Am J Physiol Cell Physiol Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 280: C415-C422, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murphy, R.
Right arrow Articles by Snow, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murphy, R.
Right arrow Articles by Snow, R.
Vol. 280, Issue 3, C415-C422, March 2001

Creatine transporter protein content, localization, and gene expression in rat skeletal muscle

R. Murphy1, G. McConell3, D. Cameron-Smith1, K. Watt1, L. Ackland2, B. Walzel4, T. Wallimann4, and R. Snow1

1 School of Health Sciences and 2 Centre for Cellular and Molecular Biology, Deakin University, Burwood 3125, Australia; 3 Department of Physiology, Monash University, Clayton 3168, Australia; and 4 Institute of Cell Biology, ETH-Hönggerberg, CH-8093 Zürich, Switzerland


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The present study examined the gene expression and cellular localization of the creatine transporter (CreaT) protein in rat skeletal muscle. Soleus (SOL) and red (RG) and white gastrocnemius (WG) muscles were analyzed for CreaT mRNA, CreaT protein, and total creatine (TCr) content. Cellular location of the CreaT protein was visualized with immunohistochemical analysis of muscle cross sections. TCr was higher (P <=  0.05) in WG than in both RG and SOL, and was higher in RG than in SOL. Total CreaT protein content was greater (P <=  0.05) in SOL and RG than in WG. Two bands (55 and 70 kDa) of the CreaT protein were found in all muscle types. Both the 55-kDa (CreaT-55) and the 70-kDa (CreaT-70) bands were present in greater (P <=  0.05) amounts in SOL and RG than in WG. SOL and RG had a greater amount (P <=  0.05) of CreaT-55 than CreaT-70. Immunohistochemical analysis revealed that the CreaT was mainly associated with the sarcolemmal membrane in all muscle types. CreaT mRNA expression per microgram of total RNA was similar across the three muscle types. These data indicate that rat SOL and RG have an enhanced potential to transport Cr compared with WG, despite a higher TCr in the latter.

phosphocreatine; metabolism; creatine supplementation.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

CREATINE (Cr) in its free and phosphorylated forms (i.e., creatine phosphate, CrP) plays an important role in skeletal muscle energy provision (48), acid-base regulation (18), and possibly protein synthesis (19). Recent evidence indicates that supplementing the diet with Cr can increase human (9, 16, 39) and rat (1) skeletal intramuscular total creatine content (TCr = Cr + CrP) by ~10-20%. Interestingly, following Cr supplementation, improvements have been observed in muscular dystrophy in mdx mice (33, 36), as well as some neuromuscular diseases (43) including amyotrophic lateral sclerosis (21) and animal models of Huntington's disease (26). Additionally, in healthy human subjects, improvements in muscular strength (45) and high-intensity exercise performance (1, 3) have been observed with dietary Cr supplementation. In humans, the magnitude of muscle TCr content increase following Cr supplementation is quite varied and in some individuals nonexistent (11). In these individuals, a failure to load Cr may preclude any potential beneficial effects of Cr supplementation (39). The mechanism for this variability is unknown but is likely to be related to mechanisms controlling the protein required to transport Cr into muscle cells.

About 90% of Cr uptake in cultured cells occurs by the secondary active transport of Cr by a specific transporter that is both sodium (6, 24, 30) and chloride (5, 13) dependent and that belongs to the Na+/Cl--dependent neurotransmitter transporter family (28). Guerrero-Ontiveros and Wallimann (12) demonstrated that the Cr transporter (CreaT) protein in rat skeletal muscle consists of two isoforms (CreaT-70 and CreaT-55). Recent findings have revealed that CreaT-70 seems to be a glycosylated version of CreaT-55 (47). At present it is unclear what, if any, is the functional significance of the cellular presence of the two forms of the CreaT protein.

Total intramuscular Cr content depends on the balance of uptake and efflux of Cr. In vitro studies, with the use of cultured cells (8, 24, 30), and in vivo human studies (10, 16) clearly indicate that muscle cells are capable of regulating their intracellular Cr content. The mechanisms by which these cells perform this task are only partially understood. The in vitro data indicate that the regulation of muscle CreaT activity occurs in several ways (24, 30). Acute regulation (minutes to hours) of the CreaT activity involves factors that regulate the sodium concentration across the muscle cell membrane (30) and factors that may directly stimulate and/or inhibit the CreaT protein (8, 24, 28, 30). Previous research (8, 23, 24) clearly indicates that at least some of the CreaT protein must be located at the sarcolemma; however, no studies have been conducted to determine the existence of an intracellular CreaT protein pool. The existence of an intracellular pool would leave open the possibility that acute CreaT regulation may also involve movement of the protein to and from the sarcolemma, as in the case of the GLUT-4 (glucose) transporter translocation (22). Additionally, chronic regulation (days to weeks) of the CreaT may occur in rat skeletal muscle by altering the number of transporters expressed by the cell (12). Importantly, CreaT content in rat quadriceps muscle is attenuated after chronic Cr feeding, whereas chronic ingestion of the Cr analog beta -guanidinoproprionic acid resulted in an upregulation of CreaT protein content (12). Interestingly, in failing human myocardium as well as in experimental heart failure, both of which are paralleled by generally lowered TCr levels, CreaT protein expression is downregulated (29).

Because Cr supplementation has been shown to result in an increase in muscle Cr content (1) as well as attenuation in the content of the CreaT (12), intramuscular Cr content may be a regulator in the amount of transporter protein present within muscle. This raises the possibility that there are differences in the CreaT content in predominantly glycolytic (type IIb) and oxidative (type I and IIa) rat muscle because glycolytic muscle has a greater basal Cr content than oxidative muscle (1, 20, 41, 42). Alternatively, there may be alterations in the expression of the two isoforms of the transporter between the different fiber types. Interestingly, a recent study (32) reported that, after Cr loading in rats, TCr content was increased in soleus muscle (SOL; predominantly type I fibers) but was not altered in white gastrocnemius muscle (WG; predominantly type IIb fibers). Furthermore, using incubated rat muscle strips, Willott et al. (49) demonstrated that, at normal extracellular Cr concentrations (e.g., 100 µM), SOL displayed a greater rate of Cr uptake than the extensor digitorum longus muscle (EDL; predominantly type IIb and IIx fibers). However, at high extracellular Cr levels (1 mM), the rate of Cr uptake was similar between both muscles. It was concluded that SOL had a lower Michaelis-Menten constant (Km) for Cr uptake than did the EDL; however, the maximal Cr uptake rate between the two muscles was similar. These authors suggested that the differences in Cr uptake between the fiber types could not be explained at the level of CreaT expression because of the similar maximal rates of Cr uptake. These findings remain uncertain because Willott et al. (49) did not analyze for differences between fast- and slow-twitch muscles and their content of CreaT-55 and CreaT-70. Differential expression of these isoforms may explain their kinetic data.

The major aims of the present study were to determine the content of CreaT protein isoforms between the predominantly oxidative and glycolytic muscle in rat, as well as the localization of the protein. Furthermore, this study aimed to determine whether any differences in CreaT protein content between primarily oxidative and glycolytic muscle could be explained by alterations in the levels of CreaT mRNA.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and muscle sampling. Male Wistar rats (n = 6, 16-22 wk of age) were kept under standard laboratory conditions (12:12-h light-dark cycle, ad libitum standard lab chow) and immediately killed after having been anesthetized with chloroform. Portions of the SOL (40-100 mg), red gastrocnemius (RG; 80-120 mg), and WG (80-100 mg) muscles were rapidly dissected and snap-frozen in liquid N2 within 5 min of death. A further portion was aligned, mounted in embedding matrix (Tissue Tek Oct), and frozen in isopentane cooled by liquid N2 for subsequent immunohistochemical analysis. In addition, a portion of the plantaris muscle (PL; n = 1) was treated as just described. The first portions of muscle were cut under liquid N2, weighed, and divided for subsequent analyses of TCr, CreaT protein, and CreaT mRNA.

Enzymatic assays. Muscle samples were freeze dried for 24 h, weighed, and powdered, removing any visible connective tissue. The samples were extracted with 0.5 M perchloric acid and 1 mM EDTA, neutralized with 2.1 M KHCO3 (15), and assayed enzymatically with the use of fluorometric detection (25) to determine Cr and CrP levels. TCr content was taken as the sum of these two metabolites.

Immunoblotting. Muscle samples (15-40 mg) were hyposmotically swelled in 2-3 volumes of ice-cold deionized, distilled water for 15 min. The same volume of extraction buffer (50 mM sodium dihydrophosphate monohydrate, 10 mM 2-mercaptoethanol, pH 8.8, and freshly added 1% Triton-X 100) was added, and the samples were homogenized (Polytron PT1200; Kinematica, Luzern, Switzerland) for ~10 s. Samples were then incubated on ice for 60-90 min before being spun at 10,000 g at 4°C for 10 min. The supernatant was collected, and an aliquot was set aside for subsequent total protein analysis (BCA Assay Kit; Pierce, Rockford, IL) with bovine serum albumin (BSA) as the standard, whereas the remainder was stored at -80°C until further analysis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis was performed by using a Multiphor II (Pharmacia Biotech, Uppsala, Sweden) system. Denatured protein (25 µg) was loaded onto 7.5% gels, and after electrophoresis (50 mA, 80 min), the protein was semi-dry transferred to 0.45-µm nitrocellulose membrane (50 mA, 90 min). The membrane was placed in a blocking buffer comprising 5% skim milk powder in Tris-buffered saline and 0.25% Tween (TBST) for 2 h and exposed overnight at 4°C to the NH2- and COOH-terminal anti-CreaT antibodies (12) diluted 1:8,000 in blocking buffer. After several washes in blocking buffer, the horseradish peroxidase-conjugated secondary antibody (anti-rabbit) was applied (1:10,000 dilution in blocking buffer) for 60 min. After four washes in TBST, the membrane was placed in chemiluminescent substrate (Pierce SuperSignal Chemiluminescent) for 60 s and then exposed to light-sensitive film (Kodak BioMax Light) for 2 min and developed (FPM100A; Fuji, Tokyo, Japan). Band density was analyzed with the use of Kodak 1D software.

Immunohistochemistry. From the second frozen portion of muscle, 10-µm sections were sectioned at -16°C, mounted on microscope slides, and stored at -80°C. When the samples had been thawed, the sections were fixed in 4% paraformaldehyde, and after a series of washes [twice for 5 min in phosphate-buffered saline (PBS), once for 10 min in 5% Triton X-100, and twice for 5 min in PBS], nonspecific binding sites were blocked by overnight incubation with 3% BSA at 4°C. For double labeling, the sections were incubated with the primary antibodies: rabbit anti-CreaT antibody (12), diluted 1:2000 in 1% BSA, and mouse anti-muscle myosin heavy chain 1 (MHC1) monoclonal antibody (Chemicon International, Temecula, CA), diluted 1:500 in 1% BSA overnight at 4°C. After PBS washes (twice 5 min), sections were incubated with the secondary antibodies: FITC-conjugated anti-rabbit antibody (Silenus; Amrad Biotech, Boronia, Australia) and Texas Red-conjugated anti-mouse antibody (Molecular Probes, Eugene, OR), both diluted 1:200 in 1% BSA for 90 min. Negative control sections followed the above protocol except that they were incubated with preimmune serum diluted 1:2,000 in 1% BSA for the second overnight incubation period. A drop of Fluoroguard (Bio-Rad, Hercules, CA) was added to the sections, and a coverslip was applied. Epifluorescence was viewed with an Olympus AX70 microscope with an UplanFL ×20 0.5-NA objective. Digital images were collected (Pulnix TM-6CN monochrome charge-coupled device camera; Optimas 5.2 software). For single labeling, the procedure was the same as described above except that only anti-CreaT primary antibody was applied and confocal laser images were collected with an Olympus BX50 microscope with a PlanApo ×60 1.4-NA oil-immersion objective. Images were collected with the use of Optiscan F900E software.

Real-time PCR. Total RNA was extracted from frozen muscle by using a modification of the acid guanidinium thiocyanate-phenol-chloroform extraction (RNAzol B; TelTest, Friendswood, TX). Tissue was homogenized (Polytron X-100) in RNAzol B (20-40 mg/500 µl) for ~10 s. The final RNA pellet was resuspended in 10-15 µl of RNase-free water. Total RNA concentration was determined spectrophotometrically at 260 nm, and samples were treated with DNase (DNase I, amplification grade, catalog no. 18047-019; Life Technologies, Gaithersburg, MD). Oligo(dT) single-stranded DNA was synthesized by using AMV reverse transcriptase (kit A3500; Promega, Madison, WI) according to the manufacturer's instructions. Primers complementary to selected regions of the gene encoding for the CreaT (GenBank accession no. L31409) were designed to produce a single 86-bp product with the use of Primer Express software (PE Biosystems, Foster City, CA). The forward primer sequence (5'-3') was GCCGGCAGCATCAATGTC, and the reverse primer sequence (5'-3') was GGTGTTGCAGTAGAAGACGATCAC. Real-time RT-PCR (GeneAmp 7700 Sequence Detection System; PE Biosystems) was set up by using 25-µl reaction volumes of SYBR Green Buffer (PE Biosystems), 3 µM forward primer, 3 µM reverse primer, and 1 ng of cDNA template per tube. Measurements included a no-template control where no cDNA template was added to the sample tube. Primers specific to the rat beta -actin gene (forward primer sequence, GACAGGATGCAGAAGGAGATTACT; reverse primer sequence, TGATCCACATCTGCTGGAAGGT) were used as the control to account for any variations due to efficiencies of the RT and PCR steps. Real Time RT-PCR was run for 1 cycle (50°C for 2 min, 95°C for 10 min) and 40 cycles (95°C for 15 s, 60°C for 60 s), and fluorescence was measured after each of the repetitive cycles. The fluorescence resulted from the incorporation of SYBR green dye into the double-stranded DNA produced during the PCR reaction. Products were run on a 1.8% agarose gel, stained with ethidium bromide, and visualized under ultraviolet light to confirm that only a single product was present. CreaT PCR product was purified with the use of centri-step columns (Princeton Separations, Adelphia, NJ), and DNA sequence was confirmed on an ABI Prism model 373 Sequencer (PE Biosystems). The real-time data were analyzed as previously described (17).

Statistics. The results were analyzed with BioMedical Data Processing software, and ANOVA was used to analyze differences between tissue types. Newman-Keuls post hoc analysis was used to locate differences among means when the ANOVA revealed that significant differences existed. The level of statistical significance was set at P <=  0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The TCr contents for the different fiber types are displayed in Fig. 1. TCr was greater (P <=  0.05) in WG than in both RG and SOL, and RG had a greater (P <=  0.05) TCr content than SOL. Immunoblots revealed greater (P <=  0.05) total CreaT protein content in SOL and RG than in WG (Figs. 2 and 3A). Both CreaT-55 and CreaT-70 were present in greater (P <=  0.05) amounts in SOL and RG than in WG (Fig. 3B). SOL and RG had a greater amount (P <=  0.05) of CreaT-55 than CreaT-70. Immunohistochemistry located the CreaT protein primarily at the sarcolemma of all muscle fiber types (Figs. 4-6), with some internal fluorescent signal evident (Fig. 6). The MHC1 analysis revealed that the percent composition of type I fibers was estimated to be 81, 52, and 0% for the SOL, RG, and WG, respectively (Fig. 4). The negative controls for both the CreaT (Fig. 7) and MHC1 (data not shown) immunohistochemical analysis produced no or very little signal compared with experimental conditions, thereby indicating the specificity of the technique. Real-time RT-PCR analysis revealed no differences among the expression of mRNA in SOL, RG, and WG when equivalent amounts of RNA were analyzed (Fig. 8).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1.   Total creatine (TCr) content in rat soleus (SOL), red gastrocnemius (RG), and white gastrocnemius (WG) skeletal muscle. Values are means ± SE (n = 6). *P < 0.05 vs. WG. #P < 0.05 vs. SOL.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 2.   Representative immunoblot of the creatine transporter protein isoforms in rat SOL, RG, and WG skeletal muscle. Values at left indicate molecular mass of bands.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   Total creatine transporter (CreaT) protein (A) and amounts of 55- (solid bars) and 70-kDa isoforms (hatched bars) (B) measured as net band density in rat SOL, RG, and WG skeletal muscle. Values are means ± SE (n = 6). *P < 0.05 vs. WG. # P < 0.05 vs. 70-kDa isoform.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 4.   Epifluorescence (×20 amplification) of 10-µm cross sections of SOL, RG, and WG rat tissue. A: detection of CreaT protein using FITC-conjugated secondary antibody. B: detection of myosin heavy chain 1 (MHC1) protein using Texas Red-conjugated secondary antibody. Type I fibers are labeled (I) according to MHC1 antibody detection.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 5.   Epifluorescence (×20 amplification) of 10-µm cross sections of rat plantaris muscle. A: detection of CreaT protein using FITC-conjugated secondary antibody. B: detection of MHC1 protein using Texas Red-conjugated secondary antibody. Type I fibers are labeled according to MHC1 antibody detection.



View larger version (135K):
[in this window]
[in a new window]
 
Fig. 6.   Confocal images (×60 amplification, oil objective) of 10-µm longitudinal sections of rat SOL muscle. Detection of CreaT protein using FITC-conjugated secondary antibody.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 7.   Epifluorescence (×40 amplification) of 10-µm cross sections of rat SOL muscle. Detection of rabbit preimmune serum (1:2,000; negative control) (A) or CreaT (B) using FITC-conjugated secondary antibody.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 8.   Real-time RT-PCR analysis of CreaT mRNA in rat SOL, RG, and WG muscles. Values are means ± SE expressed relative to beta -actin expression and were determined with 1 ng of cDNA in the reaction tube.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In the present study, we have demonstrated for the first time that, in rat, expression of the CreaT protein is greater in the predominantly oxidative SOL and RG than in the predominantly glycolytic WG skeletal muscle. These results indicate that rat SOL and RG muscle may have an enhanced potential to transport Cr compared with WG. This finding is consistent with previous research that has reported a greater accumulation of TCr in rat slow-twitch compared with fast-twitch muscle following Cr supplementation (32). While we have found that the CreaT protein is associated with the sarcolemma in both type I and II fibers, some internal staining is evident. Further research is required to identify the intracellular structures with which the protein may be associated. Furthermore, we have also demonstrated that the content of two identified isoforms (CreaT-55 and CreaT-70) differed within and among muscles. Additional investigations are required to understand the functional significance of these findings. Finally, we have reported that for a given amount of total RNA, the CreaT mRNA content, when normalized for beta -actin, was not different among the SOL, RG, and WG.

In the present study, a lower abundance (Fig. 3A) of total CreaT protein was seen in WG than in the SOL and RG. Because the SOL and RG contain very few type IIb fibers, while the WG consists almost exclusively of type IIb fibers (7), these data indicate that the CreaT protein content is attenuated in type IIb fibers compared with the other fiber types. At least for the SOL and WG, these data also support the concept that an elevation in intracellular Cr results in a decreased expression of the CreaT protein. Our data (Fig. 1) and those of others (20, 41, 42) demonstrate that WG muscle has a greater TCr content than SOL, with RG displaying intermediate TCr levels. Unfortunately, we were unable to determine basal Cr levels in the present study because of minor delays in tissue sampling (~5 min after death). Nevertheless, previous research has found that Cr levels in the various muscles follow the same pattern as observed for TCr (20, 41, 42). This is probably important, because intracellular Cr rather than CrP levels are involved in acutely regulating Cr uptake (8, 23). Although no data are available, it is reasonable to assume that Cr, rather than CrP, may also act as the initial signal to alter CreaT expression. Our findings are also consistent with the work of Guerrero-Ontiveros and Wallimann (12), who found a reduced CreaT protein content in the rat hindlimb muscles following chronic high-dose Cr supplementation. As previously mentioned, Cr supplementation would be expected to result in an increase in muscle Cr content (1). The mechanism by which an elevation in intracellular Cr downregulates gene expression is unknown. An attractive hypothesis, however, may be offered: AMP-activated protein kinase (AMPK), an important enzyme in regulation of muscle energy pathways, is the first enzyme, besides creatine kinase, that has been shown recently to respond to the Cr/CrP ratio (35). Thus, via an elevation of total free Cr content, activated AMPK may initiate a signaling pathway leading to alterations in gene expression.

Interestingly, the RG CreaT protein content does not fit neatly into the theory that intracellular Cr is the sole signal controlling CreaT protein content. As mentioned above, RG is expected to have an intermediate Cr level compared with SOL and WG, but this is not reflected in the amount of CreaT protein given the similar levels observed in RG and SOL. It is unclear why this is the case; however, one possibility may lie in the fact that the RG consists of a mixture of type IIa (35%), type IIx (13%), and type I (51%) muscle fibers, whereas the SOL and WG are predominantly composed of type I and IIb fibers, respectively. In the RG, the type II fibers are likely to have the higher intracellular Cr content, resulting in an elevated Cr in the whole muscle section, but the presence of a large percentage of type I fibers may mask any reduction in CreaT protein content.

Our data indicate that the proportion of CreaT-55 and CreatT-70, thought to represent different glycosylation states of the CreaT (47), varies between muscle types (Fig. 3B). There is a greater amount of CreaT-55 compared with CreaT-70 in the SOL and RG fibers. In the WG, there was a trend (P = 0.08) for greater amounts of CreaT-70 than CreaT-55. Although no information specific to the CreaT is available about the functional significance of glycosylation, it has been suggested that variations in glycosylation sites between the taurine subfamily of proteins to which the CreaT belongs may contribute to the heterogeneity between these transmembrane transporters (40). The majority of plasma membrane proteins are glycosylated, and the role of these covalently bound carbohydrate units is varied (46), with N-linked glycosylation being associated with various functions, including stability (44), rate of activity (31), folding (46), and maturing of functional proteins (27). Alternatively, the presence of glycosylation may not necessarily alter protein function (2). It is clear that further work needs to be undertaken to determine the function of glycosylation in the regulation of the CreaT in skeletal muscle.

We have also demonstrated that the CreaT is associated predominantly with the sarcolemma (Fig. 4). Previous in vitro studies have shown that the plasma membrane is a site of regulation of Cr uptake (8, 24, 28, 30) and, hence, is at least one of the locations of CreaT. Though our data confirm the sarcolemmal location of the CreaT, they also indicate the detection of some internal fluorescence (Fig. 6). With the use of the current technique, however, it is not possible for this signal to be located to a particular organelle. Further investigation is required to identify whether the protein is associated with specific intracellular structure(s). Such examination may ascertain whether acute translocation of the transporter is a possible mechanism regulating CreaT activity. Interestingly, other transporters from the taurine subfamily (e.g., gamma -aminobutyric acid, betaine, and taurine) have been shown in vitro to translocate away from (37) or toward (4, 38) the plasma membrane in response to acute activation of protein kinase C (PKC) by phorbol 12-myristate 13-acetate (PMA). In cultured cells expressing the CreaT protein, a 15% decrease (28) to almost complete loss (5) of Cr uptake was observed after incubation with PMA, although a direct effect of PMA on the CreaT could not be determined. Whether or not activation of PKC results in movement of the CreaT within the cell is not known.

The immunoblotting technique on whole muscle sections revealed no difference in the CreaT protein content in the SOL and RG muscles, but these muscles displayed a higher CreaT content compared with the WG (Fig. 3A). As mentioned above, these data indicate that type IIb fibers have fewer CreaT than type I, IIa, and IIx muscle fibers. In support of the whole muscle analysis, there are no obvious differences in CreaT signal intensity surrounding the type I and II fibers in the SOL and RG sections. The type II fibers in these sections are highly likely to be IIa or IIx, but not IIb, fibers (7). Although the fluorescence intensity surrounding the fibers in the WG section appears to be less than that of the other muscle sections, such a comparison is not valid because comparisons can only be made across single sections that contain both type I and IIb fibers (34). To ascertain whether such differences could be detected by using the employed immunohistochemical analysis, we probed PL sections. The PL was chosen because it is a muscle that has a reasonable percentage of all the fiber types (7). No attenuation of signal could be observed around any particular fibers (Fig. 5).

Traditionally, mRNA content for any given gene is measured from an equalized amount of total RNA and expressed as a ratio to a constitutively expressed housekeeping gene. In the present study, highly sensitive real-time RT-PCR technology was utilized to determine the relative abundance of the CreaT gene relative to beta -actin (17). The beta -actin gene was used as a proxy measure of the mRNA abundance in the sample, because RNA extraction protocols do not allow quantitative extraction of either total RNA or mRNA (R. Murphy and R. Snow, unpublished observations). Hence, in the current study it is not possible to express CreaT mRNA content relative to either total RNA or mRNA in the skeletal muscle sample or, indeed, relative to the sample mass. When CreaT mRNA content was expressed relative to the commonly used housekeeping gene beta -actin, no differences in apparent CreaT mRNA were demonstrated among SOL, RG, and WG. This is in contrast to a study in which CreaT mRNA was measured, by using the Northern blot technique, in glycolytic compared with slow oxidative fibers in the rabbit, where there appeared to be a greater CreaT mRNA content in the glycolytic muscle (13). Differences in methodology and species may explain these discrepancies.

A recent study (14) indicates that there is about a fivefold increase in the total RNA content of type I fibers compared with type IIb fibers, with intermediate levels in both IIa and IIx fibers in rat skeletal muscle. In that study (14), the use of single fibers and biochemical RNA analysis permitted the quantitative analysis of total RNA. The mRNA levels of housekeeping genes reflected these differences in total RNA among the fiber types. Because data derived from the real-time RT-PCR methodology can only be validly expressed as a ratio of the CreaT to a housekeeping gene (e.g., beta -actin), we can only speculate that the total quantity of CreaT mRNA is greater in the predominantly type I SOL than in the predominantly type IIb WG muscle. This finding, in turn, may suggest a greater capacity for CreaT protein synthesis in SOL compared with WG. The finding of increased CreaT abundance in the SOL compared with the WG indicates that if degradation rates between fibers do not differ, then there is an increased rate of synthesis matched by the absolute increase in CreaT mRNA. Further analysis of transcription rate or CreaT turnover is required to determine which interpretation is valid.

In conclusion, the present study has demonstrated that CreaT protein expression is greater in SOL and RG than in WG muscle, indicating that the more oxidative muscles have a greater potential for more rapid Cr uptake. Whether these differences are reflected at the gene transcription level is open to interpretation. We have also shown that, while the CreaT is associated primarily with the sarcolemma in all fiber types, some intracellular stores may be evident. Future studies need to be undertaken to determine the functional significance of the CreaT-55 and CreaT-70 isoforms and the mechanisms regulating the differential expression of these forms of the protein in the various muscles investigated.


    ACKNOWLEDGEMENTS

We thank Drs. Megan Wallace and Ian Phillips, Dept. of Physiology, Monash University, for assistance in the immunoblotting techniques; Dr. Kelly Windmill, School of Health Sciences, for assistance with the real-time RT-PCR applications; and Stephen Firth and Agnes Michalczyk, Centre for Cellular and Molecular Biology, School of Biological and Chemical Sciences, Deakin University.


    FOOTNOTES

Address for reprint requests and other correspondence: R. J. Snow, School of Health Sciences, Deakin Univ., Burwood 3125 Australia (E-mail: rsnow{at}deakin.edu.au).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 27 April 2000; accepted in final form 15 September 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Brannon, TA, Adams GR, Conniff CL, and Baldwin KM. Effects of creatine loading and training on running performance and biochemical properties of rat skeletal muscle. Med Sci Sports Exerc 29: 489-495, 1997[ISI][Medline].

2.   Carpenter, L, Poole RC, and Halestrap AP. Cloning and sequencing of the monocarboxylate transporter from mouse Ehrlich Lettre tumour cell confirms its identity as MCT1 and demonstrates that glycosylation is not required for MCT1 function. Biochim Biophys Acta 1279: 157-163, 1996[Medline].

3.   Casey, A, Constantin Teodosiu D, Howell S, Hultman E, and Greenhaff PL. Creatine ingestion favorably affects performance and muscle metabolism during maximal exercise in humans. Am J Physiol Endocrinol Metab 271: E31-E37, 1996[Abstract/Free Full Text].

4.   Corey, JL, Davidson N, Lester HA, Brecha N, and Quick MW. Protein kinase C modulates the activity of a cloned gamma-aminobutyric acid transporter expressed in Xenopus oocytes via regulated subcellular redistribution of the transporter. J Biol Chem 269: 14759-14767, 1994[Abstract/Free Full Text].

5.   Dai, WX, Vinnakota S, Qian XJ, Kunze DL, and Sarkar HK. Molecular characterization of the human CRT-1 creatine transporter expressed in Xenopus oocytes. Arch Biochem Biophys 361: 75-84, 1999[ISI][Medline].

6.   Daly, MM, and Seifter S. Uptake of creatine by cultured cells. Arch Biochem Biophys 203: 317-324, 1980[ISI][Medline].

7.   Delp, MD, and Duan C. Composition and size of type I, IIA, IID/X, and IIB fibers and citrate synthase activity of rat muscle. J Appl Physiol 80: 261-270, 1996[Abstract/Free Full Text].

8.   Dodd, JR, Zheng T, and Christie DL. Creatine accumulation and exchange by HEK293 cells stably expressing high levels of creatine transporter. Biochim Biophys Acta 1472: 128-136, 1999[Medline].

9.   Green, AL, Hultman E, Macdonald IA, Sewell DA, and Greenhaff PL. Carbohydrate ingestion augments skeletal muscle creatine accumulation during creatine supplementation in humans. Am J Physiol Endocrinol Metab 271: E821-E826, 1996[Abstract/Free Full Text].

10.   Green, AL, Simpson EJ, Littlewood JJ, Macdonald IA, and Greenhaff PL. Carbohydrate ingestion augments creatine retention during creatine feeding in humans. Acta Physiol Scand 158: 195-202, 1996[ISI][Medline].

11.   Greenhaff, PL, Bodin K, Soderlund K, and Hultman E. Effect of oral creatine supplementation on skeletal muscle phosphocreatine resynthesis. Am J Physiol Endocrinol Metab 266: E725-E730, 1994[Abstract/Free Full Text].

12.   Guerrero-Ontiveros, ML, and Wallimann T. Creatine supplementation in health and disease. Effects of chronic creatine ingestion in vivo: down-regulation of the expression of creatine transporter isoforms in skeletal muscle. Mol Cell Biochem 184: 427-437, 1998[ISI][Medline].

13.   Guimbal, C, and Kilimann MW. A Na+-dependent creatine transporter in rabbit brain, muscle, heart, and kidney. cDNA cloning and functional expression. J Biol Chem 268: 8418-8421, 1993[Abstract/Free Full Text].

14.   Habets, PE, Franco D, Ruijter JM, Sargeant AJ, Pereira JA, and Moorman AF. RNA content differs in slow and fast muscle fibers: implications for interpretation of changes in muscle gene expression. J Histochem Cytochem 47: 995-1004, 1999[Abstract/Free Full Text].

15.   Harris, RC, Hultman E, and Nordesjo LO. Glycogen, glycolytic intermediates and high-energy phosphates determined in biopsy samples of musculus quadriceps femoris of man at rest. Methods and variance of values. Scand J Clin Lab Invest 33: 109-120, 1974[ISI][Medline].

16.   Harris, RC, Soderlund K, and Hultman E. Elevation of creatine in resting and exercised muscle of normal subjects by creatine supplementation. Clin Sci (Colch) 83: 367-374, 1992[Medline].

17.   Heid, CA, Stevens J, Livak KJ, and Williams PM. Real time quantitative PCR. Genome Res 6: 986-994, 1996[Abstract/Free Full Text].

18.   Hultman, E, and Sahlin K. Acid-base balance during exercise. Exerc Sport Sci Rev 8: 41-127, 1980[Medline].

19.   Ingwall, JS. Creatine and the control of muscle-specific protein synthesis in cardiac and skeletal muscle. Circ Res 38: 115-123, 1976[Abstract/Free Full Text].

20.   Kelso, TB, Hodgson DR, Visscher AR, and Gollnick PD. Some properties of different skeletal muscle fiber types: comparison of reference bases. J Appl Physiol 62: 1436-1441, 1987[Abstract/Free Full Text].

21.   Klivenyi, P, Ferrante RJ, Matthews RT, Bogdanov MB, Klein AM, Andreassen OA, Mueller G, Wermer M, Kaddurah Daouk R, and Beal MF. Neuroprotective effects of creatine in a transgenic animal model of amyotrophic lateral sclerosis. Nat Med 5: 347-350, 1999[ISI][Medline].

22.   Kristiansen, S, Hargreaves M, and Richter EA. Exercise-induced increase in glucose transport, GLUT-4, and VAMP-2 in plasma membrane from human muscle. Am J Physiol Endocrinol Metab 270: E197-E201, 1996[Abstract/Free Full Text].

23.   Loike, JD, Somes M, and Silverstein SC. Creatine uptake, metabolism, and efflux in human monocytes and macrophages. Am J Physiol Cell Physiol 251: C128-C135, 1986[Abstract/Free Full Text].

24.   Loike, JD, Zalutsky DL, Kaback E, Miranda AF, and Silverstein SC. Extracellular creatine regulates creatine transport in rat and human muscle cells. Proc Natl Acad Sci USA 85: 807-811, 1988[Abstract/Free Full Text].

25.   Lowry, OH, and Passoneau JV. A Flexible System of Enzymatic Analysis. New York: Academic, 1972.

26.   Matthews, RT, Yang L, Jenkins BG, Ferrante RJ, Rosen BR, Kaddurah Daouk R, and Beal MF. Neuroprotective effects of creatine and cyclocreatine in animal models of Huntington's disease. J Neurosci 18: 156-163, 1998[Abstract/Free Full Text].

27.   Mitsumoto, Y, and Klip A. Development regulation of the subcellular distribution and glycosylation of GLUT1 and GLUT4 glucose transporters during myogenesis of L6 muscle cells. J Biol Chem 267: 4957-4962, 1992[Abstract/Free Full Text].

28.   Nash, SR, Giros B, Kingsmore SF, Rochelle JM, Suter ST, Gregor P, Seldin MF, and Caron MG. Cloning, pharmacological characterization, and genomic localization of the human creatine transporter. Receptors Channels 2: 165-174, 1994[ISI][Medline].

29.   Neubauer, S, Remkes H, Spindler M, Horn M, Wiesmann F, Prestle J, Walzel B, Ertl G, Hasenfuss G, and Wallimann T. Downregulation of the Na+-creatine cotransporter in failing human myocardium and in experimental heart failure. Circulation 100: 1847-1850, 1999[Abstract/Free Full Text].

30.   Odoom, JE, Kemp GJ, and Radda GK. The regulation of total creatine content in a myoblast cell line. Mol Cell Biochem 158: 179-188, 1996[ISI][Medline].

31.   Olivares, L, Aragon C, Gimenez C, and Zafra F. The role of N-glycosylation in the targeting and activity of the GLYT1 glycine transporter. J Biol Chem 270: 9437-9442, 1995[Abstract/Free Full Text].

32.   Op't Eijnde, R, Richter EA, Kiens B, and Hespel P. Effect of creatine on glucose disposal in rat skeletal muscle. J Sports Sci 17: 561-562, 1999.

33.  Passaquin A, Renard M, Kay L, Challet C, Mokhtarian A, Wallimann T, and Ruegg U. Creatine supplementation reduces skeletal muscle degeneration and enhances mitochondrial function in mdx mice. Neuromus Dis. In press.

34.   Pilegaard, H, Terzis G, Halestrap A, and Juel C. Distribution of the lactate/H+ transporter isoforms MCT1 and MCT4 in human skeletal muscle. Am J Physiol Endocrinol Metab 276: E843-E848, 1999[Abstract/Free Full Text].

35.   Ponticos, M, Lu QL, Morgan JE, Hardie DG, Partridge TA, and Carling D. Dual regulation of the AMP-activated protein kinase provides a novel mechanism for the control of creatine kinase in skeletal muscle. EMBO J 17: 1688-1699, 1998[ISI][Medline].

36.   Pulido, SM, Passaquin AC, Leijendekker WJ, Challet C, Wallimann T, and Ruegg UT. Creatine supplementation improves intracellular Ca2+ handling and survival in mdx skeletal muscle cells. FEBS Lett 439: 357-362, 1998[ISI][Medline].

37.   Qian, Y, Galli A, Ramamoorthy S, Risso S, DeFelice LJ, and Blakely RD. Protein kinase C activation regulates human serotonin transporters in HEK-293 cells via altered cell surface expression. J Neurosci 17: 45-57, 1997[Abstract/Free Full Text].

38.   Quick, MW, Corey JL, Davidson N, and Lester HA. Second messengers, trafficking-related proteins, and amino acid residues that contribute to the functional regulation of the rat brain GABA transporter GAT1. J Neurosci 17: 2967-2979, 1997[Abstract/Free Full Text].

39.   Snow, RJ, McKenna MJ, Selig SE, Kemp J, Stathis CG, and Zhao S. Effect of creatine supplementation on sprint exercise performance and muscle metabolism. J Appl Physiol 84: 1667-1673, 1998[Abstract/Free Full Text].

40.   Sora, I, Richman J, Santoro G, Wei H, Wang Y, Vanderah T, Horvath R, Nguyen M, Waite S, Roeske WR, and Yamamura HI. The cloning and expression of a human creatine transporter. Biochem Biophys Res Commun 204: 419-427, 1994[ISI][Medline].

41.   Spriet, LL. Anaerobic ATP provision, glycogenolysis and glycolysis in rat slow-twitch muscle during tetanic contractions. Pflügers Arch 417: 278-284, 1990[ISI][Medline].

42.   Spriet, LL. ATP utilization and provision in fast-twitch skeletal muscle during tetanic contractions. Am J Physiol Endocrinol Metab 257: E595-E605, 1989[Abstract/Free Full Text].

43.   Tarnopolsky, M, and Martin J. Creatine monohydrate increases strength in patients with neuromuscular disease. Neurology 52: 854-857, 1999[Abstract/Free Full Text].

44.   Tate, CG, and Blakely RD. The effect of N-linked glycosylation on activity of the Na+- and Cl--dependent serotonin transporter expressed using recombinant baculovirus in insect cells. J Biol Chem 269: 26303-26310, 1994[Abstract/Free Full Text].

45.   Vandenberghe, K, Goris M, Van Heck P, Van Leemputte M, Vangerven L, and Hespel P. Long-term creatine intake is beneficial to muscle performance during resistance training. J Appl Physiol 83: 2055-2063, 1997[Abstract/Free Full Text].

46.   Varki, A. Biological roles of oligosaccharides. Glycobiology 3: 97-130, 1993[Abstract/Free Full Text].

47.   Wallimann, T, Schlattner U, Guerrero L, and Dolder M. The phosphocreatine circuit and creatine supplementation, both come of age! In: Guanidino Compounds, edited by Mori A, Ishida M, and Clark JF.. Carlton South, Victoria, Australia: Blackwell Science Asia, 1999, vol. 5, p. 117-129.

48.   Wallimann, T, Wyss M, Brdiczka D, Nicolay K, and Eppenberger HM. Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the `phosphocreatine circuit' for cellular energy homeostasis. Biochem J 281: 21-40, 1992.

49.   Willott, CA, Young ME, Leighton B, Kemp GJ, Boehm EA, Radda GK, and Clarke K. Creatine uptake in isolated soleus muscle: kinetics and dependence on sodium, but not on insulin. Acta Physiol Scand 166: 99-104, 1999[ISI][Medline].


Am J Physiol Cell Physiol 280(3):C415-C422
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
J. J. Brault, K. A. Abraham, and R. L. Terjung
Muscle creatine uptake and creatine transporter expression in response to creatine supplementation and depletion
J Appl Physiol, June 1, 2003; 94(6): 2173 - 2180.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. J. Brault and R. L. Terjung
Creatine uptake and creatine transporter expression among rat skeletal muscle fiber types
Am J Physiol Cell Physiol, June 1, 2003; 284(6): C1481 - C1489.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Walzel, O. Speer, E. Boehm, S. Kristiansen, S. Chan, K. Clarke, J. P. Magyar, E. A. Richter, and T. Wallimann
New creatine transporter assay and identification of distinct creatine transporter isoforms in muscle
Am J Physiol Endocrinol Metab, August 1, 2002; 283(2): E390 - E401.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
W. Wang, M. A. Jobst, B. Bell, C.-R. Zhao, L.-H. Shang, and D. O. Jacobs
Cr supplementation decreases tyrosine phosphorylation of the CreaT in skeletal muscle during sepsis
Am J Physiol Endocrinol Metab, May 1, 2002; 282(5): E1046 - E1054.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murphy, R.
Right arrow Articles by Snow, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murphy, R.
Right arrow Articles by Snow, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online