|
|
||||||||
Institute of Biomedical and Life Sciences, Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, United Kingdom
| |
ABSTRACT |
|---|
|
|
|---|
The neuropeptide CAP2b stimulates
fluid transport obligatorily via calcium entry, nitric oxide, and cGMP
in Drosophila melanogaster Malpighian (renal) tubules. We
have shown by RT-PCR that the Drosophila L-type calcium
channel
1-subunit genes Dmca1D and
Dmca1A (nbA) are both expressed in tubules.
CAP2b-stimulated fluid transport and cytosolic calcium
concentration ([Ca2+]i) increases are
inhibited by the L-type calcium channel blockers verapamil and
nifedipine. cGMP-stimulated fluid transport is verapamil and nifedipine
sensitive. Furthermore, cGMP induces a slow
[Ca2+]i increase in tubule principal cells
via verapamil- and nifedipine-sensitive calcium entry; RT-PCR shows
that tubules express Drosophila cyclic nucleotide-gated
channel (cng). Additionally, thapsigargin-induced [Ca2+]i increase is verapamil sensitive.
Phenylalkylamines bind with differing affinities to the basolateral and
apical surfaces of principal cells in the main segment; however,
dihydropyridine binds apically in the tubule initial segment.
Immunocytochemical evidence suggests localization of
1-subunits to both basolateral and apical surfaces of
principal cells in the tubule main segment. We suggest roles for L-type
calcium channels and cGMP-mediated calcium influx in both calcium
signaling and fluid transport mechanisms in Drosophila.
calcium channel
1-subunits; targeted aequorin
expression; intracellular calcium; guanosine 3',5'-cyclic
monophosphate; cyclic nucleotide-gated channels
| |
INTRODUCTION |
|---|
|
|
|---|
THE REGULATION of intracellular calcium signaling pathways is critical for the physiological function of cells and tissues (4). Furthermore, in response to external stimuli, whole organ function is achieved through the integration of inter- and intracellular signaling pathways between heterogeneous cell types. Accordingly, studies of hormonally controlled cell-specific calcium signaling pathways in an organotypic context are ultimately essential for studies of the integrative physiology of calcium signaling. We have developed the model fluid-transporting epithelium, the Drosophila melanogaster Malpighian tubule, as a genetically tractable system in which to study the roles, in vivo, of cell-specific ion transport and cell signaling pathways in the regulation of epithelial fluid transport (14, 15). Insect tubules have excretory and osmoregulatory functions analogous to vertebrate renal function; as such, a simplified renal tubule system in Drosophila, with its attendant genomic and transgenic resources, is a valuable one for studies of integrative physiology. Although the contribution of genetic models to physiology is profound, the tubule is the first phenotype that has allowed such an analysis in a fluid-secreting epithelium.
Despite its small size (160 cells), the Drosophila tubule can be genetically delineated into six segments of precise size to which a battery of functional properties maps exactly (43). The main segment, which is responsible for fluid secretion, consists of two major genetically defined cell types (43) in which calcium signaling processes are understood in some detail. Fluid transport by Drosophila tubules is driven by a vacuolar (V)-type H+-ATPase (10, 14) and is stimulated by a rise in cytosolic calcium levels ([Ca2+]i), by the cyclic nucleotides adenosine 3',5'-cyclic monophosphate (cAMP) and guanosine 3',5'-cyclic monophosphate (cGMP), and by nitric oxide (NO) (15).
Genetic technologies unique to Drosophila permit sophisticated, noninvasive calcium monitoring of genetically specified cell types in the intact tissue. The GAL4/UASG binary system (7) has been used to drive expression of an apoaequorin transgene in genetically defined subsets of cells in the intact epithelium, permitting noninvasive, cell-specific [Ca2+]i measurements in the intact tissue. With the use of this technology, it was possible to show that the neuropeptide Drosophila CAP2b stimulates fluid secretion by increasing [Ca2+]i in the principal (type I) cells (39), which in turn activates a [Ca2+]i/calmodulin-sensitive nitric oxide synthase (NOS) (12) (see Fig. 11). Furthermore, increased [Ca2+]i and stimulated fluid secretion rates are both dependent on calcium entry; these responses are abolished in calcium-free medium, thus invoking a role for calcium entry channels in mediating this critical step in calcium signaling. The contribution of intracellular calcium stores to the CAP2b-stimulated [Ca2+]i increases in principal cells is presently unclear; however, the endoplasmic reticular Ca2+-ATPase inhibitor thapsigargin stimulates tubule fluid transport and increased [Ca2+]i in both the tubule principal and stellate cell subtypes. In only principal cells, however, is this response abolished in the absence of external calcium (39). This suggests that different cell types have different calcium-cycling mechanisms in vivo and, also, that plasma membrane calcium channels contribute to thapsigargin-induced [Ca2+]i increases in principal cells.
Several classes of calcium entry channel have been documented in
insects, including L-type calcium channel subunits. In
Drosophila, multiple phenylalkylamine binding
affinities in head extracts imply L-type calcium channel diversity
(26). Although calcium channels reveal molecular diversity
via alternative splicing, multigene-encoded subunits, and differential
assembly of subunit types (28), pharmacological
sensitivities of the channel to 1,4-dihydropyridines (DHP) and
phenylalkylamines (e.g., verapamil) are conferred by the
1-subunit (41). To date,
1-and
-subunits have been cloned from the housefly
(24, 25); and two Drosophila calcium channel
1-subunit genes, Dmca1A (42)
[renamed nightblind A (nbA),
http://fly.ebi.ac.uk:7081/.bin/fbidq.html?FBgn0005563] and
Dmca1D (51) have been cloned and investigated
functionally. Dmca1A is associated with the visual system
and Drosophila courtship song (42);
Dmca1D, however, is preferentially expressed in the developing larval and adult nervous systems (21).
Dmca1A is structurally similar to DHP-insensitive calcium
channels (42), whereas Dmca1D is associated
with DHP-sensitive calcium currents (37). There is also
evidence for the existence of
2-and
-subunits in
Drosophila (27).
Until recently, L-type calcium channels were considered unique to excitable cells (1); however, studies in vertebrates have provided evidence for functional L-type calcium channels in nonexcitable cells. An L-type calcium channel isolated from renal epithelial apical membranes is thought to play a role in calcium reabsorption (49). DHP-sensitive calcium channels have been characterized in mouse distal convoluted tubule cells and are thought to be associated with transepithelial calcium transport (30). Also, DHP-sensitive, protein kinase C-regulated calcium channels have been shown to be activated by mechanical stress in renal proximal tubule cells (50). The existence of a cGMP-stimulated, DHP-sensitive calcium channel has also been demonstrated in B-lymphocytes (40), which suggests that many classes of nonexcitable cells may express differentially regulated L-type calcium channels.
In this paper, we show that tubules express both known
Drosophila L-type calcium channel
1-subunits,
Dmca1D (51) and Dmca1A (42), implying a role for this class of calcium channel in
renal function in Drosophila. Calcium entry processes that
contribute to CAP2b-stimulated epithelial fluid transport
and [Ca2+]i rise in principal cells exhibit
pharmacological sensitivities to the L-type calcium channel antagonists
verapamil and nifedipine that are distinct from those previously
described in other Drosophila tissues. We show that
exogenous cGMP stimulates a [Ca2+]i rise in
principal cells through a process dependent on calcium entry, which is
verapamil and nifedipine sensitive. We also demonstrate that
Drosophila cyclic nucleotide-gated (CNG) channel
(cng) is expressed in tubules and must therefore have a role
in epithelial transport. Additionally, verapamil partially abolishes
thapsigargin-stimulated [Ca2+]i in principal
cells, so a phenylalkylamine-sensitive calcium channel contributes to
the thapsigargin-induced [Ca2+]i
"signature." The use of fluorescent L-type calcium channel antagonists demonstrates verapamil binding at high affinity to basolateral membranes of main segment principal cells, with apical binding at low affinity; these data support the pharmacology of the
CAP2b response. DHP, however, binds mainly to the apical
surface of anterior tubule initial segment, with perinuclear binding in main segment principal cells. Immunocytochemical localization of
1-subunits suggests a basolateral and possible apical
membrane location in principal cells in the main segment.
Thus we have demonstrated L-type calcium channel
1-subunit involvement in epithelial fluid transport and
a role for these channels in distinct calcium entry mechanisms, namely,
those mediated by CAP2b, cGMP, and thapsigargin.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
Coelenterazine, thapsigargin, and fluorescent conjugates of verapamil,
phenylalkylamine, and nifedipine were purchased from Molecular Probes
and dissolved in ethanol before use. L-type calcium channel (anti-pan
1) antibody (raised against an epitope common to both
Dmca1A and Dmca1D) was purchased from Alomone
Labs. The calcium channel antagonists verapamil and nifedipine
(dissolved in either DMSO or ethanol before use) and cGMP (dissolved in
Schneider's medium before use) were obtained from Sigma. Schneider's
medium and Ca2+-free Schneider's medium were obtained from
GIBCO. Oligonucleotides for RT-PCR were obtained from either GIBCO or
MWG-Biotech UK. Taq polymerase and PCR reagents were
obtained from Boehringer Mannheim. All other chemicals were obtained
from Sigma.
Drosophila stocks. Drosophila were maintained on a 12:12-h light-dark cycle on standard corn meal-yeast-agar medium at 25°C. P{GAL4} lines (43, 47) and UASG-aequorin lines were the same as those described previously (39). To produce flies in which apoaequorin was expressed in a particular spatial or temporal pattern, we crossed the appropriate GAL4 driver line to a line carrying the apoaequorin transgene under control of the yeast UASG promoter as previously described (39, 44). In the resultant progeny, apoaequorin is expressed only in cells in which GAL4 is being expressed. For these experiments, the c42 line was used to drive expression to the principal cells of the main segment (3); such "c42-aeq" flies were maintained as homozygous lines. For tubule dissections, flies were cooled on ice and then decapitated before whole tubules were isolated.
RT-PCR. Twenty tubules were dissected, and poly(A)+ RNA was extracted (Dynal mRNA direct kit) and reverse transcribed with Superscript Plus (GIBCO BRL) as described previously (16). We used 1 µl of the reverse transcription reaction, corresponding to cDNAs derived from one tubule (~160 cells), as a template for PCR containing Dmca1D (51), Dmca1A (42), or cng (3) gene-specific primer pairs based on published sequences.
In RT-PCR for Dmca1D, forward primers to region 5581- 5603 (TCCTTCCAGGCACTGCCCTACG) and backward primers to region 6003-5982 (GCGAATAAACTCGTCCAAGTGG) were expected to generate a product of 422 bp with the use of cDNA templates. Cycle conditions were as follows: 94°C for 1 min; 36 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min; and 72°C for 1 min. In RT-PCR for Dmca1A, forward primers to region 5825-5850 (TAGGGATCGGGATCGTGATAGG) and backward primers to region 6327-6306 (TTGTCGTTGGTTTTGGGTTAGG) were expected to generate a product of 499 bp with the use of cDNA templates. Cycle conditions were as follows: 94°C for 1 min; 36 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and 72°C for 1 min. In RT-PCR for cng, forward primers to region 1201-1224 (ATTCCAGAATCGCATGGACGGTGT) and backward primers to region 1702-1722 (ACCCACAAATCCCGTTTCGCCA) were expected to generate a product of 521 bp with the use of cDNA templates. Cycle conditions were as follows: 94°C for 1 min; 37 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and 72°C for 1 min. Each set of primers flanked small introns as a control against genomic contamination; corresponding PCR reactions were also carried out with the use of Drosophila genomic DNA template to distinguish the cDNA products. The PCR products obtained from RT-PCR experiments were cloned with the use of the Invitrogen Topoisomerase (TOPO TA Cloning) system. Cloned plasmids were purified with Qiagen kits and sequenced with USB Sequenase kits to confirm their identity. The cloned PCR products shared 100% sequence identity with published cDNA sequences for Dmca1D, Dmca1A, and cng (not shown).Fluid secretion assays. Malpighian tubules were isolated into 10-µl drops of Schneider's medium under liquid paraffin, and fluid secretion rates were measured as detailed elsewhere (17) under the different conditions described in the text. Verapamil was dissolved in DMSO; nifedipine and thapsigargin were dissolved in ethanol before use and serially diluted in assay medium (1:1 mixture of Schneider's medium and Drosophila saline) before addition to the tubules. Care was taken that the final concentration of solvent did not exceed 1% vol/vol; at this concentration, neither DMSO nor ethanol has any effect on tubule fluid secretion (not shown). CAP2b and cGMP were added as solutions in assay medium. Membrane-permeant cGMP analogs were not used, because all insect tubules, unlike those of vertebrates, are permeable to cyclic nucleotides (16, 38), the uptake of which is thought to occur via organic anion transporters in principal cells.
Intracellular calcium measured with the use of targeted aequorin transgene. For each assay, 20 tubules from 4- to 14-day-old c42-aeq adults were dissected in Schneider's medium. Tubules were pooled in 160 µl of the same buffer containing the apoaequorin cofactor coelenterazine (2.5 µM final concentration); reconstitution of aequorin occurred upon incubation in the dark for 4-6 h (39). Bioluminescence recordings were made with a luminometer (LB9507; Berthold Wallac); recordings were made every 0.1 s for each tube. Measurements from each tube of 20 tubules were used to represent a single data point: after [Ca2+]i levels were recorded, tissues were disrupted in 350 µl of lysis solution [1% (vol/vol) Triton X-100, 100 mM CaCl2], causing discharge of the remaining aequorin and allowing estimation of the total amount of aequorin in the sample. Calibration of the aequorin system and calculation of calcium concentrations were performed as previously described (39).
Mock injections with Schneider's medium were applied to all samples before treatment with neuropeptide and antagonists. Control tubules were stimulated with either CAP2b (10
7 M) or
cGMP (10
4 M) or were pretreated with the appropriate
calcium channel antagonist before CAP2b/cGMP stimulation.
Similarly, thapsigargin was applied to control tubules or to tubules
pretreated with the appropriate calcium channel antagonists. With the
exception of a transient peak ("ethanol artifact"), neither ethanol
nor DMSO affects [Ca2+]i levels, provided
that the final concentration is <1% vol/vol (not shown).
Whole mount immunocytochemistry and fluorescent calcium channel
antagonist binding studies.
Intact tubules were fixed in 4% (vol/vol) paraformaldehyde for 30 min,
washed twice for 1 h in PBS containing 1% (wt/vol) Sigma cold
fraction V bovine serum albumin and 1% (vol/vol) Triton X-100 (PAT),
and incubated overnight in 3% (vol/vol) normal goat serum containing
rabbit polyclonal anti-pan
1 antibody (Alomone Labs)
diluted 1:100 in PAT. After three washes in PAT (1 h), tubules were
subsequently incubated with the appropriate fluorescein-labeled secondary antibody (1:250 dilution; Vector Labs), washed twice for
1 h in PAT, and washed once for 5 min in PBS. All procedures were
carried out at room temperature. Stained tubules were mounted in
VectaShield (Vector Labs). Whole mount tubules were examined with a
Molecular Dynamics Multiprobe laser scanning confocal upright microscope. The excitation (488 nm) and emission (515 nm) barrier filters used were appropriate to the fluorescein-based label of the
secondary antibody. Images were viewed with NIH Image.
Statistics. Data are presented as means ± SE. Where appropriate, the significance of differences between data points was analyzed using Student's t-test (unpaired) with P < 0.05 as the critical level.
| |
RESULTS |
|---|
|
|
|---|
Tubules express L-type channels.
Figure 1 shows that both
Dmca1D and Dmca1A
1 calcium channel
subunits were expressed in both brain and tubules. Because expression of these calcium channels was confined to neither the nervous system
nor excitable cells in Drosophila, it is suggested that L-type channels also have an epithelial role in invertebrates.
|
CAP2b-stimulated tubule fluid secretion
is sensitive to L-type calcium channel
antagonists.
Phenylalkylamines and DHP are selective antagonists of
L-type calcium channels and are known to be effective in
Drosophila (35). The fluid secretion assay
permits the effects of such antagonists to be studied in either resting
tubules or tubules stimulated by defined peptide agonists. The basal
rates of fluid secretion were not significantly altered by calcium
channel antagonist pretreatments, except where verapamil was applied at
10
2 M, at which time secretion rates were completely
abolished (not shown). However, both the DHP, nifedipine, and the
phenylalkylamine, verapamil, inhibited CAP2b-stimulated
fluid secretion (Fig. 2, A and
B).
|
5 and 10
3 M and again
at 10
8 M. Verapamil (1 mM) pretreatment completely
abolished CAP2b-stimulated fluid secretion rates. In
contrast, the DHP, nifedipine, significantly inhibited
CAP2b-stimulated fluid secretion at all concentrations between 10
10 and 10
7 M (Fig.
3B), with maximal inhibition to ~31% of control
(10
7 M). The complexity of the dose-response curves, with
significant effects spanning wide concentration ranges, implies
multiple targets of differing affinity for each drug.
|
CAP2b-stimulated increase in
[Ca2+]i is
sensitive to L-type calcium channel antagonists.
CAP2b is known to act obligatorily through entry of
extracellular calcium (3). If L-type calcium channels
contributed to calcium entry, we would also expect to see reduced
[Ca2+]i upon CAP2b stimulation in
the presence of nifedipine or verapamil. Indeed, the CAP2b
stimulated [Ca2+]i increase in principal
cells of c42-aeq tubules (39) is modulated by both
verapamil and nifedipine. Inhibition by both compounds mirrored that of
the fluid secretion response (Fig. 3, A and B). Verapamil significantly reduced the CAP2b-induced calcium
response over a similar concentration range that inhibits fluid
transport, between 10
5 and 10
3 M and again
at 10
7 M. Maximal inhibition occurred at
10
3 M verapamil (Fig. 3C). Although the
verapamil dose-response curves for fluid secretion and calcium are
complex, their agreement is near perfect (cf. Fig. 3, A and
C); this implies that all the effects of verapamil on fluid
secretion can be ascribed to effects on intracellular calcium.
8-10
7 M) at which fluid secretion
was profoundly and reliably inhibited but at which the
intracellular calcium signal was at most only mildly attenuated. This
finding should not be disturbing; the fluid secretion assay exposes the
entire tubule to pharmacological agents, and it is known that both
other cell types in the main segment and other segments in the tubule
either signal with or transport calcium. By contrast, the targeted
aequorin reports calcium signals only from the principal cells of the
main segment. It is thus clear that not all the effects of nifedipine
can be attributed to its effect on calcium in principal cells of the main segment; in fact, we have also shown a class of nifedipine binding
that lies outside the main (fluid-secreting) segment of the tubule (see below).
Both the verapamil and nifedipine responses imply the existence of
multiple targets, with a wide range of affinities. It is possible that
not all of these are L-type channels.
cGMP-stimulated epithelial transport is sensitive to
verapamil and nifedipine.
We previously documented a linear signaling pathway for
CAP2b in Drosophila tubules, acting through
[Ca2+]i, NOS, NO, soluble guanylate cyclase,
cGMP, and cGMP-dependent protein kinase (cGK) (16). In
principle, downstream elements of this pathway might be expected to
modulate [Ca2+]i in turn, perhaps
contributing to a stimulation of fluid secretion that lasts much longer
than the initial calcium peak. Because CNG channels are known to exist
in Drosophila, we examined the possible effect of cGMP on
calcium signaling. Because maximal stimulation of fluid secretion rates
by cGMP occurs at a concentration of 10
4 M
(11), this concentration of cGMP was employed in all
experiments. Figure 4 shows that
cGMP-stimulated fluid transport is sensitive to L-type calcium channel
antagonists. In the presence of 10
3 M verapamil, maximum
rates of fluid secretion stimulated by cGMP were 66% of control (Fig.
4A). Pretreatment with 10
9 M nifedipine
reduced maximum cGMP-stimulated fluid secretion rates similarly,
to 66% of control (Fig. 4B). When verapamil and nifedipine
were used in combination, however, cGMP-stimulated fluid-secretion
rates were reduced to 18% of control values (Fig. 4C). This
finding suggests that each L-type calcium channel antagonist may act on
a different target involved in cGMP-stimulated fluid transport.
|
cGMP-stimulated increase in
[Ca2+]i in
principal cells requires calcium entry.
Having previously demonstrated that calcium entry is essential for
CAP2b- and thapsigargin-stimulated
[Ca2+]i responses in principal cells
(39), we have now shown that cGMP induces a slow,
sustained increase in [Ca2+]i (Fig.
5A) and
that this increase is also dependent on a calcium entry process (Fig.
5B). Because the cGMP-induced
[Ca2+]i signal is abolished in the absence of
extracellular calcium, it is probable that, in this cell type, release
of calcium from intracellular calcium stores does not contribute to
cGMP-induced [Ca2+]i increases.
|
cGMP-mediated calcium entry occurs via verapamil- and nifedipine-sensitive calcium channels. As with cGMP-stimulated fluid secretion, sensitivity to L-type calcium channel antagonists was also observed upon cGMP stimulation of calcium entry (Fig. 5C). It is clear that both verapamil and nifedipine pretreatments completely abolish the cGMP-induced [Ca2+]i signal but that cGMP-stimulated fluid secretion is only partially reduced by these calcium channel antagonists, suggesting that the cGMP-induced increase in [Ca2+]i alone is not sufficient to promote fluid transport.
Drosophila head and tubules both express cng, a gene encoding a
CNG channel.
In Fig. 6, results of RT-PCR experiments
in which Drosophila head cDNA was used as a positive control
show that a Drosophila CNG channel, cng, is
expressed in tubules. As with other genes that have been postulated to
have only neuronal roles, these results demonstrate that the expression
of CNG is not confined to the head and may be involved not only in
olfactory and visual processing in Drosophila but also in
epithelial transport. Together with the pharmacological data, the data
for cGMP reveal a calcium entry mechanism with properties distinct from
that activated by CAP2b.
|
A verapamil-sensitive calcium channel mediates the
thapsigargin-induced calcium signature in principal cells.
Thapsigargin induces a rise in [Ca2+]i in
principal cells via calcium entry, as we have previously shown
(39) and as shown in Fig.
7A. Pretreatment with
verapamil (Fig. 7B), but not nifedipine (Fig.
7C), reduced the thapsigargin response (control: 247 ± 32 nM [Ca2+]i, n = 5;
verapamil pretreatment: 160 ± 8 nM
[Ca2+]i, n = 5). With
both verapamil and nifedipine pretreatment, the thapsigargin signature
was inhibited to about the same extent as with verapamil alone (Fig.
7D). These data suggest that, although thapsigargin is
usually considered to elicit calcium entry through trp-like
store-operated calcium channels, the thapsigargin signature in tubule
principal cells is modulated by phenylalkylamine-sensitive calcium
channels.
|
Colocalization of verapamil binding and
1-subunit(s) in the tubule; differential binding
of DHP to tubule subregions.
Fluorescence-labeled phenylalkylamine at a low concentration (10 nM) bound to the basolateral membrane in only principal cells in the
main segment of the tubule (Fig.
8A). The same concentration of
verapamil also bound to the basolateral membrane of main segment principal cells (Fig. 8B). However, the use of verapamil at
a concentration that inhibits CAP2b-induced increases in
fluid secretion and [Ca2+]i
(10
4 M) shows punctate staining of the basolateral
membrane with diffuse, nonspecific staining at the apical surface (Fig.
8C). These data strongly suggest that there are multiple
targets for verapamil in tubules. Verapamil is known to act as a
substrate for P-glycoprotein; the use of a BODIPY-labeled analog of
a P-glycoprotein substrate, vinblastine (Fig. 8D),
shows that binding of a P-glycoprotein substrate is distinct from
that seen with verapamil; binding is seen only in the initial segment
of the anterior tubule (see Fig. 11). It is thus reasonable to assume
that verapamil is accurately labeling L-type channels in the main
segment. Confocal microscopy results of intact tubule preparations
treated with anti-pan
1 antibody (Fig.
9) suggest that
1-subunits
are located on the basolateral surface of principal cells. However,
there is a significant signal at the apical surface; the large globular
structures may be due to membrane blebbing, and this may suggest that a
different class of
1-subunit may be located on apical
surface microvilli.
|
|
1-subunit localization. Figure 10A shows clearly
defined apical nifedipine binding in the initial segment of anterior
tubule, known to be a major calcium-transporting region
(19). However, BODIPY-nifedipine binding was also seen in
principal cells in the main segment (Fig. 10B), where most
fluorescence was observed to be perinuclear, with some staining
observed in lateral membranes. Thus DHPs may have a role in
transepithelial calcium transport in Drosophila
tubules; however, this calcium transport process is distinct from, and
does not overlap with, calcium signaling processes in the main segment
induced by CAP2b or, indeed, cGMP.
|
| |
DISCUSSION |
|---|
|
|
|---|
L-type channels.
Studies of calcium channel blocker binding to Drosophila
head membranes have shown the existence of at least eight
pharmacological classes of L-type calcium channel (35).
However, only two
1-subunits have been cloned and
characterized in Drosophila, Dmca1D and
Dmca1A. We have shown that both these subunits are expressed
in nonexcitable cells in Drosophila. We have also
demonstrated functional roles for L-type calcium channel
1-subunits in the tubule using a pharmacological approach: our working model is shown in Fig.
11.
|
1-subunits in different Drosophila tissues
have distinct pharmacological sensitivities. Developmental Northern
blot analysis in Drosophila shows that Dmca1A is
expressed preferentially in the nervous system as a single 10.5-kb
transcript, with diversity of this subunit being generated by
alternative splicing (51). Analysis of Dmca1A suggests that phenylalkylamine, but not DHP, binding sites are conserved compared with vertebrate
1-subunits
(42); this may account for the
phenylalkylamine-sensitive, DHP-insensitive calcium channels characterized in Drosophila brain extracts
(26) and for the verapamil sensitivity of tubule responses.
Although it is not possible to conclude rigorously that the clear
L-type pharmacology documented here is attributable to the L-type genes
Dmca1A and Dmca1D, the recent completion of the
genome project allows us to be unusually precise about the L-type gene family in this organism. Within the Drosophila genome, only
Dmca1A and Dmca1D match the calcium channel motif
IPR002077 in the Interpro protein motif database
(http://www.ebi.ac.uk/interpro/). Furthermore, BLASTP
searches through the predicted peptide database, for either Dmca1A or Dmca1D, turn up only known genes or a
single possible additional L-type subunit (gene CG1517), which is more
distantly related to Dmca1A and D than they are
to each other. The L-type calcium channel family in
Drosophila is thus not large, and so the probability that
the pharmacology we have described can be laid at the door of
Dmca1A, Dmca1D, or the newly described CG1517 is
very high.
DHP sensitivity and transepithelial calcium transport. The precise role of L-type calcium channels in vertebrate renal epithelial cells is still unclear. High-affinity DHP binding sites have been demonstrated in rabbit renal epithelia (34), with dissociation constant values for DHP binding in the subnanomolar range. DHP-sensitive calcium influx may also be involved with cell volume regulation in vertebrate renal epithelia (33). Additionally, DHP-sensitive channels on the apical membrane of mouse distal convoluted tubule cells contribute to transepithelial calcium transport (calcium influx) in response to parathyroid hormone stimulation (22). As in vertebrate transporting epithelia, it is probable that there are several classes of L-type channel in the Drosophila tubule that may participate in calcium reabsorption or transepithelial calcium transport (23). DHP binding suggests that a major site for high-affinity DHP binding is the initial segment of anterior tubules. This tubule region is the main site of calcium storage in Drosophila, accounting for 25-30% of whole body calcium content (18), and is also the major calcium transporting region (19). Intriguingly, while high-affinity, DHP-sensitive targets clearly inhibit CAP2b-stimulated fluid secretion and [Ca2+]i, localization of these binding sites does not occur in the main, fluid-secreting segment; our results indicate that DHP binding sites may colocalize with those found with 100 nM BODIPY-vinblastine, specific for P-glycoprotein. We speculate that binding to low-affinity targets in initial segment may block calcium secretion into the lumen and thereby reduce influx through the main segment apical channels implied by our imaging data. Such a model could explain the complexity of the effects of both verapamil and nifedipine in this system.
Verapamil sensitivity of epithelial fluid transport in Drosophila.
Recent work shows that basolateral calcium influx in tubules is
inhibited by verapamil at the same concentrations that inhibit CAP2b-stimulated fluid secretion and
[Ca2+]i (19). This is consistent
with the verapamil-sensitive calcium entry and
1-subunit
localization demonstrated here, potentially via Dmca1A. It
has recently been demonstrated that
1A-subunit is
localized to the basolateral surface in polarized epithelial (Madin-Darby canine kidney) cells (8); it is likely that
this could also occur in invertebrate epithelia. Preliminary evidence demonstrates that mutants in Dmca1A have reduced basal fluid
transport rates (MacPherson MR, unpublished observation), suggesting
that calcium entry via the Dmca1A gene product is critical
for epithelial transport.
cGMP-stimulated fluid secretion and [Ca2+]i in tubules: role of CNG channels? Because CAP2b is known to activate NO/cGMP signaling via an elevation in [Ca2+]i in tubule principal cells (39), a possible feedback role of cGMP on calcium signaling processes was investigated. We have shown that cGMP induces a rise in [Ca2+]i in principal cells that is abolished in the absence of extracellular calcium. While the contribution of intracellular stores to this process cannot be ruled out, it is possible that the cGMP-induced rise in [Ca2+]i occurs via calcium entry channels directly regulated by cGMP (CNG channels) (5) or by cGKs, two forms of which are expressed in Drosophila tubules, cGKI and cGKII (16). A role for cGKII in tubules has been postulated (8a) in which cGKII is thought to act on the V-ATPase, expressed only in principal cells of the main segment (14). From data presented here, it is probable that cGMP-induced fluid secretion occurs, in part, via cGMP-induced [Ca2+]i rise in principal cells, with concomitant stimulation of cGKs and hence V-ATPase activity.
CNG channels have been isolated from Drosophila eyes and antennae (3) and have been shown to be most similar to vertebrate CNG3. Also, a CNG-like channel has been isolated from the head (31), suggesting a role for cGMP-induced calcium entry in vision and olfaction. Furthermore, the availability of the complete Drosophila genome (Flybase Genome Annotation Database of Drosophila, Gadfly, http://hedgehog.lbl.gov:8000/cgi-bin/annot/query/) has shown the existence of a further three cng-like genes. Heterologous expression studies of the Drosophila CNG channel indicate that this channel has a similar role to CNG principal subunits in vertebrates, i.e., that of generating Ca2+ signals upon increased intracellular cGMP concentrations (20). We have shown here that Drosophila tubules express cng. CNG channels have been localized to many nonsensory tissues in vertebrates (6, 13), including localization of CNG3 in kidney; as such, CNG channels must play a role in epithelial transport. It is of interest to note that, in transporting epithelia, the roles of Drosophila CNG and vertebrate CNG3 have been conserved across evolution, and this suggests an important role for cGMP in regulating Ca2+ influx in transporting epithelia. A recent study of a novel CNG-related vertebrate ion channel, KCNA10, shows that verapamil significantly inhibits channel activity over a concentration range similar to that seen in our system (29). In the absence of any direct pharmacological data for Dmca1A, it remains possible that verapamil sensitivity of the tubule CAP2b/cGMP response is mediated by a blockade of CNG channel activity. Work in B-lymphocytes has also suggested that cGMP mediates calcium entry via DHP-sensitive channels (40). In light of these findings, the pharmacological inhibition of cGMP-induced [Ca2+]i rise in tubule principal cells may not be so unusual.Thapsigargin-induced calcium entry: involvement of
Dmca1A or cng?
We have also demonstrated that verapamil-sensitive calcium entry
mediates, in part, the thapsigargin response in principal cells. Our
previous work showed that thapsigargin-induced
[Ca2+]i is abolished in principal, but not in
stellate, cells in calcium-free medium (39), suggesting
that the response is critically dependent on calcium influx through the
plasma membrane. In nonexcitable cells, it is known that store-operated
calcium entry ("capacitative" calcium entry) is the main calcium
entry route upon hormonal stimulation via activation of inositol
1,4,5-trisphosphate (IP3) signaling (36).
There is also evidence from vertebrate studies that
IP3-invoked store-operated calcium entry can occur via
L-type channels: in renal epithelial cells, Ca2+
oscillations induced by Escherichia coli
-hemolysin are
dependent on IP3 receptor-induced capacitative calcium
entry via L-type channels (45). Also,
neuropeptide-activated L-type channels have also been documented in
gastric enterochromaffin-like cells (48). However, recent
work has also shown that thapsigargin-stimulated capacitative calcium
entry induces a Ca2+ current via a CNG channel in pulmonary
artery endothelial cells (46).
Conclusion. Activation of multiple calcium entry channels by hormones has been previously documented; indeed, a model has recently been proposed for coordinated calcium entry into mouse distal convoluted tubule cells involving multiple calcium entry channels (2). Thus, in Drosophila tubules, as in vertebrate epithelia, convergence of distinct but interacting signal transduction pathways (Ca2+/NO/cGMP) stimulates calcium entry into principal cells via several classes of calcium channel, resulting in increased fluid transport.
This first demonstration of L-type calcium channel modulation of epithelial fluid transport in invertebrates suggests conservation of the role of these calcium channels in renal function between vertebrates and insects. Our present model is that the rapid, calcium-mediated signal from CAP2b through to cGK is modulated and sustained by a slower, more sustained calcium signal that depends on cGMP and that both components of the calcium signal are affected to different degrees by calcium channel blockers. The complexity of the system we have outlined might seem daunting, but it has been uncovered by a combination of traditional physiology and targetted transgenesis in an organotypic context. In a real tissue that both transports bulk calcium and employs it as a second messenger, such richness is entirely plausible and reflects a level of function that cannot be addressed by conventional cell culture approaches. Thus the application of molecular genetic tools to Drosophila, together with the availability of mutants and the tubule phenotype, makes further analysis of calcium channel modulation of renal function an exciting possibility.| |
ACKNOWLEDGEMENTS |
|---|
We are very grateful to Prof. J. C. McGrath, Dr. C. Daly, and S. McGrory, Autonomic Physiology Unit, Institute of Biomedical and Life Sciences, University of Glasgow, for confocal microscopy and extensive discussions.
| |
FOOTNOTES |
|---|
This work was supported by a Biotechnology and Biological Sciences Research Council (BBSRC) Grant (to J. A. T. Dow and S. A. Davies), a BBSRC Fellowship (to S. A. Davies), and a BBSRC Committee Studentship (to M. R. MacPherson).
Address for reprint requests and other correspondence: S. A. Davies, Division of Molecular Genetics, Anderson College, Univ. of Glasgow, Glasgow G11 6NU, UK (E-mail: s.a.davies{at}bio.gla.ac.uk).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 14 April 2000; accepted in final form 12 October 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Armstrong, CM,
and
Hille B.
Voltage-gated ion channels and electrical excitability.
Neuron
20:
371-380,
1998[Web of Science][Medline].
2.
Barry, ELR,
Gesek FA,
Yu ASL,
Lytton J,
and
Friedman PA.
Distinct calcium channel isoforms mediate parathyroid hormone and chlorothiazide-stimulated calcium entry in transporting epithelial cells.
J Membr Biol
161:
55-64,
1998[Web of Science][Medline].
3.
Baumann, A,
Frings S,
Godde M,
Seifert R,
and
Kaupp UB.
Primary structure and functional expression of a Drosophila cyclic nucleotide-gated channel present in eyes and antennae.
EMBO J
13:
5040-5050,
1994[Web of Science][Medline].
4.
Berridge, MJ.
Elementary and global aspects of calcium signaling.
J Exp Biol
200:
315-319,
1997[Abstract].
5.
Biel, M,
Sautter A,
Ludwig A,
Hofmann F,
and
Zong X.
Cyclic nucleotide-gated channels-mediators of NO: cGMP-regulated processes.
Naunyn Schmiedebergs Arch Pharmacol
358:
140-144,
1998[Web of Science][Medline].
6.
Biel, M,
Zong X,
Distler M,
Bosse E,
Klugbauer N,
Murakami M,
Flockerzi V,
and
Hofmann F.
Another member of the cyclic nucleotide-gated channel family, expressed in testis, kidney, and heart.
Proc Natl Acad Sci USA
91:
3505-3509,
1994
7.
Brand, AH,
and
Perrimon N.
Targetted gene expression as a means of altering cell fates and generating dominant phenotypes.
Development
118:
401-415,
1993[Abstract].
8.
Brice, NL,
and
Dolphin AC.
Differential plasma membrane targeting of voltage-dependent calcium channel subunits expressed in a polarized epithelial cell line.
J Physiol (Lond)
515:
685-694,
1999
8a.
Broderick, K,
Dow J,
and
Davies S.
Functional characterization of cGMP-dependent protein kinase in a transporting epithelium.
Am Dros Res Conf
41:
814C,
2000.
9.
Davies, S-A.
Nitric oxide signalling in insects.
Insect Biochem Mol Biol
30:
1123-1138,
2000[Web of Science][Medline].
10.
Davies, SA,
Goodwin SF,
Kelly DC,
Wang ZS,
Sözen MA,
Kaiser K,
and
Dow JAT
Analysis and inactivation of vha55, the gene encoding the vacuolar ATPase B-subunit in Drosophila melanogaster reveals a larval lethal phenotype.
J Biol Chem
271:
30677-30684,
1996
11.
Davies, SA,
Huesmann GR,
Maddrell SHP,
O'Donnell MJ,
Skaer NJV,
Dow JAT,
and
Tublitz NJ.
CAP2b, a cardioacceleratory peptide, is present in Drosophila and stimulates tubule fluid secretion via cGMP.
Am J Physiol Regulatory Integrative Comp Physiol
269:
R1321-R1326,
1995
12.
Davies, SA,
Stewart EJ,
Huesmann GR,
Skaer NJV,
Maddrell SHP,
Tublitz NJ,
and
Dow JAT
Neuropeptide stimulation of the nitric oxide signaling pathway in Drosophila melanogaster Malpighian tubules.
Am J Physiol Regulatory Integrative Comp Physiol
273:
R823-R827,
1997
13.
Distler, M,
Biel M,
Flockerzi V,
and
Hofmann F.
Expression of cyclic nucleotide-gated cation channels in non-sensory tissues and cells.
Neuropharmacology
33:
1275-1282,
1994[Web of Science][Medline].
14.
Dow, JAT
The multifunctional Drosophila melanogaster V-ATPase is encoded by a multigene family.
J Bioenerg Biomembr
31:
75-83,
1999[Web of Science][Medline].
15.
Dow, JAT,
Davies SA,
and
Sözen MA.
Fluid secretion by the Drosophila melanogaster Malpighian tubule.
Am Zool
38:
450-460,
1998.
16.
Dow, JAT,
Maddrell SHP,
Davies S-A,
Skaer NJV,
and
Kaiser K.
A novel role for the nitric oxide/cyclic GMP signalling pathway: the control of fluid secretion in Drosophila.
Am J Physiol Regulatory Integrative Comp Physiol
266:
R1716-R1719,
1994
17.
Dow, JAT,
Maddrell SHP,
Görtz A,
Skaer NV,
Brogan S,
and
Kaiser K.
The Malpighian tubules of Drosophila melanogaster: a novel phenotype for studies of fluid secretion and its control.
J Exp Biol
197:
421-428,
1994[Abstract].
18.
Dube, KA,
McDonald DG,
and
O'Donnell MJ.
Calcium homeostasis in larval and adult Drosophila melanogaster.
Arch Insect Biochem Physiol
44:
27-39,
2000[Web of Science][Medline].
19.
Dube, K,
McDonald DG,
and
O'Donnell MJ.
Calcium transport by isolated anterior and posterior Malpighian tubules of Drosophila melanogaster: roles of sequestration and secretion.
J Insect Physiol
46:
1449-1460,
2000[Web of Science][Medline].
20.
Dzeja, C,
Hagen V,
Kaupp UB,
and
Frings S.
Ca2+ permeation in cyclic nucleotide-gated channels.
EMBO J
18:
131-144,
1999[Web of Science][Medline].
21.
Eberl, DF,
Ren D,
Feng G,
Lorenz LJ,
Van Victor D,
and
Hall LM.
Genetic and developmental characterisation of Dmca1D, a calcium channel
1 subunit gene in Drosophila melanogaster.
Genetics
148:
1159-1169,
1998
22.
Friedman, PA,
and
Gesek F.
Vitamin D3 accelerates PTH-dependent calcium transport in distal convoluted tubule cells.
Am J Physiol Renal Fluid Electrolyte Physiol
265:
F300-F308,
1993
23.
Friedman, PA,
and
Gesek FA.
Cellular calcium transport in renal epithelia: measurement, mechanisms and regulation.
Physiol Rev
75:
429-471,
1995
24.
Grabner, M,
Bachmann A,
Rosenthal F,
Striessnig J,
Schultz C,
Tautz D,
and
Glossman H.
Insect calcium channels. Molecular cloning of an alpha 1-subunit from housefly (Musca domestica) muscle.
FEBS Lett
339:
189-194,
1994[Web of Science][Medline].
25.
Grabner, M,
Wang Z,
Mitterdorfer J,
Rosenthal F,
Charnet P,
Savchenko A,
Hering S,
Ren D,
Hall LM,
and
Glossman H.
Cloning and functional expression of a neuronal calcium channel beta subunit from the housefly (Musca domestica).
J Biol Chem
269:
23668-23674,
1994
26.
Greenberg, RM,
Streissnig J,
Koza A,
Devay P,
Glossman H,
and
Hall LM.
Native and detergent-solubilised membrane extracts from Drosophila heads contain binding sites for the phenylalkylamine calcium channel blockers.
Insect Biochem
19:
309-322,
1989.
27.
Hall, LM,
Ren D,
Feng D,
Eberl DF,
Dubald M,
Yang M,
Hannan F,
Kousky CT,
and
Zheng W.
Calcium channel as a new potential target for insecticides.
In: ACS Symposium Series: Molecular Action of Insecticides on Ion Channels, edited by Clark JM.. San Diego, CA: American Chemical Society, 1994, p. 162-172.
28.
Hofmann, F,
Biel M,
and
Flockerzi V.
Molecular basis for calcium channel diversity.
Annu Rev Neurosci
17:
399-418,
1994[Web of Science][Medline].
29.
Lang, R,
Lee G,
Liu W,
Tian S,
Rafi H,
Orias M,
Segal AS,
and
Desir GV.
KCNA10: a novel ion channel functionally related to both voltage-gated potassium and CNG cation channels.
Am J Physiol Renal Physiol
278:
F1013-F1021,
2000
30.
Matsunaga, H,
Stanton BA,
Gesek FA,
and
Friedman PA.
Epithelial Ca2+ channels sensitive to dihydropyridines and activated by hyperpolarizing voltages.
Am J Physiol Cell Physiol
267:
C157-C165,
1994
31.
Miyazu, M,
Tanimura T,
and
Sokabe M.
Molecular cloning and characterization of a putative cyclic nucleotide-gated channel from Drosophila.
Insect Mol Biol
9:
283-292,
2000[Web of Science][Medline].
32.
O'Donnell, MJ,
Rheault MR,
Davies SA,
Rosay P,
Harvey BJ,
Maddrell SHP,
Kaiser K,
and
Dow JAT
Hormonally-controlled chloride movement across Drosophila tubules is via ion channels in stellate cells.
Am J Physiol Regulatory Integrative Comp Physiol
274:
R1039-R1049,
1998
33.
O'Neil, RG,
and
Leng L.
Osmo-mechanically sensitive phosphatidylinositol signalling regulates a Ca2+ influx channel in renal epithelial cells.
Am J Physiol Renal Physiol
273:
F120-F128,
1997
34.
O'Neil, RG,
Reid JM,
Williams RL,
and
Karin NJ.
Expression of dihydropyridine binding sites in renal epithelial cells.
Biochem Biophys Res Commun
237:
41-45,
1997[Web of Science][Medline].
35.
Pelzer, S,
Barhanin J,
Pauron D,
Trautwein W,
Lazdunski M,
and
Pelzer D.
Diversity and novel pharmacological properties of Ca2+ channels in Drosophila brain membranes.
EMBO J
8:
2365-2371,
1989[Web of Science][Medline].
36.
Putney, JWJ
Type 3 inositol 1,4,5-trisphosphate receptor and capacitative calcium entry.
Cell Calcium
21:
257-261,
1997[Web of Science][Medline].
37.
Ren, D,
Xu H,
Eberl DF,
Chopra M,
and
Hall LM.
A mutation affecting dihydropyridine-sensitive current levels and activation kinetics in Drosophila muscle and mammalian heart calcium channels.
J Neurosci
18:
2335-2341,
1998
38.
Riegel, JA,
Maddrell SH,
Farndale RW,
and
Caldwell FM.
Stimulation of fluid secretion of Malpighian tubules of Drosophila melanogaster Meig. by cyclic nucleotides of inosine, cytidine, thymidine and uridine.
J Exp Biol
201:
3411-3418,
1998[Abstract].
39.
Rosay, P,
Davies SA,
Yu Y,
Sozen MA,
Kaiser K,
and
Dow JAT
Cell-type specific calcium signalling in a Drosophila epithelium.
J Cell Sci
110:
1683-1692,
1997[Abstract].
40.
Sadighi Akha, AA,
Willmott NJ,
Brickley K,
Dolphin AC,
Galione A,
and
Hunt SV.
Anti-Ig-induced calcium influx in rat B lymphocytes mediated by cGMP through a dihydropyridine-sensitive channel.
J Biol Chem
271:
7297-7300,
1996
41.
Schuster, A,
Lacinova L,
Klugbaeur N,
Ito H,
Birnbaumer L,
and
Hoffman F.
The IV6 segment of the L-type calcium channel is critical for the action of dihydropyridines and phenylalkylamines.
EMBO J
15:
2365-2370,
1996[Web of Science][Medline].
42.
Smith, LA,
Wang X,
Peixoto AA,
Neumann EK,
Hall LM,
and
Hall JC.
A Drosophila calcium channel
1 subunit gene maps to a genetic locus associated with behavioral and visual defects.
J Neurosci
16:
7868-7879,
1996
43.
Sozen, HA,
Armstrong JD,
Yang MY,
Kaiser K,
and
Dow JAT
Functional domains are specified to single-cell resolution in a Drosophila epithelium.
Proc Natl Acad Sci USA
94:
5207-5212,
1997
44.
Terhzaz, S,
O'Connell FC,
Pollock VP,
Kean L,
Davies SA,
Veenstra JA,
and
Dow JA.
Isolation and characterization of a leucokinin-like peptide of Drosophila melanogaster.
J Exp Biol
202:
3667-3676,
1999[Abstract].
45.
Uhlen, P,
Laestadius A,
Jahnukainen T,
Soderblom T,
Backhed F,
Celsi G,
Brismar H,
Normark S,
Aperia A,
and
Richter-Dahlfors A.
Alpha-haemolysin of uropathogenic E. coli induces Ca2+ oscillations in renal epithelial cells.
Nature
405:
694-697,
2000[Medline].
45a.
Wessing, A,
and
Eichelberg D.
Malpighian tubules, rectal papillae and excretion.
In: The Genetics and Biology of Drosophila, edited by Ashburner A,
and Wright TRF. London: Academic, 1978, vol. 2c, p. 1-42.
46.
Wu, S,
Moore TM,
Brough GH,
Whitt SR,
Chinkers M,
Li M,
and
Stevens T.
Cyclic nucleotide-gated channels mediate membrane depolarization following activation of store-operated calcium entry in endothelial cells.
J Biol Chem
275:
18887-18896,
2000
47.
Yang, MY,
Armstrong JD,
Vilinsky I,
Strausfeld NJ,
and
Kaiser K.
Subdivision of the Drosophila mushroom bodies by enhancer-trap expression patterns.
Neuron
15:
45-54,
1995[Web of Science][Medline].
48.
Zeng, N,
Athmann C,
Kang T,
Walsh JH,
and
Sachs G.
Role of neuropeptide-sensitive L-type Ca2+ channels in histamine release in gastric enterochromaffin-like cells.
Am J Physiol Gastrointest Liver Physiol
277:
G1268-G1280,
1999
49.
Zhang, MIN,
and
O'Neil RG.
An L-type calcium channel in renal epithelial cells.
J Membr Biol
154:
259-266,
1996[Web of Science][Medline].
50.
Zhang, MIN,
and
O'Neil RG.
A regulated calcium channel in apical membranes of renal proximal tubule cells.
Am J Physiol Cell Physiol
271:
C1757-C1764,
1996
51.
Zheng, W,
Feng G,
Ren D,
Eberl DF,
Hannan F,
Dubald M,
and
Hall LM.
Cloning and characterisation of a calcium channel
1 subunit from Drosophila melanogaster with similarity to the rat brain type D isoform.
J Neurosci
15:
1132-1143,
1995[Abstract].
This article has been cited by other articles:
![]() |
S. A. Davies and S. Terhzaz Organellar calcium signalling mechanisms in Drosophila epithelial function J. Exp. Biol., February 1, 2009; 212(3): 387 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. MacPherson, V. P. Pollock, L. Kean, T. D. Southall, M. E. Giannakou, K. E. Broderick, J. A. T. Dow, R. C. Hardie, and S. A. Davies Transient Receptor Potential-Like Channels Are Essential for Calcium Signaling and Fluid Transport in a Drosophila Epithelium Genetics, March 1, 2005; 169(3): 1541 - 1552. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P. Pollock, J. McGettigan, P. Cabrero, I. M. Maudlin, J. A. T. Dow, and S.-A. Davies Conservation of capa peptide-induced nitric oxide signalling in Diptera J. Exp. Biol., November 1, 2004; 207(23): 4135 - 4145. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Broderick, M. R. MacPherson, M. Regulski, T. Tully, J. A. T. Dow, and S. A. Davies Interactions between epithelial nitric oxide signaling and phosphodiesterase activity in Drosophila Am J Physiol Cell Physiol, November 1, 2003; 285(5): C1207 - C1218. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. T. DOW and S. A. DAVIES Integrative Physiology and Functional Genomics of Epithelial Function in a Genetic Model Organism Physiol Rev, July 1, 2003; 83(3): 687 - 729. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P. Pollock, J. C. Radford, S. Pyne, G. Hasan, J. A. T. Dow, and S.-A. Davies norpA and itpr mutants reveal roles for phospholipase C and inositol (1,4,5)- trisphosphate receptor in Drosophila melanogaster renal function J. Exp. Biol., March 1, 2003; 206(5): 901 - 911. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Cabrero, J. C. Radford, K. E. Broderick, L. Costes, J. A. Veenstra, E. P. Spana, S. A. Davies, and J. A. T. Dow The Dh gene of Drosophila melanogaster encodes a diuretic peptide that acts through cyclic AMP J. Exp. Biol., December 15, 2002; 205(24): 3799 - 3807. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Radford, S. A. Davies, and J. A. T. Dow Systematic G-protein-coupled Receptor Analysis in Drosophila melanogaster Identifies a Leucokinin Receptor with Novel Roles J. Biol. Chem., October 4, 2002; 277(41): 38810 - 38817. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |