|
|
||||||||
Department of Biology, University of Konstanz, D-78457 Konstanz, Germany
| |
ABSTRACT |
|---|
|
|
|---|
Muscle LIM protein (MLP) is constitutively expressed in slow, but undetectable in fast, muscles of the rat. Here we show that MLP was upregulated at both the mRNA and protein levels under experimental conditions leading to transitions from fast to slower phenotypes. Chronic low-frequency stimulation and mechanical overloading by synergist removal both induced fast-to-slow shifts in myosin heavy chain (MHC) isoforms and expression of MLP in fast muscles. High amounts of MLP mRNA and protein were also present in fast muscles of the myotonic, hyperactive ADR mouse. Hypothyroidism evoked shifts in myosin composition toward slower isoforms and increased the MLP protein content of soleus (SOL) muscle but failed to induce MLP in fast muscles. Unweighting by hindlimb suspension elicited slow-to-fast transitions in MHC expression without altering MLP levels in SOL muscle. Hyperthyroidism shifted the MHC pattern toward faster isoforms but did not affect MLP content in SOL muscle. We conclude that alterations in MLP expression are associated with transitions from fast to slower phenotypes but not with slow-to-fast muscle fiber transitions.
ADR mouse; chronic low-frequency stimulation; fiber type transition; hindlimb suspension; mechanical overloading; myotonia; thyroid hormone
| |
INTRODUCTION |
|---|
|
|
|---|
MUSCLE LIM PROTEIN (MLP)
IS a member of the cystein-rich LIM protein family
(29). The LIM domain encompasses double zinc fingerlike
motifs, with each finger coordinating a single zinc ion to specific
cysteine and histidine residues (17). LIM domains have
been shown to serve as protein-binding interfaces (22). MLP has been proposed to play an important role in myogenesis and in
the promotion of myogenic differentiation (1). This function has been related to its myofibrillar location in close vicinity to the Z disk (1) and its interaction with
-actinin (20). It has also been suggested that MLP
serves as a cofactor for the myogenic basic helix-loop-helix proteins
by increasing their interaction with specific DNA-regulatory elements
(15). Moreover, the role of MLP in myogenesis is
emphasized by the finding that MLP-deficient mice display a
cardiomyopathy due to a disruption of the cardiac cytoarchitectural
organization (2). In addition, enhanced fatigability of
limb muscles was observed in the MLP-deficient mouse.
The expression of MLP in adult muscle is thought to be neurally
regulated. In the adult rat, MLP protein is present in similarly high
amounts in cardiac and slow-twitch muscle (soleus) but is not
detectable in fast-twitch muscles. However, we recently showed that MLP
can be induced in fast-twitch muscle by chronic low-frequency stimulation (CLFS) (23). CLFS has been shown to elicit
sequential fast-to-slow fiber type transitions in various mammals (for
reviews, see Refs. 18 and 19). These transitions are also
reflected by sequential changes in myosin heavy chain (MHC) isoform
expression. Generally, these transitions follow the order
MHCIIb
MHCIId(x)
MHCIIa
MHCI
. According to single fiber
studies on rat muscle (3, 8), MHCIIb-containing fibers are
the fastest, while MHCI
-containing fibers are the slowest.
MHCIId(x)- and MHCIIa-containing fibers are intermediate. Whereas CLFS
ultimately transforms fast-twitch muscles of rabbit and larger mammals
into slow-twitch muscles predominantly expressing MHCI
, CLFS-induced
transformation does not attain this stage in smaller mammals. Thus
long-term stimulation of rat muscle induces pronounced increases in
MHCIIa but only small amounts of MHCI
(12).
The aim of the present study was to investigate under which conditions MLP is upregulated in adult muscle of rat and mouse, especially with regard to experimentally induced fiber type transformation. For this purpose, MLP expression was studied under various kinds of induced fiber type transitions. Different experimental models were chosen to induce fast-to-slow as well as slow-to-fast fiber type transitions. Transitions toward slower phenotypes were elicited by experimentally increased neuromuscular activity using the CLFS model and by increasing the mechanical load by synergist ablation (compensatory hypertrophy). In addition, our studies included the myotonic ADR (arrested development of righting response) mouse as an example of spontaneous neuromuscular hyperactivity (13). Slow-to-fast transitions were induced by decreasing the mechanical load of the muscle using the hindlimb suspension model. Furthermore, hypo- and hyperthyroidism were chosen as conditions to induce fiber type transitions in both directions independent of neuromuscular activity. Changes in MLP expression were assessed at both the mRNA and protein levels and were correlated with fiber type transitions as judged by changes in MHC isoform composition. Our findings indicate that MLP expression is correlated with transitions from fast to slower fiber types.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Experimental models. The following muscles and conditions were studied: 1) CLFS of fast-twitch extensor digitorum longus (EDL) and tibialis anterior (TA) muscles, leading to changes in MHC isoform composition as previously described (12); 2) compensatory hypertrophy of the EDL muscle by ablation of the TA muscle; 3) effects of hyperthyroidism and hypothyroidism on EDL, TA, and soleus muscles; 4) unweighting of soleus muscle by hindlimb suspension; and 5) gastrocnemius, plantaris, EDL, and TA muscles of the spontaneously myotonic ADR mouse (13). In all cases, animals were killed by lethal narcosis and exsanguination. The muscles were quickly excised, trimmed, chilled, and stored in liquid nitrogen. In the CLFS and compensatory hypertrophy experiments, corresponding muscles from the right hindlimb were used as controls. In the case of the ADR mouse, corresponding muscles from wild-type mice served as controls.
CLFS. Adult male Wistar rats (body mass 400-470 g) were stimulated (10 Hz, 0.2-ms impulse width, 24 h/day) via electrodes implanted laterally to the peroneal nerve of the left hindlimb.
Compensatory hypertrophy. Adult male Wistar rats (body mass 400-470 g) were anesthetized with Kemint (15.5 mg/100 g body wt; Alvetra, Neumünster, Germany) and Rompun (0.6 mg per animal; Bayer, Leverkusen, Germany). Under aseptic conditions, the distal tendon of the left TA muscle was sectioned above the retinaculum and then separated from the underlying structures by blunt dissection as close as possible to its proximal insertion. Animals were killed after 8 days.
Hypothyroidism and hyperthyroidism. Hypothyroidism was induced by feeding the rats an iodine-poor diet for 6 wk (Altromin C1042; Altromin, Lage, Germany) containing 0.2% propylthiouracil and by adding 0.1% propylthiouracil to the drinking water. Hyperthyroidism was induced by implanting encapsulated tri-iodo-L-thyronine pellets (1.5 mg/pellet) with biodegradable carrier-binder (IRA, Toledo, OH). A second pellet was implanted after 3 wk. The animals were killed after 6 wk.
Hindlimb suspension. Soleus muscles of rats unweighted by hindlimb suspension for different time periods (25) were kindly provided by Dr. Laurence Stevens, Laboratoire de Plasticité Neuromusculaire, Université des Sciences et Technologies de Lille, France.
Myotonic ADR mouse. Five-week-old myotonic (adr/adr) and wild-type mice were a gift from Dr. Harald Jockusch, Developmental Biology Unit, University of Bielefeld, Germany (13).
RNA extraction and RT-PCR.
After pulverization of the muscle in a liquid N2-cooled
steel mortar, total RNA was extracted by homogenization of 50 mg muscle powder in 1 ml TriStar (Hybaid, Germany). RNA was isolated according to
the manufacturer's instructions for RNA preparation using three modifications: 1) after homogenization, proteins and
insoluble material were removed by 10 min of centrifugation at 12,000 g and 4°C; 2) phase separation was performed
using 1-bromo-3-chloropropane (Fluka); and 3) RNA was
precipitated by adding isopropanol (0.25 ml per ml Trireagent) and
high-salt buffer (0.25 ml per ml precipitation). After centrifugation,
pellets were dissolved in water, RNA concentration was assessed
spectrophotometrically, and its quality was checked on 1% agarose
gels. For the two-step RT-PCR, cDNA synthesis was carried out with 0.4 µg RNA, 200 units SuperScript RNase H
RT (GIBCO BRL),
400 nM oligo(dT) primer (Pharmacia). The temperature profile was as
follows: 5 min at 65°C, 60 min at 37°C, and 5 min at 75°C. A 1:10
dilution of the cDNA was amplified using 1 unit Taq
polymerase (Quantum Appligene), 200 µM dNTP, 1× Taq
buffer (Quantum Appligene), and 0.2 µM of each primer. Primers for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplification were
ACCCATCACCATCTTCCAGGAGCG and CGGGAAGCTCACTGGCATGGCCTT (MWG Biotech).
Primers for MLP amplification were TCTACCATGCAGAAGAAATCC and
GTGTAAGCCCTCCAAACC (Interactiva Biotechnologie, Ulm, Germany). The
temperature profile was 30 s at 95°C, 30 s at 55°C, and 1 min at 72°C for 23 cycles (GAPDH) or 25 cycles (MLP). The amplified
cDNAs were visualized on an ethidium bromide stained 6% polyacrylamide
gel under ultraviolet light (254 nm). Band intensities were evaluated
using the Scanpack software (Biometra, Göttingen, Germany). For
an internal control, MLP band intensities were referred to GAPDH band intensities.
Electrophoretic analysis of MHC isoforms. MHC isoform distribution was electrophoretically examined as previously described (9).
Western blot analysis. Total muscle protein (~250 µg) was separated on a 12% SDS polyacrylamide gel. Transfer on nitrocellulose membrane (Schleicher & Schuell) was performed according to that described in Ref. 28. The membrane was blocked with 5% fat-free milk powder and 1% BSA in 20 mM Tris · HCl (pH 7.6), 137 mM NaCl, and subsequently incubated for 1 h with the antibodies diluted in the blocking solution. MLP antibodies were obtained as described before (23). Desmin antibodies were from Sigma. Peroxidase-coupled secondary antibodies were applied, and detection was performed with the enhanced chemiluminescence-Western Blot detection reagent (Amersham).
Statistical evaluation. Data are presented as means ± SD. All data were analyzed using Student's t-test to determine differences between experimental and control muscles. The acceptable level of significance was set at P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
CLFS and compensatory hypertrophy were chosen to study effects of increased neuromuscular activity and mechanical loading on the expression of MLP in fast-twitch muscles. These studies were complemented by analyzing fast skeletal muscles of the myotonic ADR mouse, a myotonic mutant with muscular hyperactivity due to a lack of functional chloride channels (24). Effects of mechanical unloading were studied in the unweighted slow-twitch soleus muscle. Finally, the influence of hypothyroidism and hyperthyroidism on MLP expression were investigated in fast- and slow-twitch muscles undergoing fast-to-slow or slow-to-fast transitions, respectively.
Effects of CLFS.
Stimulation periods of 6 h were sufficient to drastically
increase MLP mRNA in rat TA muscle (Fig.
1). Maximum expression levels were
reached after 1 day of CLFS. Longer stimulation periods (up to 8 days)
did not lead to further increases. Low amounts of MLP protein were
first detected in 4-day-stimulated TA muscles (Fig.
2). Prolonged stimulation resulted in
further increases. The upregulation of MLP in low-frequency stimulated
EDL muscle followed a similar time course (Fig.
3).
|
|
|
Effects of mechanical overloading.
Compensatory hypertrophy of the EDL muscle 8 days after surgical
ablation of the TA muscle was accompanied by a pronounced upregulation
of MLP at both the mRNA and protein levels (Fig. 4).
|
Myotonic mouse muscles.
MLP expression was studied in four fast-twitch muscles from myotonic
mice: gastrocnemius and TA for MLP mRNA, and EDL and plantaris for MLP
protein. Corresponding muscles from wild-type mice served as controls.
MLP mRNA was hardly detectable in the fast-twitch gastrocnemius and TA
muscles of wild-type mice, whereas it was present at high levels in
gastrocnemius and TA muscles from ADR mice (Fig.
5). Similarly, MLP protein was absent in
wild-type EDL and plantaris muscles but was present at high levels in
the corresponding muscles of myotonic mice (Fig.
6).
|
|
MLP expression during slow-to-fast transition.
Effects of reduced mechanical loading were studied in rat soleus
muscles unloaded by hindlimb suspension for different time periods. We
observed an approximately threefold increase of the MLP transcript in
7-day unloaded soleus muscle (Fig. 7).
MLP mRNA remained elevated also in 15-day and 28-day unloaded soleus
muscles. In contrast to its enhanced expression at the mRNA level, MLP protein, constitutively high in soleus muscle, was unaltered under the
same conditions (Fig. 8).
|
|
MLP in hypo- and hyperthyroid fast-twitch and slow-twitch muscles.
The well-established effects of elevated and reduced thyroid hormone
levels on slow-to-fast and fast-to-slow fiber type transitions (4), respectively, were exploited to study potential
changes in MLP expression under conditions of unaltered neuromuscular activity or mechanical loading. For this purpose, slow-twitch soleus
and fast-twitch EDL and TA muscles were studied in rats after 6 wk of
hypothyroidism and hyperthyroidism. Compared with the euthyroid state,
hypothyroid soleus muscle exhibited an increase in MLP protein (see
Fig. 10) but no increase in MLP mRNA (Fig. 9). The rise in MLP protein corresponded
to the electrophoretically documented slow to slower transition in the
MHC isoform pattern, i.e., an increase in MHCI and a decrease in MHCIIa
(see Fig. 11). Changes in the opposite direction, namely an increase in
MHCIIa and decrease in MHCI, were observed in hyperthyroid soleus
muscles. However, under these conditions no changes were detected in
MLP protein content (Fig. 10), although
MLP transcript levels were reduced (Fig. 9).
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
MLP is present at high levels in cardiac (1) and slow-twitch muscles (23). MLP protein is not detectable in fast-twitch muscles of the adult rat but can be induced by CLFS (23). MLP has also been shown to be upregulated in hindlimb muscles of the rat by denervation (1). These findings have led to the suggestion that MLP expression is neurally regulated. In both cases, MLP is upregulated under conditions that induce, albeit to different extents, transitions from fast to slower MHC isoforms (18). The induction of MLP in mouse hindlimb muscles, which are mainly composed of fast-twitch fibers, may be due to the abolishment of a repressive influence of the phasic high-frequency impulse pattern delivered to these muscles by their nerve. Several studies have shown that denervation of fast-twitch muscles results in a moderate upregulation of slower MHC isoforms (10, 11, 18). CLFS, which mimicks the tonic low-frequency impulse pattern of slow-type motoneurons, is thought to override the repressive effect of the neurally transmitted phasic impulse pattern and, therefore, might lead to an upregulation of MLP in fast-twitch muscle to similar levels as in slow-twitch muscle. Indeed, enhanced neuromuscular activity occurs in three experimental models under study. Confirming previous observations (23), we show that MLP is induced in fast-twitch muscle by CLFS. MLP is also induced by mechanical overloading. Both models are known to ultimately result, albeit to different extents, in transitions from fast to slower MHC isoforms (18). Furthermore, we show high levels of MLP in fast-twitch muscles of the myotonic ADR mouse, characterized by spontaneously elevated neuromuscular activity. Its fast TA and gastrocnemius muscles contain a pure MHCIIa type myosin that differs from the corresponding wild-type muscles by the absence of the faster MHCIIb and MHCIId isoforms (14). Obviously, MLP is expressed in the type IIA fibers of these muscles. This is in line with our previous immunohistochemical observations on low-frequency stimulated rat TA muscle where type IIA and type I fibers were the first to upregulate MLP (23).
The increase in MLP protein in the hypothyroid soleus muscle is
associated with changes in myosin composition in the slow direction,
namely an increase in MHCI
at the expense of MHCIIa. In the TA
muscle, MLP protein content is unaffected by hypothyroidism, although myosin composition is slightly shifted toward MHCIIa. The
failure to detect increases in MLP under this condition may relate to
the relatively long duration of the hypothyroid state. Initial changes
in MLP expression, both in the hypo- and hyperthyroid state, may have
escaped detection at the 6-wk time points investigated. In any case,
discrepancies between mRNA and protein levels, e.g., in the hypothyroid
soleus muscle, indicate that MLP protein levels are controlled not only
by transcriptional but also by posttranscriptional regulation, such as
transcript stability, translational activity, and protein turnover.
The slow-to-fast transitions in MHC isoforms by hindlimb suspension in soleus muscle (25) do not lead to conspicuous changes in MLP protein expression. Under these conditions, MLP protein levels appear to be unaltered, whereas MLP mRNA increases, although only after 7 days. This delay is surprising, especially in view of the rapid increases in MLP mRNA observed in denervated (1) and low-frequency stimulated muscles (23). The increase in mRNA without alterations in protein amount represents another example pointing to the complex regulation of MLP expression. In this conjunction, it must also be taken into account that mechanical unloading not only shifts myosin composition toward faster isoforms but also causes pronounced muscle atrophy (26). The overlap of these two processes might lead to an atypical dissociation between MLP expression at the mRNA and protein levels.
Taken together, our observations indicate that MLP expression is
upregulated under conditions leading to transitions in the direction
from fast to slower MHC isoforms but is not downregulated under
conditions leading to changes in the opposite direction. The
upregulation of MLP in all experimental models known to induce fast-to-slower phenotype transitions is not unexpected in view of its
high levels in transforming type IIA fibers and in type I fibers
(23). A conspicuous finding is that the induction of MLP
precedes the changes in MHC composition and of other myofibrillar proteins. The rapid time course of its induction points to a role for
MLP during the early phase of sarcomeric remodeling. We propose that
MLP is important for the rearrangement of the Z disk and its protein
composition. The width of the Z disk is greatest in type I fibers,
intermediate in type IIA, and smallest in type IIB fibers (5,
27). Increases in Z disk width have previously been demonstrated
during CLFS-induced fast-to-slow conversion of rabbit muscle fibers
(6). Moreover, these changes are paralleled by an exchange
of fast with slow
-actinin isoforms (21). We speculate
that MLP is involved in the remodeling of the Z disk and functions,
similarly as in muscle development (1), as an adaptor
protein for the proper arrangement of Z disk-associated myofibrillar
and cytoskeletal proteins. This suggestion is in line with the
demonstrated binding of MLP to
-actinin (16, 20), as
well as to its specific association with
-spectrin (7).
Following the suggestion that MLP stabilizes the assembly of functional
sarcomeres through interactions with skeletal
-actinin and
-spectrin along the Z disk (7), its function may not
only be important during myogenic differentiation but also during
redifferentiation of adult muscle fibers in response to altered
functional demands.
In summary, we show that the expression of MLP, a constitutive component of slow muscle fibers, is induced in fast-twitch muscle under conditions of enhanced neuromuscular activity leading to the expression of slower MHC isoforms, i.e., CLFS, mechanical overloading, and the myotonic state.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Laurence Stevens for supplying the muscles from hindlimb suspended rats and Professor Jockusch for supplying the ADR mice.
| |
FOOTNOTES |
|---|
This study was supported by a grant from the Deutsche Forschungsgemeinschaft (Pe 62/25-3).
Address for reprint requests and other correspondence: D. Pette, Dept. of Biology, Univ. of Konstanz, D-78457 Konstanz, Germany, (E-mail: dirk.pette{at}uni-konstanz.de).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 17 April 2000; accepted in final form 1 September 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arber, S,
Halder G,
and
Caroni P.
Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation.
Cell
79:
221-231,
1994[ISI][Medline].
2.
Arber, S,
Hunter JJ,
Ross J,
Hongo M,
Sansig G,
Borg J,
Perriard JC,
Chien KR,
and
Caroni P.
MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure.
Cell
88:
393-403,
1997[ISI][Medline].
3.
Bottinelli, R,
Canepari M,
Reggiani C,
and
Stienen GJM
Myofibrillar ATPase activity during isometric contraction and isomyosin composition in rat single skinned muscle fibres.
J Physiol (Lond)
481:
663-675,
1994[ISI][Medline].
4.
D'Albis, A,
and
Butler-Browne G.
The hormonal control of myosin isoform expression in skeletal muscle of mammals: a review.
Basic Appl Myol
3:
7-16,
1993.
5.
Eisenberg, BR.
Quantitative ultrastructure of mammalian skeletal muscle.
In: Handbook of Physiology. Skeletal Muscle. Bethesda, MD: Am. Physiol. Soc, 1983, sect. 10, chapt. 3, p. 73.
6.
Eisenberg, BR,
and
Salmons S.
The reorganization of subcellular structure in muscle undergoing fast-to-slow type transformation: a stereological study.
Cell Tissue Res
220:
449-471,
1981[ISI][Medline].
7.
Flick, MJ,
and
Konieczny SF.
The muscle regulatory and structural protein MLP is a cytoskeletal binding partner of beta I-spectrin.
J Cell Sci
113:
1553-1564,
2000[Abstract].
8.
Galler, S,
Schmitt T,
and
Pette D.
Stretch activation, unloaded shortening velocity, and myosin heavy chain isoforms of rat skeletal muscle fibres.
J Physiol (Lond)
478:
523-531,
1994[ISI][Medline].
9.
Hämäläinen, N,
and
Pette D.
Slow-to-fast transitions in myosin expression of rat soleus muscle by phasic high-frequency stimulation.
FEBS Lett
399:
220-222,
1996[ISI][Medline].
10.
Huey, KA,
and
Bodine SC.
Changes in myosin mRNA and protein expression in denervated rat soleus and tibialis anterior.
Eur J Biochem
256:
45-50,
1998[ISI][Medline].
11.
Jakubiec-Puka, A,
Ciechomska I,
Morga J,
and
Matusiak A.
Contents of myosin heavy chains in denervated slow and fast rat leg muscles.
Comp Biochem Physiol B Biochem Mol Biol
B122:
355-362,
1999[Medline].
12.
Jaschinski, F,
Schuler M,
Peuker H,
and
Pette D.
Transitions in myosin heavy chain mRNA and protein isoforms of rat muscle during forced contractile activity.
Am J Physiol Cell Physiol
274:
C365-C371,
1998
13.
Jockusch, H.
Muscle fibre transformations in myotonic mouse mutants.
In: The Dynamic State of Muscle Fibers, edited by Pette D.. Berlin, NY: de Gruyter, 1990, p. 429-443.
14.
Jockusch, H,
Friedrichs G,
and
Zippel M.
Serum parvalbumin, an indicator of muscle disease in murine dystrophy and myotonia.
Muscle Nerve
13:
551-555,
1990[ISI][Medline].
15.
Kong, Y,
Flick MJ,
Kudla AJ,
and
Konieczny SF.
Muscle LIM protein promotes myogenesis by enhancing the activity of MyoD.
Mol Cell Biol
17:
4750-4760,
1997[Abstract].
16.
Louis, HA,
Pino JD,
Schmeichel KL,
Pomiès P,
and
Beckerle MC.
Comparison of three members of the cysteine-rich protein family reveals functional conservation and divergent patterns of gene expression.
J Biol Chem
272:
27484-27491,
1997
17.
Michelsen, JW,
Schmeichel KL,
Beckerle MC,
and
Winge DR.
The LIM motif defines a specific zinc binding protein domain.
Proc Natl Acad Sci USA
90:
4404-4408,
1993
18.
Pette, D,
and
Staron RS.
Mammalian skeletal muscle fiber type transitions.
Int Rev Cytol
170:
143-223,
1997[Medline].
19.
Pette, D,
and
Vrbová G.
Adaptation of mammalian skeletal muscle fibers to chronic electrical stimulation.
Rev Physiol Biochem Pharmacol
120:
116-202,
1992.
20.
Pomiès, P,
Louis HA,
and
Beckerle MC.
CRP1, a LIM domain protein implicated in muscle differentiation, interacts with
-actinin.
J Cell Biol
139:
157-168,
1997
21.
Schachat, FH,
Williams RS,
and
Schnurr CA.
Coordinate changes in fast thin filament and Z-line protein expression in the early response to chronic stimulation.
J Biol Chem
263:
13975-13978,
1988
22.
Schmeichel, KL,
and
Beckerle MC.
The LIM domain is a modular protein-binding interface.
Cell
79:
211-219,
1994[ISI][Medline].
23.
Schneider, AG,
Sultan KR,
and
Pette D.
Muscle LIM protein: expressed in slow muscle and induced in fast muscle by enhanced contractile activity.
Am J Physiol Cell Physiol
276:
C900-C906,
1999
24.
Steinmeyer, K,
Klocke R,
Ortland C,
Gronemeier M,
Jockusch H,
Gründer S,
and
Jentsch TJ.
Inactivation of muscle chloride channel by transposon insertion in myotonic mice.
Nature
354:
304-308,
1991[Medline].
25.
Stevens, L,
Sultan KR,
Peuker H,
Gohlsch B,
Mounier Y,
and
Pette D.
Time-dependent changes in myosin heavy chain mRNA and protein isoforms in unloaded soleus muscle of rat.
Am J Physiol Cell Physiol
277:
C1044-C1049,
1999
26.
Thomason, DB,
and
Booth FW.
Atrophy of the soleus muscle by hindlimb unweighting.
J Appl Physiol
68:
1-12,
1990
27.
Thornell, L-E,
Carlsson E,
Kugelberg E,
and
Grove BK.
Myofibrillar M-band structure and composition of physiologically defined rat motor units.
Am J Physiol Cell Physiol
253:
C456-C468,
1987
28.
Towbin, H,
Staehelin T,
and
Gordon J.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc Natl Acad Sci USA
76:
4350-4354,
1979
29.
Weiskirchen, R,
Pino JD,
Macalma T,
Bister K,
and
Beckerle MC.
The cysteine-rich protein family of highly related LIM domain proteins.
J Biol Chem
270:
28946-28954,
1995
This article has been cited by other articles:
![]() |
I. A. Barash, M.-L. Bang, L. Mathew, M. L. Greaser, J. Chen, and R. L. Lieber Structural and regulatory roles of muscle ankyrin repeat protein family in skeletal muscle Am J Physiol Cell Physiol, July 1, 2007; 293(1): C218 - C227. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Lehti, M. Silvennoinen, R. Kivela, H. Kainulainen, and J. Komulainen Effects of streptozotocin-induced diabetes and physical training on gene expression of titin-based stretch-sensing complexes in mouse striated muscle Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E533 - E542. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Raffaello, P. Laveder, C. Romualdi, C. Bean, L. Toniolo, E. Germinario, A. Megighian, D. Danieli-Betto, C. Reggiani, and G. Lanfranchi Denervation in murine fast-twitch muscle: short-term physiological changes and temporal expression profiling Physiol Genomics, March 13, 2006; 25(1): 60 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Barash, L. Mathew, M. Lahey, M. L. Greaser, and R. L. Lieber Muscle LIM protein plays both structural and functional roles in skeletal muscle Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1312 - C1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Glenmark, M. Nilsson, H. Gao, J.-A. Gustafsson, K. Dahlman-Wright, and H. Westerblad Difference in skeletal muscle function in males vs. females: role of estrogen receptor-{beta} Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1125 - E1131. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. A. Barash, L. Mathew, A. F. Ryan, J. Chen, and R. L. Lieber Rapid muscle-specific gene expression changes after a single bout of eccentric contractions in the mouse Am J Physiol Cell Physiol, February 1, 2004; 286(2): C355 - C364. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |