson N,
and
Lester HA.
Second messengers, trafficking-related proteins, and amino acid residues that contribute to the functional regulation of the rat brain GABA transporter GAT1.
J Neurosci
17:
2967-2979,
1997
39.
Snow, RJ,
McKenna MJ,
Selig SE,
Kemp J,
Stathis CG,
and
Zhao S.
Effect of creatine supplementation on sprint exercise performance and muscle metabolism.
J Appl Physiol
84:
1667-1673,
1998
40.
Sora, I,
Richman J,
Santoro G,
Wei H,
Wang Y,
Vanderah T,
Horvath R,
Nguyen M,
Waite S,
Roeske WR,
and
Yamamura HI.
The cloning and expression of a human creatine transporter.
Biochem Biophys Res Commun
204:
419-427,
1994[ISI][Medline].
41.
Spriet, LL.
Anaerobic ATP provision, glycogenolysis and glycolysis in rat slow-twitch muscle during tetanic contractions.
Pflügers Arch
417:
278-284,
1990[ISI][Medline].
42.
Spriet, LL.
ATP utilization and provision in fast-twitch skeletal muscle during tetanic contractions.
Am J Physiol Endocrinol Metab
257:
E595-E605,
1989
43.
Tarnopolsky, M,
and
Martin J.
Creatine monohydrate increases strength in patients with neuromuscular disease.
Neurology
52:
854-857,
1999
44.
Tate, CG,
and
Blakely RD.
The effect of N-linked glycosylation on activity of the Na+- and Cl
-dependent serotonin transporter expressed using recombinant baculovirus in insect cells.
J Biol Chem
269:
26303-26310,
1994
45.
Vandenberghe, K,
Goris M,
Van Heck P,
Van Leemputte M,
Vangerven L,
and
Hespel P.
Long-term creatine intake is beneficial to muscle performance during resistance training.
J Appl Physiol
83:
2055-2063,
1997
46.
Varki, A.
Biological roles of oligosaccharides.
Glycobiology
3:
97-130,
1993
47.
Wallimann, T,
Schlattner U,
Guerrero L,
and
Dolder M.
The phosphocreatine circuit and creatine supplementation, both come of age!
In: Guanidino Compounds, edited by Mori A,
Ishida M,
and Clark JF.. Carlton South, Victoria, Australia: Blackwell Science Asia, 1999, vol. 5, p. 117-129.
48.
Wallimann, T,
Wyss M,
Brdiczka D,
Nicolay K,
and
Eppenberger HM.
Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the `phosphocreatine circuit' for cellular energy homeostasis.
Biochem J
281:
21-40,
1992.
49.
Willott, CA,
Young ME,
Leighton B,
Kemp GJ,
Boehm EA,
Radda GK,
and
Clarke K.
Creatine uptake in isolated soleus muscle: kinetics and dependence on sodium, but not on insulin.
Acta Physiol Scand
166:
99-104,
1999[ISI][Medline].
This article has been cited by other articles:
![]() |
J. J. Brault, K. A. Abraham, and R. L. Terjung Muscle creatine uptake and creatine transporter expression in response to creatine supplementation and depletion J Appl Physiol, June 1, 2003; 94(6): 2173 - 2180. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Brault and R. L. Terjung Creatine uptake and creatine transporter expression among rat skeletal muscle fiber types Am J Physiol Cell Physiol, June 1, 2003; 284(6): C1481 - C1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Walzel, O. Speer, E. Boehm, S. Kristiansen, S. Chan, K. Clarke, J. P. Magyar, E. A. Richter, and T. Wallimann New creatine transporter assay and identification of distinct creatine transporter isoforms in muscle Am J Physiol Endocrinol Metab, August 1, 2002; 283(2): E390 - E401. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wang, M. A. Jobst, B. Bell, C.-R. Zhao, L.-H. Shang, and D. O. Jacobs Cr supplementation decreases tyrosine phosphorylation of the CreaT in skeletal muscle during sepsis Am J Physiol Endocrinol Metab, May 1, 2002; 282(5): E1046 - E1054. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |