Am J Physiol Cell Physiol Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 280: C273-C279, 2001;
0363-6143/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Willmann, R.
Right arrow Articles by Pette, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Willmann, R.
Right arrow Articles by Pette, D.
Vol. 280, Issue 2, C273-C279, February 2001

Muscle LIM protein is upregulated in fast skeletal muscle during transition toward slower phenotypes

Raffaella Willmann, Justine Kusch, Karim R. Sultan, Achim G. Schneider, and Dirk Pette

Department of Biology, University of Konstanz, D-78457 Konstanz, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Muscle LIM protein (MLP) is constitutively expressed in slow, but undetectable in fast, muscles of the rat. Here we show that MLP was upregulated at both the mRNA and protein levels under experimental conditions leading to transitions from fast to slower phenotypes. Chronic low-frequency stimulation and mechanical overloading by synergist removal both induced fast-to-slow shifts in myosin heavy chain (MHC) isoforms and expression of MLP in fast muscles. High amounts of MLP mRNA and protein were also present in fast muscles of the myotonic, hyperactive ADR mouse. Hypothyroidism evoked shifts in myosin composition toward slower isoforms and increased the MLP protein content of soleus (SOL) muscle but failed to induce MLP in fast muscles. Unweighting by hindlimb suspension elicited slow-to-fast transitions in MHC expression without altering MLP levels in SOL muscle. Hyperthyroidism shifted the MHC pattern toward faster isoforms but did not affect MLP content in SOL muscle. We conclude that alterations in MLP expression are associated with transitions from fast to slower phenotypes but not with slow-to-fast muscle fiber transitions.

ADR mouse; chronic low-frequency stimulation; fiber type transition; hindlimb suspension; mechanical overloading; myotonia; thyroid hormone


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

MUSCLE LIM PROTEIN (MLP) IS a member of the cystein-rich LIM protein family (29). The LIM domain encompasses double zinc fingerlike motifs, with each finger coordinating a single zinc ion to specific cysteine and histidine residues (17). LIM domains have been shown to serve as protein-binding interfaces (22). MLP has been proposed to play an important role in myogenesis and in the promotion of myogenic differentiation (1). This function has been related to its myofibrillar location in close vicinity to the Z disk (1) and its interaction with alpha -actinin (20). It has also been suggested that MLP serves as a cofactor for the myogenic basic helix-loop-helix proteins by increasing their interaction with specific DNA-regulatory elements (15). Moreover, the role of MLP in myogenesis is emphasized by the finding that MLP-deficient mice display a cardiomyopathy due to a disruption of the cardiac cytoarchitectural organization (2). In addition, enhanced fatigability of limb muscles was observed in the MLP-deficient mouse.

The expression of MLP in adult muscle is thought to be neurally regulated. In the adult rat, MLP protein is present in similarly high amounts in cardiac and slow-twitch muscle (soleus) but is not detectable in fast-twitch muscles. However, we recently showed that MLP can be induced in fast-twitch muscle by chronic low-frequency stimulation (CLFS) (23). CLFS has been shown to elicit sequential fast-to-slow fiber type transitions in various mammals (for reviews, see Refs. 18 and 19). These transitions are also reflected by sequential changes in myosin heavy chain (MHC) isoform expression. Generally, these transitions follow the order MHCIIbright-arrowMHCIId(x)right-arrowMHCIIaright-arrowMHCIbeta . According to single fiber studies on rat muscle (3, 8), MHCIIb-containing fibers are the fastest, while MHCIbeta -containing fibers are the slowest. MHCIId(x)- and MHCIIa-containing fibers are intermediate. Whereas CLFS ultimately transforms fast-twitch muscles of rabbit and larger mammals into slow-twitch muscles predominantly expressing MHCIbeta , CLFS-induced transformation does not attain this stage in smaller mammals. Thus long-term stimulation of rat muscle induces pronounced increases in MHCIIa but only small amounts of MHCIbeta (12).

The aim of the present study was to investigate under which conditions MLP is upregulated in adult muscle of rat and mouse, especially with regard to experimentally induced fiber type transformation. For this purpose, MLP expression was studied under various kinds of induced fiber type transitions. Different experimental models were chosen to induce fast-to-slow as well as slow-to-fast fiber type transitions. Transitions toward slower phenotypes were elicited by experimentally increased neuromuscular activity using the CLFS model and by increasing the mechanical load by synergist ablation (compensatory hypertrophy). In addition, our studies included the myotonic ADR (arrested development of righting response) mouse as an example of spontaneous neuromuscular hyperactivity (13). Slow-to-fast transitions were induced by decreasing the mechanical load of the muscle using the hindlimb suspension model. Furthermore, hypo- and hyperthyroidism were chosen as conditions to induce fiber type transitions in both directions independent of neuromuscular activity. Changes in MLP expression were assessed at both the mRNA and protein levels and were correlated with fiber type transitions as judged by changes in MHC isoform composition. Our findings indicate that MLP expression is correlated with transitions from fast to slower fiber types.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Experimental models. The following muscles and conditions were studied: 1) CLFS of fast-twitch extensor digitorum longus (EDL) and tibialis anterior (TA) muscles, leading to changes in MHC isoform composition as previously described (12); 2) compensatory hypertrophy of the EDL muscle by ablation of the TA muscle; 3) effects of hyperthyroidism and hypothyroidism on EDL, TA, and soleus muscles; 4) unweighting of soleus muscle by hindlimb suspension; and 5) gastrocnemius, plantaris, EDL, and TA muscles of the spontaneously myotonic ADR mouse (13). In all cases, animals were killed by lethal narcosis and exsanguination. The muscles were quickly excised, trimmed, chilled, and stored in liquid nitrogen. In the CLFS and compensatory hypertrophy experiments, corresponding muscles from the right hindlimb were used as controls. In the case of the ADR mouse, corresponding muscles from wild-type mice served as controls.

CLFS. Adult male Wistar rats (body mass 400-470 g) were stimulated (10 Hz, 0.2-ms impulse width, 24 h/day) via electrodes implanted laterally to the peroneal nerve of the left hindlimb.

Compensatory hypertrophy. Adult male Wistar rats (body mass 400-470 g) were anesthetized with Kemint (15.5 mg/100 g body wt; Alvetra, Neumünster, Germany) and Rompun (0.6 mg per animal; Bayer, Leverkusen, Germany). Under aseptic conditions, the distal tendon of the left TA muscle was sectioned above the retinaculum and then separated from the underlying structures by blunt dissection as close as possible to its proximal insertion. Animals were killed after 8 days.

Hypothyroidism and hyperthyroidism. Hypothyroidism was induced by feeding the rats an iodine-poor diet for 6 wk (Altromin C1042; Altromin, Lage, Germany) containing 0.2% propylthiouracil and by adding 0.1% propylthiouracil to the drinking water. Hyperthyroidism was induced by implanting encapsulated tri-iodo-L-thyronine pellets (1.5 mg/pellet) with biodegradable carrier-binder (IRA, Toledo, OH). A second pellet was implanted after 3 wk. The animals were killed after 6 wk.

Hindlimb suspension. Soleus muscles of rats unweighted by hindlimb suspension for different time periods (25) were kindly provided by Dr. Laurence Stevens, Laboratoire de Plasticité Neuromusculaire, Université des Sciences et Technologies de Lille, France.

Myotonic ADR mouse. Five-week-old myotonic (adr/adr) and wild-type mice were a gift from Dr. Harald Jockusch, Developmental Biology Unit, University of Bielefeld, Germany (13).

RNA extraction and RT-PCR. After pulverization of the muscle in a liquid N2-cooled steel mortar, total RNA was extracted by homogenization of 50 mg muscle powder in 1 ml TriStar (Hybaid, Germany). RNA was isolated according to the manufacturer's instructions for RNA preparation using three modifications: 1) after homogenization, proteins and insoluble material were removed by 10 min of centrifugation at 12,000 g and 4°C; 2) phase separation was performed using 1-bromo-3-chloropropane (Fluka); and 3) RNA was precipitated by adding isopropanol (0.25 ml per ml Trireagent) and high-salt buffer (0.25 ml per ml precipitation). After centrifugation, pellets were dissolved in water, RNA concentration was assessed spectrophotometrically, and its quality was checked on 1% agarose gels. For the two-step RT-PCR, cDNA synthesis was carried out with 0.4 µg RNA, 200 units SuperScript RNase H- RT (GIBCO BRL), 400 nM oligo(dT) primer (Pharmacia). The temperature profile was as follows: 5 min at 65°C, 60 min at 37°C, and 5 min at 75°C. A 1:10 dilution of the cDNA was amplified using 1 unit Taq polymerase (Quantum Appligene), 200 µM dNTP, 1× Taq buffer (Quantum Appligene), and 0.2 µM of each primer. Primers for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplification were ACCCATCACCATCTTCCAGGAGCG and CGGGAAGCTCACTGGCATGGCCTT (MWG Biotech). Primers for MLP amplification were TCTACCATGCAGAAGAAATCC and GTGTAAGCCCTCCAAACC (Interactiva Biotechnologie, Ulm, Germany). The temperature profile was 30 s at 95°C, 30 s at 55°C, and 1 min at 72°C for 23 cycles (GAPDH) or 25 cycles (MLP). The amplified cDNAs were visualized on an ethidium bromide stained 6% polyacrylamide gel under ultraviolet light (254 nm). Band intensities were evaluated using the Scanpack software (Biometra, Göttingen, Germany). For an internal control, MLP band intensities were referred to GAPDH band intensities.

Electrophoretic analysis of MHC isoforms. MHC isoform distribution was electrophoretically examined as previously described (9).

Western blot analysis. Total muscle protein (~250 µg) was separated on a 12% SDS polyacrylamide gel. Transfer on nitrocellulose membrane (Schleicher & Schuell) was performed according to that described in Ref. 28. The membrane was blocked with 5% fat-free milk powder and 1% BSA in 20 mM Tris · HCl (pH 7.6), 137 mM NaCl, and subsequently incubated for 1 h with the antibodies diluted in the blocking solution. MLP antibodies were obtained as described before (23). Desmin antibodies were from Sigma. Peroxidase-coupled secondary antibodies were applied, and detection was performed with the enhanced chemiluminescence-Western Blot detection reagent (Amersham).

Statistical evaluation. Data are presented as means ± SD. All data were analyzed using Student's t-test to determine differences between experimental and control muscles. The acceptable level of significance was set at P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

CLFS and compensatory hypertrophy were chosen to study effects of increased neuromuscular activity and mechanical loading on the expression of MLP in fast-twitch muscles. These studies were complemented by analyzing fast skeletal muscles of the myotonic ADR mouse, a myotonic mutant with muscular hyperactivity due to a lack of functional chloride channels (24). Effects of mechanical unloading were studied in the unweighted slow-twitch soleus muscle. Finally, the influence of hypothyroidism and hyperthyroidism on MLP expression were investigated in fast- and slow-twitch muscles undergoing fast-to-slow or slow-to-fast transitions, respectively.

Effects of CLFS. Stimulation periods of 6 h were sufficient to drastically increase MLP mRNA in rat TA muscle (Fig. 1). Maximum expression levels were reached after 1 day of CLFS. Longer stimulation periods (up to 8 days) did not lead to further increases. Low amounts of MLP protein were first detected in 4-day-stimulated TA muscles (Fig. 2). Prolonged stimulation resulted in further increases. The upregulation of MLP in low-frequency stimulated EDL muscle followed a similar time course (Fig. 3).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Densitometric evaluation of muscle LIM protein (MLP) mRNA in tibialis anterior (TA) muscles of rats stimulated for different periods of time. Transcripts were reverse-transcribed and amplified with two different primer sets, one for MLP and one for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as internal control. TA muscles from the contralateral hindlimb served as controls. MLP mRNA levels were referred to GAPDH mRNA levels. Values are means ± SD, n = 3. d, Day.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2.   Densitometric evaluation of MLP protein as assessed by immunoblotting of TA muscle homogenates from rats stimulated for different time periods. Desmin served as an internal control. Contralateral TA muscles from the same animals were used as controls. Values are means ± SD, n = 3.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3.   Immunoblot detection of MLP in extensor digitorum longus (EDL) muscles stimulated for different periods of time (Stim). Contralateral EDL muscles from the same animals were used as controls (Co). An extract from slow-twitch soleus (SOL) muscle was analyzed for comparison of MLP expression. Desmin was detected as an internal control.

Effects of mechanical overloading. Compensatory hypertrophy of the EDL muscle 8 days after surgical ablation of the TA muscle was accompanied by a pronounced upregulation of MLP at both the mRNA and protein levels (Fig. 4).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4.   MLP mRNA transcript and protein levels in contralateral and hypertrophic rat EDL muscles following 6-wk compensatory hypertrophy by synergist removal. Expression levels in the contralateral control muscles were set equal to 100%. Values are means ± SD of 4 animals.

Myotonic mouse muscles. MLP expression was studied in four fast-twitch muscles from myotonic mice: gastrocnemius and TA for MLP mRNA, and EDL and plantaris for MLP protein. Corresponding muscles from wild-type mice served as controls. MLP mRNA was hardly detectable in the fast-twitch gastrocnemius and TA muscles of wild-type mice, whereas it was present at high levels in gastrocnemius and TA muscles from ADR mice (Fig. 5). Similarly, MLP protein was absent in wild-type EDL and plantaris muscles but was present at high levels in the corresponding muscles of myotonic mice (Fig. 6).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   MLP mRNA levels detected by RT-PCR in TA and gastrocnemius (GAS) muscles from the mutant ADR mouse compared with the wild-type (WT) mouse. GAPDH mRNA was amplified as an internal control. Values are means ± SD of 4 animals.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6.   Immunoblot detection of MLP protein levels in fast-twitch plantaris (PL) and EDL muscles from WT and mutant ADR mice. Desmin served as an internal standard.

MLP expression during slow-to-fast transition. Effects of reduced mechanical loading were studied in rat soleus muscles unloaded by hindlimb suspension for different time periods. We observed an approximately threefold increase of the MLP transcript in 7-day unloaded soleus muscle (Fig. 7). MLP mRNA remained elevated also in 15-day and 28-day unloaded soleus muscles. In contrast to its enhanced expression at the mRNA level, MLP protein, constitutively high in soleus muscle, was unaltered under the same conditions (Fig. 8).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7.   MLP mRNA levels in rat SOL muscles after 4, 7, 15, and 28 days of unloading by hindlimb suspension. SOL muscles from age-mated rats were used as controls. Insert: a representative ethidium bromide-stained polyacrylamide gel. Values are means ± SD of 5 animals. *Significant difference as referred to the controls.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 8.   MLP protein levels detected by immunoblotting in rat SOL muscles after 4, 7, and 14 days of unloading by hindlimb suspension. SOL muscles from age-mated rats served as controls. MLP levels were referred to desmin levels in the same muscles. Values are means ± SD of 5 animals.

MLP in hypo- and hyperthyroid fast-twitch and slow-twitch muscles. The well-established effects of elevated and reduced thyroid hormone levels on slow-to-fast and fast-to-slow fiber type transitions (4), respectively, were exploited to study potential changes in MLP expression under conditions of unaltered neuromuscular activity or mechanical loading. For this purpose, slow-twitch soleus and fast-twitch EDL and TA muscles were studied in rats after 6 wk of hypothyroidism and hyperthyroidism. Compared with the euthyroid state, hypothyroid soleus muscle exhibited an increase in MLP protein (see Fig. 10) but no increase in MLP mRNA (Fig. 9). The rise in MLP protein corresponded to the electrophoretically documented slow to slower transition in the MHC isoform pattern, i.e., an increase in MHCI and a decrease in MHCIIa (see Fig. 11). Changes in the opposite direction, namely an increase in MHCIIa and decrease in MHCI, were observed in hyperthyroid soleus muscles. However, under these conditions no changes were detected in MLP protein content (Fig. 10), although MLP transcript levels were reduced (Fig. 9).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9.   MLP mRNA levels in SOL muscles from euthyroid (control), hypothyroid (T3-), and hyperthyroid (T3+) rats. Intensities of MLP bands were referred to band intensities of GAPDH in the same muscles. Values are means ± SD (n = 5 for euthyroid, n = 6 for hypo- and hyperthyroid animals). *Significant difference as referred to control.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 10.   MLP protein levels in SOL muscles from euthyroid (control), hypothyroid (T3-), and hyperthyroid (T3+) rats detected by immunoblotting. Insert: a representative blot. Desmin was used as an internal standard. Values are means ± SD (n = 5 for euthyroid, n = 6 for hypo- and hyperthyroid animals). *Significant difference as referred to control.

No or much smaller changes were observed in the fast-twitch muscles under study. Thus MLP mRNA and protein levels were unaltered under conditions of hypo- and hyperthyroidism in EDL and TA muscles (results not shown). However, effects of hypothyroidism were observed at the level of MHC isoforms: EDL and TA muscles displayed slight increases in the relative concentration of MHCIIa in the hypothyroid state (Fig. 11).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 11.   MHC isoform composition of SOL (A), TA (B), and EDL (C) muscles from euthyroid (C), hypothyroid (T3-), and hyperthyroid rats (T3+). *Significant difference as referred to the controls.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

MLP is present at high levels in cardiac (1) and slow-twitch muscles (23). MLP protein is not detectable in fast-twitch muscles of the adult rat but can be induced by CLFS (23). MLP has also been shown to be upregulated in hindlimb muscles of the rat by denervation (1). These findings have led to the suggestion that MLP expression is neurally regulated. In both cases, MLP is upregulated under conditions that induce, albeit to different extents, transitions from fast to slower MHC isoforms (18). The induction of MLP in mouse hindlimb muscles, which are mainly composed of fast-twitch fibers, may be due to the abolishment of a repressive influence of the phasic high-frequency impulse pattern delivered to these muscles by their nerve. Several studies have shown that denervation of fast-twitch muscles results in a moderate upregulation of slower MHC isoforms (10, 11, 18). CLFS, which mimicks the tonic low-frequency impulse pattern of slow-type motoneurons, is thought to override the repressive effect of the neurally transmitted phasic impulse pattern and, therefore, might lead to an upregulation of MLP in fast-twitch muscle to similar levels as in slow-twitch muscle. Indeed, enhanced neuromuscular activity occurs in three experimental models under study. Confirming previous observations (23), we show that MLP is induced in fast-twitch muscle by CLFS. MLP is also induced by mechanical overloading. Both models are known to ultimately result, albeit to different extents, in transitions from fast to slower MHC isoforms (18). Furthermore, we show high levels of MLP in fast-twitch muscles of the myotonic ADR mouse, characterized by spontaneously elevated neuromuscular activity. Its fast TA and gastrocnemius muscles contain a pure MHCIIa type myosin that differs from the corresponding wild-type muscles by the absence of the faster MHCIIb and MHCIId isoforms (14). Obviously, MLP is expressed in the type IIA fibers of these muscles. This is in line with our previous immunohistochemical observations on low-frequency stimulated rat TA muscle where type IIA and type I fibers were the first to upregulate MLP (23).

The increase in MLP protein in the hypothyroid soleus muscle is associated with changes in myosin composition in the slow direction, namely an increase in MHCIbeta at the expense of MHCIIa. In the TA muscle, MLP protein content is unaffected by hypothyroidism, although myosin composition is slightly shifted toward MHCIIa. The failure to detect increases in MLP under this condition may relate to the relatively long duration of the hypothyroid state. Initial changes in MLP expression, both in the hypo- and hyperthyroid state, may have escaped detection at the 6-wk time points investigated. In any case, discrepancies between mRNA and protein levels, e.g., in the hypothyroid soleus muscle, indicate that MLP protein levels are controlled not only by transcriptional but also by posttranscriptional regulation, such as transcript stability, translational activity, and protein turnover.

The slow-to-fast transitions in MHC isoforms by hindlimb suspension in soleus muscle (25) do not lead to conspicuous changes in MLP protein expression. Under these conditions, MLP protein levels appear to be unaltered, whereas MLP mRNA increases, although only after 7 days. This delay is surprising, especially in view of the rapid increases in MLP mRNA observed in denervated (1) and low-frequency stimulated muscles (23). The increase in mRNA without alterations in protein amount represents another example pointing to the complex regulation of MLP expression. In this conjunction, it must also be taken into account that mechanical unloading not only shifts myosin composition toward faster isoforms but also causes pronounced muscle atrophy (26). The overlap of these two processes might lead to an atypical dissociation between MLP expression at the mRNA and protein levels.

Taken together, our observations indicate that MLP expression is upregulated under conditions leading to transitions in the direction from fast to slower MHC isoforms but is not downregulated under conditions leading to changes in the opposite direction. The upregulation of MLP in all experimental models known to induce fast-to-slower phenotype transitions is not unexpected in view of its high levels in transforming type IIA fibers and in type I fibers (23). A conspicuous finding is that the induction of MLP precedes the changes in MHC composition and of other myofibrillar proteins. The rapid time course of its induction points to a role for MLP during the early phase of sarcomeric remodeling. We propose that MLP is important for the rearrangement of the Z disk and its protein composition. The width of the Z disk is greatest in type I fibers, intermediate in type IIA, and smallest in type IIB fibers (5, 27). Increases in Z disk width have previously been demonstrated during CLFS-induced fast-to-slow conversion of rabbit muscle fibers (6). Moreover, these changes are paralleled by an exchange of fast with slow alpha -actinin isoforms (21). We speculate that MLP is involved in the remodeling of the Z disk and functions, similarly as in muscle development (1), as an adaptor protein for the proper arrangement of Z disk-associated myofibrillar and cytoskeletal proteins. This suggestion is in line with the demonstrated binding of MLP to alpha -actinin (16, 20), as well as to its specific association with beta -spectrin (7). Following the suggestion that MLP stabilizes the assembly of functional sarcomeres through interactions with skeletal alpha -actinin and beta -spectrin along the Z disk (7), its function may not only be important during myogenic differentiation but also during redifferentiation of adult muscle fibers in response to altered functional demands.

In summary, we show that the expression of MLP, a constitutive component of slow muscle fibers, is induced in fast-twitch muscle under conditions of enhanced neuromuscular activity leading to the expression of slower MHC isoforms, i.e., CLFS, mechanical overloading, and the myotonic state.


    ACKNOWLEDGEMENTS

We thank Dr. Laurence Stevens for supplying the muscles from hindlimb suspended rats and Professor Jockusch for supplying the ADR mice.


    FOOTNOTES

This study was supported by a grant from the Deutsche Forschungsgemeinschaft (Pe 62/25-3).

Address for reprint requests and other correspondence: D. Pette, Dept. of Biology, Univ. of Konstanz, D-78457 Konstanz, Germany, (E-mail: dirk.pette{at}uni-konstanz.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 17 April 2000; accepted in final form 1 September 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Arber, S, Halder G, and Caroni P. Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell 79: 221-231, 1994[Web of Science][Medline].

2.   Arber, S, Hunter JJ, Ross J, Hongo M, Sansig G, Borg J, Perriard JC, Chien KR, and Caroni P. MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell 88: 393-403, 1997[Web of Science][Medline].

3.   Bottinelli, R, Canepari M, Reggiani C, and Stienen GJM Myofibrillar ATPase activity during isometric contraction and isomyosin composition in rat single skinned muscle fibres. J Physiol (Lond) 481: 663-675, 1994[Abstract/Free Full Text].

4.   D'Albis, A, and Butler-Browne G. The hormonal control of myosin isoform expression in skeletal muscle of mammals: a review. Basic Appl Myol 3: 7-16, 1993.

5.   Eisenberg, BR. Quantitative ultrastructure of mammalian skeletal muscle. In: Handbook of Physiology. Skeletal Muscle. Bethesda, MD: Am. Physiol. Soc, 1983, sect. 10, chapt. 3, p. 73.

6.   Eisenberg, BR, and Salmons S. The reorganization of subcellular structure in muscle undergoing fast-to-slow type transformation: a stereological study. Cell Tissue Res 220: 449-471, 1981[Web of Science][Medline].

7.   Flick, MJ, and Konieczny SF. The muscle regulatory and structural protein MLP is a cytoskeletal binding partner of beta I-spectrin. J Cell Sci 113: 1553-1564, 2000[Abstract].

8.   Galler, S, Schmitt T, and Pette D. Stretch activation, unloaded shortening velocity, and myosin heavy chain isoforms of rat skeletal muscle fibres. J Physiol (Lond) 478: 523-531, 1994[Abstract/Free Full Text].

9.   Hämäläinen, N, and Pette D. Slow-to-fast transitions in myosin expression of rat soleus muscle by phasic high-frequency stimulation. FEBS Lett 399: 220-222, 1996[Web of Science][Medline].

10.   Huey, KA, and Bodine SC. Changes in myosin mRNA and protein expression in denervated rat soleus and tibialis anterior. Eur J Biochem 256: 45-50, 1998[Web of Science][Medline].

11.   Jakubiec-Puka, A, Ciechomska I, Morga J, and Matusiak A. Contents of myosin heavy chains in denervated slow and fast rat leg muscles. Comp Biochem Physiol B Biochem Mol Biol B122: 355-362, 1999[Medline].

12.   Jaschinski, F, Schuler M, Peuker H, and Pette D. Transitions in myosin heavy chain mRNA and protein isoforms of rat muscle during forced contractile activity. Am J Physiol Cell Physiol 274: C365-C371, 1998[Abstract/Free Full Text].

13.   Jockusch, H. Muscle fibre transformations in myotonic mouse mutants. In: The Dynamic State of Muscle Fibers, edited by Pette D.. Berlin, NY: de Gruyter, 1990, p. 429-443.

14.   Jockusch, H, Friedrichs G, and Zippel M. Serum parvalbumin, an indicator of muscle disease in murine dystrophy and myotonia. Muscle Nerve 13: 551-555, 1990[Web of Science][Medline].

15.   Kong, Y, Flick MJ, Kudla AJ, and Konieczny SF. Muscle LIM protein promotes myogenesis by enhancing the activity of MyoD. Mol Cell Biol 17: 4750-4760, 1997[Abstract/Free Full Text].

16.   Louis, HA, Pino JD, Schmeichel KL, Pomiès P, and Beckerle MC. Comparison of three members of the cysteine-rich protein family reveals functional conservation and divergent patterns of gene expression. J Biol Chem 272: 27484-27491, 1997[Abstract/Free Full Text].

17.   Michelsen, JW, Schmeichel KL, Beckerle MC, and Winge DR. The LIM motif defines a specific zinc binding protein domain. Proc Natl Acad Sci USA 90: 4404-4408, 1993[Abstract/Free Full Text].

18.   Pette, D, and Staron RS. Mammalian skeletal muscle fiber type transitions. Int Rev Cytol 170: 143-223, 1997[Medline].

19.   Pette, D, and Vrbová G. Adaptation of mammalian skeletal muscle fibers to chronic electrical stimulation. Rev Physiol Biochem Pharmacol 120: 116-202, 1992.

20.   Pomiès, P, Louis HA, and Beckerle MC. CRP1, a LIM domain protein implicated in muscle differentiation, interacts with alpha -actinin. J Cell Biol 139: 157-168, 1997[Abstract/Free Full Text].

21.   Schachat, FH, Williams RS, and Schnurr CA. Coordinate changes in fast thin filament and Z-line protein expression in the early response to chronic stimulation. J Biol Chem 263: 13975-13978, 1988[Abstract/Free Full Text].

22.   Schmeichel, KL, and Beckerle MC. The LIM domain is a modular protein-binding interface. Cell 79: 211-219, 1994[Web of Science][Medline].

23.   Schneider, AG, Sultan KR, and Pette D. Muscle LIM protein: expressed in slow muscle and induced in fast muscle by enhanced contractile activity. Am J Physiol Cell Physiol 276: C900-C906, 1999[Abstract/Free Full Text].

24.   Steinmeyer, K, Klocke R, Ortland C, Gronemeier M, Jockusch H, Gründer S, and Jentsch TJ. Inactivation of muscle chloride channel by transposon insertion in myotonic mice. Nature 354: 304-308, 1991[Medline].

25.   Stevens, L, Sultan KR, Peuker H, Gohlsch B, Mounier Y, and Pette D. Time-dependent changes in myosin heavy chain mRNA and protein isoforms in unloaded soleus muscle of rat. Am J Physiol Cell Physiol 277: C1044-C1049, 1999[Abstract/Free Full Text].

26.   Thomason, DB, and Booth FW. Atrophy of the soleus muscle by hindlimb unweighting. J Appl Physiol 68: 1-12, 1990[Abstract/Free Full Text].

27.   Thornell, L-E, Carlsson E, Kugelberg E, and Grove BK. Myofibrillar M-band structure and composition of physiologically defined rat motor units. Am J Physiol Cell Physiol 253: C456-C468, 1987[Abstract/Free Full Text].

28.   Towbin, H, Staehelin T, and Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76: 4350-4354, 1979[Abstract/Free Full Text].

29.   Weiskirchen, R, Pino JD, Macalma T, Bister K, and Beckerle MC. The cysteine-rich protein family of highly related LIM domain proteins. J Biol Chem 270: 28946-28954, 1995[Abstract/Free Full Text].


Am J Physiol Cell Physiol 280(2):C273-C279
0363-6143/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Exp PhysiolHome page
M. Velders, K. Legerlotz, S. J. Falconer, N. S. Stott, C. D. McMahon, and H. K. Smith
Effect of botulinum toxin A-induced paralysis and exercise training on mechanosensing and signalling gene expression in juvenile rat gastrocnemius muscle
Exp Physiol, December 1, 2008; 93(12): 1273 - 1283.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
I. A. Barash, M.-L. Bang, L. Mathew, M. L. Greaser, J. Chen, and R. L. Lieber
Structural and regulatory roles of muscle ankyrin repeat protein family in skeletal muscle
Am J Physiol Cell Physiol, July 1, 2007; 293(1): C218 - C227.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. M. Lehti, M. Silvennoinen, R. Kivela, H. Kainulainen, and J. Komulainen
Effects of streptozotocin-induced diabetes and physical training on gene expression of titin-based stretch-sensing complexes in mouse striated muscle
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E533 - E542.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
A. Raffaello, P. Laveder, C. Romualdi, C. Bean, L. Toniolo, E. Germinario, A. Megighian, D. Danieli-Betto, C. Reggiani, and G. Lanfranchi
Denervation in murine fast-twitch muscle: short-term physiological changes and temporal expression profiling
Physiol Genomics, March 13, 2006; 25(1): 60 - 74.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
I. A. Barash, L. Mathew, M. Lahey, M. L. Greaser, and R. L. Lieber
Muscle LIM protein plays both structural and functional roles in skeletal muscle
Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1312 - C1320.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Glenmark, M. Nilsson, H. Gao, J.-A. Gustafsson, K. Dahlman-Wright, and H. Westerblad
Difference in skeletal muscle function in males vs. females: role of estrogen receptor-{beta}
Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1125 - E1131.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
I. A. Barash, L. Mathew, A. F. Ryan, J. Chen, and R. L. Lieber
Rapid muscle-specific gene expression changes after a single bout of eccentric contractions in the mouse
Am J Physiol Cell Physiol, February 1, 2004; 286(2): C355 - C364.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Willmann, R.
Right arrow Articles by Pette, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Willmann, R.
Right arrow Articles by Pette, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online