Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 280: C394-C407, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacPherson, M. R.
Right arrow Articles by Davies, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacPherson, M. R.
Right arrow Articles by Davies, S. A.
Vol. 280, Issue 2, C394-C407, February 2001

SPECIAL TOPIC
Model Organisms: New Insights Into Ion Channel and Transporter Function.
L-type calcium channels regulate epithelial fluid transport in Drosophila melanogaster

Matthew R. MacPherson, Valerie P. Pollock, Kate E. Broderick, Laura Kean, Fiona C. O'Connell, Julian A. T. Dow, and Shireen A. Davies

Institute of Biomedical and Life Sciences, Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The neuropeptide CAP2b stimulates fluid transport obligatorily via calcium entry, nitric oxide, and cGMP in Drosophila melanogaster Malpighian (renal) tubules. We have shown by RT-PCR that the Drosophila L-type calcium channel alpha 1-subunit genes Dmca1D and Dmca1A (nbA) are both expressed in tubules. CAP2b-stimulated fluid transport and cytosolic calcium concentration ([Ca2+]i) increases are inhibited by the L-type calcium channel blockers verapamil and nifedipine. cGMP-stimulated fluid transport is verapamil and nifedipine sensitive. Furthermore, cGMP induces a slow [Ca2+]i increase in tubule principal cells via verapamil- and nifedipine-sensitive calcium entry; RT-PCR shows that tubules express Drosophila cyclic nucleotide-gated channel (cng). Additionally, thapsigargin-induced [Ca2+]i increase is verapamil sensitive. Phenylalkylamines bind with differing affinities to the basolateral and apical surfaces of principal cells in the main segment; however, dihydropyridine binds apically in the tubule initial segment. Immunocytochemical evidence suggests localization of alpha 1-subunits to both basolateral and apical surfaces of principal cells in the tubule main segment. We suggest roles for L-type calcium channels and cGMP-mediated calcium influx in both calcium signaling and fluid transport mechanisms in Drosophila.

calcium channel alpha 1-subunits; targeted aequorin expression; intracellular calcium; guanosine 3',5'-cyclic monophosphate; cyclic nucleotide-gated channels


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE REGULATION of intracellular calcium signaling pathways is critical for the physiological function of cells and tissues (4). Furthermore, in response to external stimuli, whole organ function is achieved through the integration of inter- and intracellular signaling pathways between heterogeneous cell types. Accordingly, studies of hormonally controlled cell-specific calcium signaling pathways in an organotypic context are ultimately essential for studies of the integrative physiology of calcium signaling. We have developed the model fluid-transporting epithelium, the Drosophila melanogaster Malpighian tubule, as a genetically tractable system in which to study the roles, in vivo, of cell-specific ion transport and cell signaling pathways in the regulation of epithelial fluid transport (14, 15). Insect tubules have excretory and osmoregulatory functions analogous to vertebrate renal function; as such, a simplified renal tubule system in Drosophila, with its attendant genomic and transgenic resources, is a valuable one for studies of integrative physiology. Although the contribution of genetic models to physiology is profound, the tubule is the first phenotype that has allowed such an analysis in a fluid-secreting epithelium.

Despite its small size (160 cells), the Drosophila tubule can be genetically delineated into six segments of precise size to which a battery of functional properties maps exactly (43). The main segment, which is responsible for fluid secretion, consists of two major genetically defined cell types (43) in which calcium signaling processes are understood in some detail. Fluid transport by Drosophila tubules is driven by a vacuolar (V)-type H+-ATPase (10, 14) and is stimulated by a rise in cytosolic calcium levels ([Ca2+]i), by the cyclic nucleotides adenosine 3',5'-cyclic monophosphate (cAMP) and guanosine 3',5'-cyclic monophosphate (cGMP), and by nitric oxide (NO) (15).

Genetic technologies unique to Drosophila permit sophisticated, noninvasive calcium monitoring of genetically specified cell types in the intact tissue. The GAL4/UASG binary system (7) has been used to drive expression of an apoaequorin transgene in genetically defined subsets of cells in the intact epithelium, permitting noninvasive, cell-specific [Ca2+]i measurements in the intact tissue. With the use of this technology, it was possible to show that the neuropeptide Drosophila CAP2b stimulates fluid secretion by increasing [Ca2+]i in the principal (type I) cells (39), which in turn activates a [Ca2+]i/calmodulin-sensitive nitric oxide synthase (NOS) (12) (see Fig. 11). Furthermore, increased [Ca2+]i and stimulated fluid secretion rates are both dependent on calcium entry; these responses are abolished in calcium-free medium, thus invoking a role for calcium entry channels in mediating this critical step in calcium signaling. The contribution of intracellular calcium stores to the CAP2b-stimulated [Ca2+]i increases in principal cells is presently unclear; however, the endoplasmic reticular Ca2+-ATPase inhibitor thapsigargin stimulates tubule fluid transport and increased [Ca2+]i in both the tubule principal and stellate cell subtypes. In only principal cells, however, is this response abolished in the absence of external calcium (39). This suggests that different cell types have different calcium-cycling mechanisms in vivo and, also, that plasma membrane calcium channels contribute to thapsigargin-induced [Ca2+]i increases in principal cells.

Several classes of calcium entry channel have been documented in insects, including L-type calcium channel subunits. In Drosophila, multiple phenylalkylamine binding affinities in head extracts imply L-type calcium channel diversity (26). Although calcium channels reveal molecular diversity via alternative splicing, multigene-encoded subunits, and differential assembly of subunit types (28), pharmacological sensitivities of the channel to 1,4-dihydropyridines (DHP) and phenylalkylamines (e.g., verapamil) are conferred by the alpha 1-subunit (41). To date, alpha 1-and beta -subunits have been cloned from the housefly (24, 25); and two Drosophila calcium channel alpha 1-subunit genes, Dmca1A (42) [renamed nightblind A (nbA), http://fly.ebi.ac.uk:7081/.bin/fbidq.html?FBgn0005563] and Dmca1D (51) have been cloned and investigated functionally. Dmca1A is associated with the visual system and Drosophila courtship song (42); Dmca1D, however, is preferentially expressed in the developing larval and adult nervous systems (21). Dmca1A is structurally similar to DHP-insensitive calcium channels (42), whereas Dmca1D is associated with DHP-sensitive calcium currents (37). There is also evidence for the existence of alpha 2-and beta -subunits in Drosophila (27).

Until recently, L-type calcium channels were considered unique to excitable cells (1); however, studies in vertebrates have provided evidence for functional L-type calcium channels in nonexcitable cells. An L-type calcium channel isolated from renal epithelial apical membranes is thought to play a role in calcium reabsorption (49). DHP-sensitive calcium channels have been characterized in mouse distal convoluted tubule cells and are thought to be associated with transepithelial calcium transport (30). Also, DHP-sensitive, protein kinase C-regulated calcium channels have been shown to be activated by mechanical stress in renal proximal tubule cells (50). The existence of a cGMP-stimulated, DHP-sensitive calcium channel has also been demonstrated in B-lymphocytes (40), which suggests that many classes of nonexcitable cells may express differentially regulated L-type calcium channels.

In this paper, we show that tubules express both known Drosophila L-type calcium channel alpha 1-subunits, Dmca1D (51) and Dmca1A (42), implying a role for this class of calcium channel in renal function in Drosophila. Calcium entry processes that contribute to CAP2b-stimulated epithelial fluid transport and [Ca2+]i rise in principal cells exhibit pharmacological sensitivities to the L-type calcium channel antagonists verapamil and nifedipine that are distinct from those previously described in other Drosophila tissues. We show that exogenous cGMP stimulates a [Ca2+]i rise in principal cells through a process dependent on calcium entry, which is verapamil and nifedipine sensitive. We also demonstrate that Drosophila cyclic nucleotide-gated (CNG) channel (cng) is expressed in tubules and must therefore have a role in epithelial transport. Additionally, verapamil partially abolishes thapsigargin-stimulated [Ca2+]i in principal cells, so a phenylalkylamine-sensitive calcium channel contributes to the thapsigargin-induced [Ca2+]i "signature." The use of fluorescent L-type calcium channel antagonists demonstrates verapamil binding at high affinity to basolateral membranes of main segment principal cells, with apical binding at low affinity; these data support the pharmacology of the CAP2b response. DHP, however, binds mainly to the apical surface of anterior tubule initial segment, with perinuclear binding in main segment principal cells. Immunocytochemical localization of alpha 1-subunits suggests a basolateral and possible apical membrane location in principal cells in the main segment.

Thus we have demonstrated L-type calcium channel alpha 1-subunit involvement in epithelial fluid transport and a role for these channels in distinct calcium entry mechanisms, namely, those mediated by CAP2b, cGMP, and thapsigargin.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Coelenterazine, thapsigargin, and fluorescent conjugates of verapamil, phenylalkylamine, and nifedipine were purchased from Molecular Probes and dissolved in ethanol before use. L-type calcium channel (anti-pan alpha 1) antibody (raised against an epitope common to both Dmca1A and Dmca1D) was purchased from Alomone Labs. The calcium channel antagonists verapamil and nifedipine (dissolved in either DMSO or ethanol before use) and cGMP (dissolved in Schneider's medium before use) were obtained from Sigma. Schneider's medium and Ca2+-free Schneider's medium were obtained from GIBCO. Oligonucleotides for RT-PCR were obtained from either GIBCO or MWG-Biotech UK. Taq polymerase and PCR reagents were obtained from Boehringer Mannheim. All other chemicals were obtained from Sigma.

Drosophila stocks. Drosophila were maintained on a 12:12-h light-dark cycle on standard corn meal-yeast-agar medium at 25°C. P{GAL4} lines (43, 47) and UASG-aequorin lines were the same as those described previously (39). To produce flies in which apoaequorin was expressed in a particular spatial or temporal pattern, we crossed the appropriate GAL4 driver line to a line carrying the apoaequorin transgene under control of the yeast UASG promoter as previously described (39, 44). In the resultant progeny, apoaequorin is expressed only in cells in which GAL4 is being expressed. For these experiments, the c42 line was used to drive expression to the principal cells of the main segment (3); such "c42-aeq" flies were maintained as homozygous lines. For tubule dissections, flies were cooled on ice and then decapitated before whole tubules were isolated.

RT-PCR. Twenty tubules were dissected, and poly(A)+ RNA was extracted (Dynal mRNA direct kit) and reverse transcribed with Superscript Plus (GIBCO BRL) as described previously (16). We used 1 µl of the reverse transcription reaction, corresponding to cDNAs derived from one tubule (~160 cells), as a template for PCR containing Dmca1D (51), Dmca1A (42), or cng (3) gene-specific primer pairs based on published sequences.

In RT-PCR for Dmca1D, forward primers to region 5581- 5603 (TCCTTCCAGGCACTGCCCTACG) and backward primers to region 6003-5982 (GCGAATAAACTCGTCCAAGTGG) were expected to generate a product of 422 bp with the use of cDNA templates. Cycle conditions were as follows: 94°C for 1 min; 36 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min; and 72°C for 1 min.

In RT-PCR for Dmca1A, forward primers to region 5825-5850 (TAGGGATCGGGATCGTGATAGG) and backward primers to region 6327-6306 (TTGTCGTTGGTTTTGGGTTAGG) were expected to generate a product of 499 bp with the use of cDNA templates. Cycle conditions were as follows: 94°C for 1 min; 36 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and 72°C for 1 min.

In RT-PCR for cng, forward primers to region 1201-1224 (ATTCCAGAATCGCATGGACGGTGT) and backward primers to region 1702-1722 (ACCCACAAATCCCGTTTCGCCA) were expected to generate a product of 521 bp with the use of cDNA templates. Cycle conditions were as follows: 94°C for 1 min; 37 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and 72°C for 1 min.

Each set of primers flanked small introns as a control against genomic contamination; corresponding PCR reactions were also carried out with the use of Drosophila genomic DNA template to distinguish the cDNA products. The PCR products obtained from RT-PCR experiments were cloned with the use of the Invitrogen Topoisomerase (TOPO TA Cloning) system. Cloned plasmids were purified with Qiagen kits and sequenced with USB Sequenase kits to confirm their identity. The cloned PCR products shared 100% sequence identity with published cDNA sequences for Dmca1D, Dmca1A, and cng (not shown).

Fluid secretion assays. Malpighian tubules were isolated into 10-µl drops of Schneider's medium under liquid paraffin, and fluid secretion rates were measured as detailed elsewhere (17) under the different conditions described in the text. Verapamil was dissolved in DMSO; nifedipine and thapsigargin were dissolved in ethanol before use and serially diluted in assay medium (1:1 mixture of Schneider's medium and Drosophila saline) before addition to the tubules. Care was taken that the final concentration of solvent did not exceed 1% vol/vol; at this concentration, neither DMSO nor ethanol has any effect on tubule fluid secretion (not shown). CAP2b and cGMP were added as solutions in assay medium. Membrane-permeant cGMP analogs were not used, because all insect tubules, unlike those of vertebrates, are permeable to cyclic nucleotides (16, 38), the uptake of which is thought to occur via organic anion transporters in principal cells.

Intracellular calcium measured with the use of targeted aequorin transgene. For each assay, 20 tubules from 4- to 14-day-old c42-aeq adults were dissected in Schneider's medium. Tubules were pooled in 160 µl of the same buffer containing the apoaequorin cofactor coelenterazine (2.5 µM final concentration); reconstitution of aequorin occurred upon incubation in the dark for 4-6 h (39). Bioluminescence recordings were made with a luminometer (LB9507; Berthold Wallac); recordings were made every 0.1 s for each tube. Measurements from each tube of 20 tubules were used to represent a single data point: after [Ca2+]i levels were recorded, tissues were disrupted in 350 µl of lysis solution [1% (vol/vol) Triton X-100, 100 mM CaCl2], causing discharge of the remaining aequorin and allowing estimation of the total amount of aequorin in the sample. Calibration of the aequorin system and calculation of calcium concentrations were performed as previously described (39).

Mock injections with Schneider's medium were applied to all samples before treatment with neuropeptide and antagonists. Control tubules were stimulated with either CAP2b (10-7 M) or cGMP (10-4 M) or were pretreated with the appropriate calcium channel antagonist before CAP2b/cGMP stimulation. Similarly, thapsigargin was applied to control tubules or to tubules pretreated with the appropriate calcium channel antagonists. With the exception of a transient peak ("ethanol artifact"), neither ethanol nor DMSO affects [Ca2+]i levels, provided that the final concentration is <1% vol/vol (not shown).

Whole mount immunocytochemistry and fluorescent calcium channel antagonist binding studies. Intact tubules were fixed in 4% (vol/vol) paraformaldehyde for 30 min, washed twice for 1 h in PBS containing 1% (wt/vol) Sigma cold fraction V bovine serum albumin and 1% (vol/vol) Triton X-100 (PAT), and incubated overnight in 3% (vol/vol) normal goat serum containing rabbit polyclonal anti-pan alpha 1 antibody (Alomone Labs) diluted 1:100 in PAT. After three washes in PAT (1 h), tubules were subsequently incubated with the appropriate fluorescein-labeled secondary antibody (1:250 dilution; Vector Labs), washed twice for 1 h in PAT, and washed once for 5 min in PBS. All procedures were carried out at room temperature. Stained tubules were mounted in VectaShield (Vector Labs). Whole mount tubules were examined with a Molecular Dynamics Multiprobe laser scanning confocal upright microscope. The excitation (488 nm) and emission (515 nm) barrier filters used were appropriate to the fluorescein-based label of the secondary antibody. Images were viewed with NIH Image.

Green fluorescence-labeled verapamil (BODIPY-FL verapamil), phenylalkylamine (BODIPY-FL phenylalkylamine), nifedipine (BODIPY-DM nifedipine), and vinblastine (BODIPY-FL vinblastine) (Molecular Probes) were used at appropriate concentrations (10 nM, 100 nM, or 100 µM as described in Figs. 8 and 10) on intact tubule preparations. Dissected tubules were fixed briefly in 4% (vol/vol) paraformaldehyde for 5 min, washed, and then mounted in PBS in the presence of BODIPY-labeled compound. Confocal images were captured under conditions similar to those applied to immunocytochemical preparations.

Statistics. Data are presented as means ± SE. Where appropriate, the significance of differences between data points was analyzed using Student's t-test (unpaired) with P < 0.05 as the critical level.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Tubules express L-type channels. Figure 1 shows that both Dmca1D and Dmca1A alpha 1 calcium channel subunits were expressed in both brain and tubules. Because expression of these calcium channels was confined to neither the nervous system nor excitable cells in Drosophila, it is suggested that L-type channels also have an epithelial role in invertebrates.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 1.   Both the head and tubules of Drosophila melanogaster express the calcium channel alpha 1-subunit genes Dmca1A and Dmca1D. RT-PCR was performed with D. melanogaster genomic DNA (G) and head (H) and tubule (T) template cDNA with primers directed against Dmca1A (A) and Dmca1D (B). Top arrows denote PCR products expected for genomic DNA; bottom arrows denote PCR products expected for cDNA. L, 1-kb DNA ladder (GIBCO BRL).

CAP2b-stimulated tubule fluid secretion is sensitive to L-type calcium channel antagonists. Phenylalkylamines and DHP are selective antagonists of L-type calcium channels and are known to be effective in Drosophila (35). The fluid secretion assay permits the effects of such antagonists to be studied in either resting tubules or tubules stimulated by defined peptide agonists. The basal rates of fluid secretion were not significantly altered by calcium channel antagonist pretreatments, except where verapamil was applied at 10-2 M, at which time secretion rates were completely abolished (not shown). However, both the DHP, nifedipine, and the phenylalkylamine, verapamil, inhibited CAP2b-stimulated fluid secretion (Fig. 2, A and B).


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   CAP2b-stimulated fluid secretion is inhibited by verapamil and nifedipine. Tubules were pretreated with appropriate concentrations of verapamil or nifedipine at 30 min before stimulation with CAP2b (10-7 M) at 40 min. A: verapamil inhibits fluid secretion. black-lozenge , Control; , 10-3 M verapamil pretreatment. Results are expressed as means ± SE (n = 9-10 tubules). B: nifedipine inhibits fluid secretion. black-lozenge , Control; , 10-9 M nifedipine. Results are expressed as means ± SE (n = 9-10 tubules). Accepted variation in secretion rates between whole tissue samples contributes to the reduced basal rates in nifedipine-treated tubule; this is not due to nifedipine, added at 30 min.

The dose-response curve for verapamil inhibition of the CAP2b-stimulated fluid secretion response (Fig. 3A) shows significant inhibition between 10-5 and 10-3 M and again at 10-8 M. Verapamil (1 mM) pretreatment completely abolished CAP2b-stimulated fluid secretion rates. In contrast, the DHP, nifedipine, significantly inhibited CAP2b-stimulated fluid secretion at all concentrations between 10-10 and 10-7 M (Fig. 3B), with maximal inhibition to ~31% of control (10-7 M). The complexity of the dose-response curves, with significant effects spanning wide concentration ranges, implies multiple targets of differing affinity for each drug.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3.   Comparison of the effects of CAP2b on fluid secretion and cytosolic calcium level ([Ca2+]i) increase in type I cells. A: dose-response curve for verapamil between 10-10 and 10-3 M is expressed as percent change of CAP2b-stimulated fluid secretion rates [(maximal stimulated rates of CAP2b-stimulated verapamil-treated samples/maximal stimulated rates of CAP2b-stimulated control samples) × 100%]. Significant inhibition of CAP2b-stimulated fluid secretion is shown between 10-3 and 10-5 M and again at 10-8 M (n = 9-10 tubules/concentration). B: dose-response curve of nifedipine inhibition of CAP2b-stimulated fluid secretion. Data are expressed as described in A (n = 9-10 tubules/concentration). Significant inhibition of CAP2b-stimulated fluid secretion is shown with nifedipine between 10-10 and 10-7 M. Inhibition is also shown at 10-4 M and may be due to nonspecific downregulation of tubule function. C: dose-response curve for effect of verapamil on [Ca2+]i. For these aequorin experiments, [Ca2+]i values were calculated as the difference in [Ca2+]i (in nM) between CAP2b-stimulated peaks and the average resting levels over the time period before stimulation for each sample. Results are expressed as a percentage of the ratio of these [Ca2+]i values between CAP2b-stimulated antagonist-treated and untreated samples. Verapamil significantly inhibits CAP2b-stimulated [Ca2+]i over two ranges, between 10-3 and 10-5 M and again at a lower concentration, 10-7 M. Data are expressed as means ± SE (n = 6-12 tubules/concentration).D: dose-response curve for effect of nifedipine on [Ca2+]i. As in B, nifedipine affects the CAP2b-induced [Ca2+]i response in a U-shaped manner, with significant inhibition of the response at concentrations that inhibit fluid secretion, 10-9 and 10-8 M. However, significant inhibition is also seen at 10-11 M. Data are expressed as means ± SE (n = 10-12 tubules/concentration). *P < 0.05, determined with Student's t-test.

CAP2b-stimulated increase in [Ca2+]i is sensitive to L-type calcium channel antagonists. CAP2b is known to act obligatorily through entry of extracellular calcium (3). If L-type calcium channels contributed to calcium entry, we would also expect to see reduced [Ca2+]i upon CAP2b stimulation in the presence of nifedipine or verapamil. Indeed, the CAP2b stimulated [Ca2+]i increase in principal cells of c42-aeq tubules (39) is modulated by both verapamil and nifedipine. Inhibition by both compounds mirrored that of the fluid secretion response (Fig. 3, A and B). Verapamil significantly reduced the CAP2b-induced calcium response over a similar concentration range that inhibits fluid transport, between 10-5 and 10-3 M and again at 10-7 M. Maximal inhibition occurred at 10-3 M verapamil (Fig. 3C). Although the verapamil dose-response curves for fluid secretion and calcium are complex, their agreement is near perfect (cf. Fig. 3, A and C); this implies that all the effects of verapamil on fluid secretion can be ascribed to effects on intracellular calcium.

By contrast, the relationship between fluid secretion and calcium dose-response curves for nifedipine is more complex (cf. Fig. 3, B and D). While the overall agreement is clear, there is a range of concentrations of nifedipine (ca. 10-8-10-7 M) at which fluid secretion was profoundly and reliably inhibited but at which the intracellular calcium signal was at most only mildly attenuated. This finding should not be disturbing; the fluid secretion assay exposes the entire tubule to pharmacological agents, and it is known that both other cell types in the main segment and other segments in the tubule either signal with or transport calcium. By contrast, the targeted aequorin reports calcium signals only from the principal cells of the main segment. It is thus clear that not all the effects of nifedipine can be attributed to its effect on calcium in principal cells of the main segment; in fact, we have also shown a class of nifedipine binding that lies outside the main (fluid-secreting) segment of the tubule (see below).

Both the verapamil and nifedipine responses imply the existence of multiple targets, with a wide range of affinities. It is possible that not all of these are L-type channels.

cGMP-stimulated epithelial transport is sensitive to verapamil and nifedipine. We previously documented a linear signaling pathway for CAP2b in Drosophila tubules, acting through [Ca2+]i, NOS, NO, soluble guanylate cyclase, cGMP, and cGMP-dependent protein kinase (cGK) (16). In principle, downstream elements of this pathway might be expected to modulate [Ca2+]i in turn, perhaps contributing to a stimulation of fluid secretion that lasts much longer than the initial calcium peak. Because CNG channels are known to exist in Drosophila, we examined the possible effect of cGMP on calcium signaling. Because maximal stimulation of fluid secretion rates by cGMP occurs at a concentration of 10-4 M (11), this concentration of cGMP was employed in all experiments. Figure 4 shows that cGMP-stimulated fluid transport is sensitive to L-type calcium channel antagonists. In the presence of 10-3 M verapamil, maximum rates of fluid secretion stimulated by cGMP were 66% of control (Fig. 4A). Pretreatment with 10-9 M nifedipine reduced maximum cGMP-stimulated fluid secretion rates similarly, to 66% of control (Fig. 4B). When verapamil and nifedipine were used in combination, however, cGMP-stimulated fluid-secretion rates were reduced to 18% of control values (Fig. 4C). This finding suggests that each L-type calcium channel antagonist may act on a different target involved in cGMP-stimulated fluid transport.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4.   cGMP-stimulated fluid secretion is verapamil and nifedipine sensitive. cGMP-stimulated fluid secretion rates are shown in the absence (black-lozenge ) or presence () of either 10-3 M verapamil (A), 10-9 M nifedipine (B), or both antagonists (C). Tubules were pretreated with appropriate concentrations of verapamil or nifedipine at 50 min (to allow appropriate monitoring of basal fluid secretion rates) before stimulation with cGMP (10-4 M) at 60 min. Data are expressed as means ± SE (control cGMP samples, n = 9; calcium channel antagonist pretreated samples, n = 10).

cGMP-stimulated increase in [Ca2+]i in principal cells requires calcium entry. Having previously demonstrated that calcium entry is essential for CAP2b- and thapsigargin-stimulated [Ca2+]i responses in principal cells (39), we have now shown that cGMP induces a slow, sustained increase in [Ca2+]i (Fig. 5A) and that this increase is also dependent on a calcium entry process (Fig. 5B). Because the cGMP-induced [Ca2+]i signal is abolished in the absence of extracellular calcium, it is probable that, in this cell type, release of calcium from intracellular calcium stores does not contribute to cGMP-induced [Ca2+]i increases.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 5.   cGMP stimulates increased [Ca2+]i in principal cells via calcium entry; cGMP-induced [Ca2+]i increase is verapamil and nifedipine sensitive. A: typical trace of cGMP-induced [Ca2+]i increase in tubule principal cells. Tubules were stimulated with 10-4 M cGMP at 30 s (arrow). Samples were monitored for a total of 500 s. Results shown are representative of at least 14 similar traces and are plotted as nanomolar [Ca2+]i against time, where each data point corresponds to 0.1 s. B: pooled nanomolar [Ca2+]i values of cGMP-induced peaks in the presence and absence of extracellular calcium from experiments described in A. Tubules were washed extensively (>3 times) in Ca2+-free Schneider's medium, as previously described (39), thus reducing the extracellular calcium concentration ([Ca2+]o) from 4 to ~0 mM. Tubules were then incubated in Ca2+-free Schneider's medium and stimulated with 10-4 M cGMP. Resting [unstimulated (open bars)] levels of [Ca2+]i = 83 ± 4.2 nM (n = 14) in 4 mM [Ca2+]o and 88 ± 3.3 nM (n = 9) in 0 mM [Ca2+]o. cGMP-stimulated [Ca2+]i (shaded bars) = 113 ± 4.6 nM (n = 14) in 4 mM [Ca2+]o and 88 ± 3.2 nM (n = 9) in 0 mM [Ca2+]o. These results indicate that a cGMP-induced increase in [Ca2+]i is not seen in Ca2+-free medium; this is also the case when Ca2+-free conditions are achieved with the use of EGTA (not shown). C: verapamil and nifedipine abolish cGMP-induced [Ca2+]i increases. Tubules were pretreated with verapamil (10-3 M) or nifedipine (10-9 M) before stimulation by 10-4 M cGMP. Data are expressed as means ± SE of cGMP-induced rise in [Ca2+]i minus average resting [Ca2+]i for each sample [n = 21, cGMP only; n = 7-10, cGMP + inhibitor(s)]. Results show that both verapamil and nifedipine almost completely abolish cGMP-induced [Ca2+]i increase; the use of both antagonists in combination abolishes the response altogether.

cGMP-mediated calcium entry occurs via verapamil- and nifedipine-sensitive calcium channels. As with cGMP-stimulated fluid secretion, sensitivity to L-type calcium channel antagonists was also observed upon cGMP stimulation of calcium entry (Fig. 5C). It is clear that both verapamil and nifedipine pretreatments completely abolish the cGMP-induced [Ca2+]i signal but that cGMP-stimulated fluid secretion is only partially reduced by these calcium channel antagonists, suggesting that the cGMP-induced increase in [Ca2+]i alone is not sufficient to promote fluid transport.

Drosophila head and tubules both express cng, a gene encoding a CNG channel. In Fig. 6, results of RT-PCR experiments in which Drosophila head cDNA was used as a positive control show that a Drosophila CNG channel, cng, is expressed in tubules. As with other genes that have been postulated to have only neuronal roles, these results demonstrate that the expression of CNG is not confined to the head and may be involved not only in olfactory and visual processing in Drosophila but also in epithelial transport. Together with the pharmacological data, the data for cGMP reveal a calcium entry mechanism with properties distinct from that activated by CAP2b.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 6.   The Drosophila CNG channel (cng) is expressed in tubules. RT-PCR was performed with D. melanogaster genomic DNA (G) and head (H) and tubule (T) template cDNA with primers directed against Drosophila CNG channel, cng. L, 1-kb ladder (GIBCO BRL). Top arrow denotes PCR products expected to be obtained with genomic DNA; bottom arrow denotes PCR products obtained with cDNA. (The lack of a genomic product of expected 619 bp is due to an undocumented RNA editing site within the 3' end of one of the primers, apparent by comparison of base 7792 of genomic DNA in accession no. AC004318 and base 1222 of the cDNA in accession no. X89601.)

A verapamil-sensitive calcium channel mediates the thapsigargin-induced calcium signature in principal cells. Thapsigargin induces a rise in [Ca2+]i in principal cells via calcium entry, as we have previously shown (39) and as shown in Fig. 7A. Pretreatment with verapamil (Fig. 7B), but not nifedipine (Fig. 7C), reduced the thapsigargin response (control: 247 ± 32 nM [Ca2+]i, n = 5; verapamil pretreatment: 160 ± 8 nM [Ca2+]i, n = 5). With both verapamil and nifedipine pretreatment, the thapsigargin signature was inhibited to about the same extent as with verapamil alone (Fig. 7D). These data suggest that, although thapsigargin is usually considered to elicit calcium entry through trp-like store-operated calcium channels, the thapsigargin signature in tubule principal cells is modulated by phenylalkylamine-sensitive calcium channels.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   Verapamil reduces the thapsigargin-induced [Ca2+]i signal in principal cells. A-D: typical traces of changes in [Ca2+]i in principal cells when stimulated by 1 µM thapsigargin alone (A) or in the presence of 10-3 M verapamil (B); 10-9 M nifedipine (C); or 10-3 M verapamil and 10-9 M nifedipine in combination (D). Results are representative of at least 5 similar recordings. The thapsigargin-induced [Ca2+]i response in principal cells was reduced to ~60% of control by verapamil (B) but not by nifedipine (C). Coapplication of both verapamil and nifedipine (D) reduced the thapsigargin-induced [Ca2+]i increase to the same extent as verapamil alone. Tubules were pretreated with channel blockers for 30 min; thapsigargin was added at arrows.

Colocalization of verapamil binding and alpha 1-subunit(s) in the tubule; differential binding of DHP to tubule subregions. Fluorescence-labeled phenylalkylamine at a low concentration (10 nM) bound to the basolateral membrane in only principal cells in the main segment of the tubule (Fig. 8A). The same concentration of verapamil also bound to the basolateral membrane of main segment principal cells (Fig. 8B). However, the use of verapamil at a concentration that inhibits CAP2b-induced increases in fluid secretion and [Ca2+]i (10-4 M) shows punctate staining of the basolateral membrane with diffuse, nonspecific staining at the apical surface (Fig. 8C). These data strongly suggest that there are multiple targets for verapamil in tubules. Verapamil is known to act as a substrate for P-glycoprotein; the use of a BODIPY-labeled analog of a P-glycoprotein substrate, vinblastine (Fig. 8D), shows that binding of a P-glycoprotein substrate is distinct from that seen with verapamil; binding is seen only in the initial segment of the anterior tubule (see Fig. 11). It is thus reasonable to assume that verapamil is accurately labeling L-type channels in the main segment. Confocal microscopy results of intact tubule preparations treated with anti-pan alpha 1 antibody (Fig. 9) suggest that alpha 1-subunits are located on the basolateral surface of principal cells. However, there is a significant signal at the apical surface; the large globular structures may be due to membrane blebbing, and this may suggest that a different class of alpha 1-subunit may be located on apical surface microvilli.


View larger version (128K):
[in this window]
[in a new window]
 
Fig. 8.   Phenylalkylamine and verapamil bind to basolateral membranes in tubule main segment. Green fluorescent phenylalkylamine (BODIPY-FL PAA) (A) and verapamil (BODIPY-FL verapamil) (B and C) binding in unfixed whole tubule preparations was observed by confocal microscopy. To determine whether verapamil binding in tubules was due to binding to P-glycoprotein, we assessed binding of a specific P-glycoprotein substrate, vinblastine (BODIPY-FL vinblastine). A: basolateral binding of phenylalkylamine (10 nM) to only principal cells in the main segment. Similar results were obtained with 1 µM phenylalkylamine (not shown). B: binding of 10 nM verapamil to basolateral membranes of principal cells in the main segment. C: when the concentration of verapamil was increased to 100 µM, in addition to punctate basolateral staining, there was also significant apical brush-border membrane staining. D: with 100 nM BODIPY-vinblastine, P-glycoprotein was localized only to the initial segment, suggesting that BODIPY-verapamil staining in the main segment is not due to binding of verapamil to P-glycoprotein. No staining in any region of the tubule was observed with 10 nM BODIPY-vinblastine (results not shown).



View larger version (157K):
[in this window]
[in a new window]
 
Fig. 9.   Immunocytochemical localization of alpha 1-subunits. An anti-pan alpha 1-subunit antibody (Alomone Labs) was used to localize alpha 1-subunits in tubules. This epitope, specific to all alpha 1-subunits, is located between domain IV and the COOH terminus, which is conserved between all species. The peptide sequence used to raise the anti-sera [(C)DNFDYLTRDWSILGPHHLD] is conserved in both Dmca1A and Dmca1D. Confocal microscopy of immunostained whole mount tubules (×40 magnification) revealed punctate staining in basolateral membranes of the main segment. There was also significant fluorescence observed in apical membranes; the nondistinct nature of these fluorescent patches may be due to membrane blebbing during fixation, which obscures defined localization of alpha 1-subunits in apical microvilli.

Unexpectedly, however, the location of DHP binding does not correlate with either verapamil binding or alpha 1-subunit localization. Figure 10A shows clearly defined apical nifedipine binding in the initial segment of anterior tubule, known to be a major calcium-transporting region (19). However, BODIPY-nifedipine binding was also seen in principal cells in the main segment (Fig. 10B), where most fluorescence was observed to be perinuclear, with some staining observed in lateral membranes. Thus DHPs may have a role in transepithelial calcium transport in Drosophila tubules; however, this calcium transport process is distinct from, and does not overlap with, calcium signaling processes in the main segment induced by CAP2b or, indeed, cGMP.


View larger version (78K):
[in this window]
[in a new window]
 
Fig. 10.   Nifedipine binds to tubule initial and main segments. Confocal microscopy of unfixed tubule preparations, as described in Fig. 8, was performed with green fluorescent nifedipine (BODIPY-DHP). High-affinity BODIPY-DHP was used at 100 nM (A). The confocal image of an anterior tubule initial segment shows clear apical localization of DHP binding. Note the large luminal space in this region of the tubule. Similar results were obtained with low-affinity BODIPY-DHP at 100 nM (not shown). DHP also binds to principal cells in the main segment. At 100 nM low-affinity DHP (B), perinuclear staining is shown; lateral staining of principal cell membranes is also shown.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

L-type channels. Studies of calcium channel blocker binding to Drosophila head membranes have shown the existence of at least eight pharmacological classes of L-type calcium channel (35). However, only two alpha 1-subunits have been cloned and characterized in Drosophila, Dmca1D and Dmca1A. We have shown that both these subunits are expressed in nonexcitable cells in Drosophila. We have also demonstrated functional roles for L-type calcium channel alpha 1-subunits in the tubule using a pharmacological approach: our working model is shown in Fig. 11.


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 11.   Working model for calcium signaling pathways in the tubule principal cell. The tubule main segment is shown, with details of known signaling events in principal and stellate cells. In stellate cells, the hormone Drosokinin stimulates a rise in [Ca2+]i (44), causing an increase in Cl- conductance (32). In principal cells, CAP2b acts on a G protein-coupled receptor (inferred) to activate phospholipase C (PLC); inositol 1,4,5-trisphosphate (IP3) receptor (IP3R), and hence IP3, are known to be necessary for CAP2b action (Pollock VP, Davies SA, Hasan G, and Dow JAT, unpublished observations). Release from internal stores is too small to measure under calcium-free conditions, implying that calcium entry is essential. Basolateral, verapamil-sensitive channels (possibly Dmca1A) contribute to this calcium entry. Calcium is returned to store by a thapsigargin-sensitive Ca2+-ATPase; thapsigargin-induced store depletion signals, at least in part, to a verapamil-sensitive plasma membrane calcium channel. Downstream, the CAP2b-induced [Ca2+]i signal activates dNOS (located in only these cells in tubules, Ref. 9), raising NO levels and acting on a methylene blue-sensitive guanylate cyclase to raise cGMP levels. cGMP acts on cGMP-dependent protein kinase (cGK) to activate an apical vacuolar (V)-ATPase, though probably not through direct phosphorylation of a subunit. cGMP also acts on a plasma membrane nifedipine- and verapamil-sensitive channel (cyclic nucleotide gated?) to raise intracellular calcium in the longer term, thereby providing feedback modulation. [Classic morphology of the tubule is from Wessing and Eichelberg (45a), reproduced with permission.]

Studies by other workers have shown that Dmca1D is expressed as a single transcript of 9.5 kb in Drosophila body RNA preparations (51), so it is unlikely that tubules show heterogeneity in this calcium channel subunit. Because Dmca1D is associated with a DHP-sensitive calcium current in larval muscle (37), it is possible that tubule DHP sensitivity is conferred by this particular subunit. However, our DHP localization studies suggest that DHP sensitivity in the tubule may not be attributable to Dmca1D, suggesting that alpha 1-subunits in different Drosophila tissues have distinct pharmacological sensitivities. Developmental Northern blot analysis in Drosophila shows that Dmca1A is expressed preferentially in the nervous system as a single 10.5-kb transcript, with diversity of this subunit being generated by alternative splicing (51). Analysis of Dmca1A suggests that phenylalkylamine, but not DHP, binding sites are conserved compared with vertebrate alpha 1-subunits (42); this may account for the phenylalkylamine-sensitive, DHP-insensitive calcium channels characterized in Drosophila brain extracts (26) and for the verapamil sensitivity of tubule responses.

Although it is not possible to conclude rigorously that the clear L-type pharmacology documented here is attributable to the L-type genes Dmca1A and Dmca1D, the recent completion of the genome project allows us to be unusually precise about the L-type gene family in this organism. Within the Drosophila genome, only Dmca1A and Dmca1D match the calcium channel motif IPR002077 in the Interpro protein motif database (http://www.ebi.ac.uk/interpro/). Furthermore, BLASTP searches through the predicted peptide database, for either Dmca1A or Dmca1D, turn up only known genes or a single possible additional L-type subunit (gene CG1517), which is more distantly related to Dmca1A and D than they are to each other. The L-type calcium channel family in Drosophila is thus not large, and so the probability that the pharmacology we have described can be laid at the door of Dmca1A, Dmca1D, or the newly described CG1517 is very high.

DHP sensitivity and transepithelial calcium transport. The precise role of L-type calcium channels in vertebrate renal epithelial cells is still unclear. High-affinity DHP binding sites have been demonstrated in rabbit renal epithelia (34), with dissociation constant values for DHP binding in the subnanomolar range. DHP-sensitive calcium influx may also be involved with cell volume regulation in vertebrate renal epithelia (33). Additionally, DHP-sensitive channels on the apical membrane of mouse distal convoluted tubule cells contribute to transepithelial calcium transport (calcium influx) in response to parathyroid hormone stimulation (22). As in vertebrate transporting epithelia, it is probable that there are several classes of L-type channel in the Drosophila tubule that may participate in calcium reabsorption or transepithelial calcium transport (23). DHP binding suggests that a major site for high-affinity DHP binding is the initial segment of anterior tubules. This tubule region is the main site of calcium storage in Drosophila, accounting for 25-30% of whole body calcium content (18), and is also the major calcium transporting region (19). Intriguingly, while high-affinity, DHP-sensitive targets clearly inhibit CAP2b-stimulated fluid secretion and [Ca2+]i, localization of these binding sites does not occur in the main, fluid-secreting segment; our results indicate that DHP binding sites may colocalize with those found with 100 nM BODIPY-vinblastine, specific for P-glycoprotein. We speculate that binding to low-affinity targets in initial segment may block calcium secretion into the lumen and thereby reduce influx through the main segment apical channels implied by our imaging data. Such a model could explain the complexity of the effects of both verapamil and nifedipine in this system.

Verapamil sensitivity of epithelial fluid transport in Drosophila. Recent work shows that basolateral calcium influx in tubules is inhibited by verapamil at the same concentrations that inhibit CAP2b-stimulated fluid secretion and [Ca2+]i (19). This is consistent with the verapamil-sensitive calcium entry and alpha 1-subunit localization demonstrated here, potentially via Dmca1A. It has recently been demonstrated that alpha 1A-subunit is localized to the basolateral surface in polarized epithelial (Madin-Darby canine kidney) cells (8); it is likely that this could also occur in invertebrate epithelia. Preliminary evidence demonstrates that mutants in Dmca1A have reduced basal fluid transport rates (MacPherson MR, unpublished observation), suggesting that calcium entry via the Dmca1A gene product is critical for epithelial transport.

cGMP-stimulated fluid secretion and [Ca2+]i in tubules: role of CNG channels? Because CAP2b is known to activate NO/cGMP signaling via an elevation in [Ca2+]i in tubule principal cells (39), a possible feedback role of cGMP on calcium signaling processes was investigated. We have shown that cGMP induces a rise in [Ca2+]i in principal cells that is abolished in the absence of extracellular calcium. While the contribution of intracellular stores to this process cannot be ruled out, it is possible that the cGMP-induced rise in [Ca2+]i occurs via calcium entry channels directly regulated by cGMP (CNG channels) (5) or by cGKs, two forms of which are expressed in Drosophila tubules, cGKI and cGKII (16). A role for cGKII in tubules has been postulated (8a) in which cGKII is thought to act on the V-ATPase, expressed only in principal cells of the main segment (14). From data presented here, it is probable that cGMP-induced fluid secretion occurs, in part, via cGMP-induced [Ca2+]i rise in principal cells, with concomitant stimulation of cGKs and hence V-ATPase activity.

CNG channels have been isolated from Drosophila eyes and antennae (3) and have been shown to be most similar to vertebrate CNG3. Also, a CNG-like channel has been isolated from the head (31), suggesting a role for cGMP-induced calcium entry in vision and olfaction. Furthermore, the availability of the complete Drosophila genome (Flybase Genome Annotation Database of Drosophila, Gadfly, http://hedgehog.lbl.gov:8000/cgi-bin/annot/query/) has shown the existence of a further three cng-like genes. Heterologous expression studies of the Drosophila CNG channel indicate that this channel has a similar role to CNG principal subunits in vertebrates, i.e., that of generating Ca2+ signals upon increased intracellular cGMP concentrations (20). We have shown here that Drosophila tubules express cng. CNG channels have been localized to many nonsensory tissues in vertebrates (6, 13), including localization of CNG3 in kidney; as such, CNG channels must play a role in epithelial transport. It is of interest to note that, in transporting epithelia, the roles of Drosophila CNG and vertebrate CNG3 have been conserved across evolution, and this suggests an important role for cGMP in regulating Ca2+ influx in transporting epithelia. A recent study of a novel CNG-related vertebrate ion channel, KCNA10, shows that verapamil significantly inhibits channel activity over a concentration range similar to that seen in our system (29). In the absence of any direct pharmacological data for Dmca1A, it remains possible that verapamil sensitivity of the tubule CAP2b/cGMP response is mediated by a blockade of CNG channel activity. Work in B-lymphocytes has also suggested that cGMP mediates calcium entry via DHP-sensitive channels (40). In light of these findings, the pharmacological inhibition of cGMP-induced [Ca2+]i rise in tubule principal cells may not be so unusual.

Thapsigargin-induced calcium entry: involvement of Dmca1A or cng? We have also demonstrated that verapamil-sensitive calcium entry mediates, in part, the thapsigargin response in principal cells. Our previous work showed that thapsigargin-induced [Ca2+]i is abolished in principal, but not in stellate, cells in calcium-free medium (39), suggesting that the response is critically dependent on calcium influx through the plasma membrane. In nonexcitable cells, it is known that store-operated calcium entry ("capacitative" calcium entry) is the main calcium entry route upon hormonal stimulation via activation of inositol 1,4,5-trisphosphate (IP3) signaling (36). There is also evidence from vertebrate studies that IP3-invoked store-operated calcium entry can occur via L-type channels: in renal epithelial cells, Ca2+ oscillations induced by Escherichia coli alpha -hemolysin are dependent on IP3 receptor-induced capacitative calcium entry via L-type channels (45). Also, neuropeptide-activated L-type channels have also been documented in gastric enterochromaffin-like cells (48). However, recent work has also shown that thapsigargin-stimulated capacitative calcium entry induces a Ca2+ current via a CNG channel in pulmonary artery endothelial cells (46).

Conclusion. Activation of multiple calcium entry channels by hormones has been previously documented; indeed, a model has recently been proposed for coordinated calcium entry into mouse distal convoluted tubule cells involving multiple calcium entry channels (2). Thus, in Drosophila tubules, as in vertebrate epithelia, convergence of distinct but interacting signal transduction pathways (Ca2+/NO/cGMP) stimulates calcium entry into principal cells via several classes of calcium channel, resulting in increased fluid transport.

This first demonstration of L-type calcium channel modulation of epithelial fluid transport in invertebrates suggests conservation of the role of these calcium channels in renal function between vertebrates and insects. Our present model is that the rapid, calcium-mediated signal from CAP2b through to cGK is modulated and sustained by a slower, more sustained calcium signal that depends on cGMP and that both components of the calcium signal are affected to different degrees by calcium channel blockers. The complexity of the system we have outlined might seem daunting, but it has been uncovered by a combination of traditional physiology and targetted transgenesis in an organotypic context. In a real tissue that both transports bulk calcium and employs it as a second messenger, such richness is entirely plausible and reflects a level of function that cannot be addressed by conventional cell culture approaches. Thus the application of molecular genetic tools to Drosophila, together with the availability of mutants and the tubule phenotype, makes further analysis of calcium channel modulation of renal function an exciting possibility.


    ACKNOWLEDGEMENTS

We are very grateful to Prof. J. C. McGrath, Dr. C. Daly, and S. McGrory, Autonomic Physiology Unit, Institute of Biomedical and Life Sciences, University of Glasgow, for confocal microscopy and extensive discussions.


    FOOTNOTES

This work was supported by a Biotechnology and Biological Sciences Research Council (BBSRC) Grant (to J. A. T. Dow and S. A. Davies), a BBSRC Fellowship (to S. A. Davies), and a BBSRC Committee Studentship (to M. R. MacPherson).

Address for reprint requests and other correspondence: S. A. Davies, Division of Molecular Genetics, Anderson College, Univ. of Glasgow, Glasgow G11 6NU, UK (E-mail: s.a.davies{at}bio.gla.ac.uk).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 14 April 2000; accepted in final form 12 October 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Armstrong, CM, and Hille B. Voltage-gated ion channels and electrical excitability. Neuron 20: 371-380, 1998[Web of Science][Medline].

2.   Barry, ELR, Gesek FA, Yu ASL, Lytton J, and Friedman PA. Distinct calcium channel isoforms mediate parathyroid hormone and chlorothiazide-stimulated calcium entry in transporting epithelial cells. J Membr Biol 161: 55-64, 1998[Web of Science][Medline].

3.   Baumann, A, Frings S, Godde M, Seifert R, and Kaupp UB. Primary structure and functional expression of a Drosophila cyclic nucleotide-gated channel present in eyes and antennae. EMBO J 13: 5040-5050, 1994[Web of Science][Medline].

4.   Berridge, MJ. Elementary and global aspects of calcium signaling. J Exp Biol 200: 315-319, 1997[Abstract].

5.   Biel, M, Sautter A, Ludwig A, Hofmann F, and Zong X. Cyclic nucleotide-gated channels-mediators of NO: cGMP-regulated processes. Naunyn Schmiedebergs Arch Pharmacol 358: 140-144, 1998[Web of Science][Medline].

6.   Biel, M, Zong X, Distler M, Bosse E, Klugbauer N, Murakami M, Flockerzi V, and Hofmann F. Another member of the cyclic nucleotide-gated channel family, expressed in testis, kidney, and heart. Proc Natl Acad Sci USA 91: 3505-3509, 1994[Abstract/Free Full Text].

7.   Brand, AH, and Perrimon N. Targetted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401-415, 1993[Abstract].

8.   Brice, NL, and Dolphin AC. Differential plasma membrane targeting of voltage-dependent calcium channel subunits expressed in a polarized epithelial cell line. J Physiol (Lond) 515: 685-694, 1999[Abstract/Free Full Text].

8a.   Broderick, K, Dow J, and Davies S. Functional characterization of cGMP-dependent protein kinase in a transporting epithelium. Am Dros Res Conf 41: 814C, 2000.

9.   Davies, S-A. Nitric oxide signalling in insects. Insect Biochem Mol Biol 30: 1123-1138, 2000[Web of Science][Medline].

10.   Davies, SA, Goodwin SF, Kelly DC, Wang ZS, Sözen MA, Kaiser K, and Dow JAT Analysis and inactivation of vha55, the gene encoding the vacuolar ATPase B-subunit in Drosophila melanogaster reveals a larval lethal phenotype. J Biol Chem 271: 30677-30684, 1996[Abstract/Free Full Text].

11.   Davies, SA, Huesmann GR, Maddrell SHP, O'Donnell MJ, Skaer NJV, Dow JAT, and Tublitz NJ. CAP2b, a cardioacceleratory peptide, is present in Drosophila and stimulates tubule fluid secretion via cGMP. Am J Physiol Regulatory Integrative Comp Physiol 269: R1321-R1326, 1995[Abstract/Free Full Text].

12.   Davies, SA, Stewart EJ, Huesmann GR, Skaer NJV, Maddrell SHP, Tublitz NJ, and Dow JAT Neuropeptide stimulation of the nitric oxide signaling pathway in Drosophila melanogaster Malpighian tubules. Am J Physiol Regulatory Integrative Comp Physiol 273: R823-R827, 1997[Abstract/Free Full Text].

13.   Distler, M, Biel M, Flockerzi V, and Hofmann F. Expression of cyclic nucleotide-gated cation channels in non-sensory tissues and cells. Neuropharmacology 33: 1275-1282, 1994[Web of Science][Medline].

14.   Dow, JAT The multifunctional Drosophila melanogaster V-ATPase is encoded by a multigene family. J Bioenerg Biomembr 31: 75-83, 1999[Web of Science][Medline].

15.   Dow, JAT, Davies SA, and Sözen MA. Fluid secretion by the Drosophila melanogaster Malpighian tubule. Am Zool 38: 450-460, 1998.

16.   Dow, JAT, Maddrell SHP, Davies S-A, Skaer NJV, and Kaiser K. A novel role for the nitric oxide/cyclic GMP signalling pathway: the control of fluid secretion in Drosophila. Am J Physiol Regulatory Integrative Comp Physiol 266: R1716-R1719, 1994[Abstract/Free Full Text].

17.   Dow, JAT, Maddrell SHP, Görtz A, Skaer NV, Brogan S, and Kaiser K. The Malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid secretion and its control. J Exp Biol 197: 421-428, 1994[Abstract].

18.   Dube, KA, McDonald DG, and O'Donnell MJ. Calcium homeostasis in larval and adult Drosophila melanogaster. Arch Insect Biochem Physiol 44: 27-39, 2000[Web of Science][Medline].

19.   Dube, K, McDonald DG, and O'Donnell MJ. Calcium transport by isolated anterior and posterior Malpighian tubules of Drosophila melanogaster: roles of sequestration and secretion. J Insect Physiol 46: 1449-1460, 2000[Web of Science][Medline].

20.   Dzeja, C, Hagen V, Kaupp UB, and Frings S. Ca2+ permeation in cyclic nucleotide-gated channels. EMBO J 18: 131-144, 1999[Web of Science][Medline].

21.   Eberl, DF, Ren D, Feng G, Lorenz LJ, Van Victor D, and Hall LM. Genetic and developmental characterisation of Dmca1D, a calcium channel alpha 1 subunit gene in Drosophila melanogaster. Genetics 148: 1159-1169, 1998[Abstract/Free Full Text].

22.   Friedman, PA, and Gesek F. Vitamin D3 accelerates PTH-dependent calcium transport in distal convoluted tubule cells. Am J Physiol Renal Fluid Electrolyte Physiol 265: F300-F308, 1993[Abstract/Free Full Text].

23.   Friedman, PA, and Gesek FA. Cellular calcium transport in renal epithelia: measurement, mechanisms and regulation. Physiol Rev 75: 429-471, 1995[Abstract/Free Full Text].

24.   Grabner, M, Bachmann A, Rosenthal F, Striessnig J, Schultz C, Tautz D, and Glossman H. Insect calcium channels. Molecular cloning of an alpha 1-subunit from housefly (Musca domestica) muscle. FEBS Lett 339: 189-194, 1994[Web of Science][Medline].

25.   Grabner, M, Wang Z, Mitterdorfer J, Rosenthal F, Charnet P, Savchenko A, Hering S, Ren D, Hall LM, and Glossman H. Cloning and functional expression of a neuronal calcium channel beta subunit from the housefly (Musca domestica). J Biol Chem 269: 23668-23674, 1994[Abstract/Free Full Text].

26.   Greenberg, RM, Streissnig J, Koza A, Devay P, Glossman H, and Hall LM. Native and detergent-solubilised membrane extracts from Drosophila heads contain binding sites for the phenylalkylamine calcium channel blockers. Insect Biochem 19: 309-322, 1989.

27.   Hall, LM, Ren D, Feng D, Eberl DF, Dubald M, Yang M, Hannan F, Kousky CT, and Zheng W. Calcium channel as a new potential target for insecticides. In: ACS Symposium Series: Molecular Action of Insecticides on Ion Channels, edited by Clark JM.. San Diego, CA: American Chemical Society, 1994, p. 162-172.

28.   Hofmann, F, Biel M, and Flockerzi V. Molecular basis for calcium channel diversity. Annu Rev Neurosci 17: 399-418, 1994[Web of Science][Medline].

29.   Lang, R, Lee G, Liu W, Tian S, Rafi H, Orias M, Segal AS, and Desir GV. KCNA10: a novel ion channel functionally related to both voltage-gated potassium and CNG cation channels. Am J Physiol Renal Physiol 278: F1013-F1021, 2000[Abstract/Free Full Text].

30.   Matsunaga, H, Stanton BA, Gesek FA, and Friedman PA. Epithelial Ca2+ channels sensitive to dihydropyridines and activated by hyperpolarizing voltages. Am J Physiol Cell Physiol 267: C157-C165, 1994[Abstract/Free Full Text].

31.   Miyazu, M, Tanimura T, and Sokabe M. Molecular cloning and characterization of a putative cyclic nucleotide-gated channel from Drosophila. Insect Mol Biol 9: 283-292, 2000[Web of Science][Medline].

32.   O'Donnell, MJ, Rheault MR, Davies SA, Rosay P, Harvey BJ, Maddrell SHP, Kaiser K, and Dow JAT Hormonally-controlled chloride movement across Drosophila tubules is via ion channels in stellate cells. Am J Physiol Regulatory Integrative Comp Physiol 274: R1039-R1049, 1998[Abstract/Free Full Text].

33.   O'Neil, RG, and Leng L. Osmo-mechanically sensitive phosphatidylinositol signalling regulates a Ca2+ influx channel in renal epithelial cells. Am J Physiol Renal Physiol 273: F120-F128, 1997[Abstract/Free Full Text].

34.   O'Neil, RG, Reid JM, Williams RL, and Karin NJ. Expression of dihydropyridine binding sites in renal epithelial cells. Biochem Biophys Res Commun 237: 41-45, 1997[Web of Science][Medline].

35.   Pelzer, S, Barhanin J, Pauron D, Trautwein W, Lazdunski M, and Pelzer D. Diversity and novel pharmacological properties of Ca2+ channels in Drosophila brain membranes. EMBO J 8: 2365-2371, 1989[Web of Science][Medline].

36.   Putney, JWJ Type 3 inositol 1,4,5-trisphosphate receptor and capacitative calcium entry. Cell Calcium 21: 257-261, 1997[Web of Science][Medline].

37.   Ren, D, Xu H, Eberl DF, Chopra M, and Hall LM. A mutation affecting dihydropyridine-sensitive current levels and activation kinetics in Drosophila muscle and mammalian heart calcium channels. J Neurosci 18: 2335-2341, 1998[Abstract/Free Full Text].

38.   Riegel, JA, Maddrell SH, Farndale RW, and Caldwell FM. Stimulation of fluid secretion of Malpighian tubules of Drosophila melanogaster Meig. by cyclic nucleotides of inosine, cytidine, thymidine and uridine. J Exp Biol 201: 3411-3418, 1998[Abstract].

39.   Rosay, P, Davies SA, Yu Y, Sozen MA, Kaiser K, and Dow JAT Cell-type specific calcium signalling in a Drosophila epithelium. J Cell Sci 110: 1683-1692, 1997[Abstract].

40.   Sadighi Akha, AA, Willmott NJ, Brickley K, Dolphin AC, Galione A, and Hunt SV. Anti-Ig-induced calcium influx in rat B lymphocytes mediated by cGMP through a dihydropyridine-sensitive channel. J Biol Chem 271: 7297-7300, 1996[Abstract/Free Full Text].

41.   Schuster, A, Lacinova L, Klugbaeur N, Ito H, Birnbaumer L, and Hoffman F. The IV6 segment of the L-type calcium channel is critical for the action of dihydropyridines and phenylalkylamines. EMBO J 15: 2365-2370, 1996[Web of Science][Medline].

42.   Smith, LA, Wang X, Peixoto AA, Neumann EK, Hall LM, and Hall JC. A Drosophila calcium channel alpha 1 subunit gene maps to a genetic locus associated with behavioral and visual defects. J Neurosci 16: 7868-7879, 1996[Abstract/Free Full Text].

43.   Sozen, HA, Armstrong JD, Yang MY, Kaiser K, and Dow JAT Functional domains are specified to single-cell resolution in a Drosophila epithelium. Proc Natl Acad Sci USA 94: 5207-5212, 1997[Abstract/Free Full Text].

44.   Terhzaz, S, O'Connell FC, Pollock VP, Kean L, Davies SA, Veenstra JA, and Dow JA. Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster. J Exp Biol 202: 3667-3676, 1999[Abstract].

45.   Uhlen, P, Laestadius A, Jahnukainen T, Soderblom T, Backhed F, Celsi G, Brismar H, Normark S, Aperia A, and Richter-Dahlfors A. Alpha-haemolysin of uropathogenic E. coli induces Ca2+ oscillations in renal epithelial cells. Nature 405: 694-697, 2000[Medline].

45a.   Wessing, A, and Eichelberg D. Malpighian tubules, rectal papillae and excretion. In: The Genetics and Biology of Drosophila, edited by Ashburner A, and Wright TRF. London: Academic, 1978, vol. 2c, p. 1-42.

46.   Wu, S, Moore TM, Brough GH, Whitt SR, Chinkers M, Li M, and Stevens T. Cyclic nucleotide-gated channels mediate membrane depolarization following activation of store-operated calcium entry in endothelial cells. J Biol Chem 275: 18887-18896, 2000[Abstract/Free Full Text].

47.   Yang, MY, Armstrong JD, Vilinsky I, Strausfeld NJ, and Kaiser K. Subdivision of the Drosophila mushroom bodies by enhancer-trap expression patterns. Neuron 15: 45-54, 1995[Web of Science][Medline].

48.   Zeng, N, Athmann C, Kang T, Walsh JH, and Sachs G. Role of neuropeptide-sensitive L-type Ca2+ channels in histamine release in gastric enterochromaffin-like cells. Am J Physiol Gastrointest Liver Physiol 277: G1268-G1280, 1999[Abstract/Free Full Text].

49.   Zhang, MIN, and O'Neil RG. An L-type calcium channel in renal epithelial cells. J Membr Biol 154: 259-266, 1996[Web of Science][Medline].

50.   Zhang, MIN, and O'Neil RG. A regulated calcium channel in apical membranes of renal proximal tubule cells. Am J Physiol Cell Physiol 271: C1757-C1764, 1996[Abstract/Free Full Text].

51.   Zheng, W, Feng G, Ren D, Eberl DF, Hannan F, Dubald M, and Hall LM. Cloning and characterisation of a calcium channel alpha 1 subunit from Drosophila melanogaster with similarity to the rat brain type D isoform. J Neurosci 15: 1132-1143, 1995[Abstract].


Am J Physiol Cell Physiol 280(2):C394-C407
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
S. A. Davies and S. Terhzaz
Organellar calcium signalling mechanisms in Drosophila epithelial function
J. Exp. Biol., February 1, 2009; 212(3): 387 - 400.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. R. MacPherson, V. P. Pollock, L. Kean, T. D. Southall, M. E. Giannakou, K. E. Broderick, J. A. T. Dow, R. C. Hardie, and S. A. Davies
Transient Receptor Potential-Like Channels Are Essential for Calcium Signaling and Fluid Transport in a Drosophila Epithelium
Genetics, March 1, 2005; 169(3): 1541 - 1552.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
V. P. Pollock, J. McGettigan, P. Cabrero, I. M. Maudlin, J. A. T. Dow, and S.-A. Davies
Conservation of capa peptide-induced nitric oxide signalling in Diptera
J. Exp. Biol., November 1, 2004; 207(23): 4135 - 4145.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. E. Broderick, M. R. MacPherson, M. Regulski, T. Tully, J. A. T. Dow, and S. A. Davies
Interactions between epithelial nitric oxide signaling and phosphodiesterase activity in Drosophila
Am J Physiol Cell Physiol, November 1, 2003; 285(5): C1207 - C1218.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. A. T. DOW and S. A. DAVIES
Integrative Physiology and Functional Genomics of Epithelial Function in a Genetic Model Organism
Physiol Rev, July 1, 2003; 83(3): 687 - 729.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
V. P. Pollock, J. C. Radford, S. Pyne, G. Hasan, J. A. T. Dow, and S.-A. Davies
norpA and itpr mutants reveal roles for phospholipase C and inositol (1,4,5)- trisphosphate receptor in Drosophila melanogaster renal function
J. Exp. Biol., March 1, 2003; 206(5): 901 - 911.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
P. Cabrero, J. C. Radford, K. E. Broderick, L. Costes, J. A. Veenstra, E. P. Spana, S. A. Davies, and J. A. T. Dow
The Dh gene of Drosophila melanogaster encodes a diuretic peptide that acts through cyclic AMP
J. Exp. Biol., December 15, 2002; 205(24): 3799 - 3807.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. Radford, S. A. Davies, and J. A. T. Dow
Systematic G-protein-coupled Receptor Analysis in Drosophila melanogaster Identifies a Leucokinin Receptor with Novel Roles
J. Biol. Chem., October 4, 2002; 277(41): 38810 - 38817.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (29)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacPherson, M. R.
Right arrow Articles by Davies, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacPherson, M. R.
Right arrow Articles by Davies, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online