Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 279: C1733-C1743, 2000;
0363-6143/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, T. W.
Right arrow Articles by Fong, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, T. W.
Right arrow Articles by Fong, S.
Vol. 279, Issue 6, C1733-C1743, December 2000

Characterization of huJAM: evidence for involvement in cell-cell contact and tight junction regulation

Tony W. Liang1, Richard A. DeMarco1, Randy J. Mrsny2, Austin Gurney3, Alane Gray3, Jeffery Hooley4, Holly L. Aaron4, Arthur Huang3, Toni Klassen5, Daniel B. Tumas6, and Sherman Fong1

1 Department of Immunology, 2 Department of Pharmacology Research and Development, 3 Department of Molecular Biology, 4 Department of Cell Biology and Technology, 5 Department of Antibody Technology, and 6 Department of Pathology, Genentech, South San Francisco, California 94080


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell-cell interactions of the mucosal epithelia are important for the maintenance and establishment of epithelial barrier function. During events of inflammation, such cell-cell interactions are often disrupted, resulting in a leaky epithelial barrier, which in turn can lead to various inflammatory and infective dysfunctions. Human junctional adhesion molecule (huJAM), found on the mucosal epithelia and vascular endothelia of many major organ systems, is a membrane glycoprotein which resolves to a doublet band of ~40 and ~37 kDa under SDS-PAGE analysis, representing differentially glycosylated forms of the same protein. huJAM was localized to the lateral membrane of Caco-2 cells (a human colonic epithelial cell line) monolayers, in an area basolateral of the epithelial tight junctions (TJ). Through functional and biochemical assays, we show huJAM to be able to homotypically associate and to participate in TJ restitution after trypsin-EDTA disruption. Furthermore, we also observed a migration of huJAM expression toward areas of cell-cell contacts during events of cell adhesion and monolayer formation. These qualities makes huJAM a likely player in the regulation of cell-cell contacts and the subsequent formation of TJs.

epithelial permeability; junctions; immunoglobulin superfamily; adhesion molecule; cell contact


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ON POLARIZED CELLS of the epithelium, the tight junction (TJ) is a physical barrier with both a "fence" and a "gate" function. While the fence function of the TJ represents and maintains the boundary between the physically distinct apical and basolateral compartments of the polarized epithelium (17), the "gate" function describes the rate-limiting step in the trafficking of cells and particles through the paracellular pathway (20). A dysfunction in these TJ functions can result in pericellular leakage of fluid and particles as well as a loss of cellular polarization (17, 22, 27). Functional TJs in a polarized epithelium are comprised of three major membrane components: occludin (7) and the claudin family members, claudin-1 and -2 (6, 30). Claudin-1 and claudin-2 are thought to be responsible for the recruitment of occludin to the TJ strands (8), which in turn interacts with the apical F-actin ring through associations with ZO-1, ZO-2, and ZO-3 (11, 20). Key in the process of establishing and maintaining a functional TJ as well as organizing polarized epithelia is the adherence junction molecule E-cadherin (10, 32).

Recently, murine junctional adhesion molecule (mJAM), a protein possessing two putative Ig domains, a single transmembrane, and a short cytoplasmic tail, was localized to murine epithelial TJs (16), platelets, endothelial junctions, myosin heavy chain (MHC) class II-positive antigen presenting cells of the thymic medulla, and T-cell areas of the peripheral lymphoid organs (15). Functionally, mJAM has been shown to participate in cell-cell adhesion and monocyte migration (16) and has been implicated in cell trafficking and cell fate determination (15). Although human junctional adhesion molecule (huJAM) was recently described, not much is understood beyond its tumor necrosis factor-alpha (TNF-alpha ) and interferon-gamma (IFN-gamma ) downregulatable endothelial membrane expression (24). Here, we present data that describes huJAM as a protein that is significantly different from mJAM in localization and tissue distribution; we further characterize the involvement of huJAM in cell-cell contact formation and epithelial TJ regulation through a potential homotypic interaction.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Generation of huJAM-Fc. huJAM was initially identified in expressed sequence tag (EST) databases through homology to CD22 and was cloned from human fetal kidney using TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT as a probe. The identification of huJAM was conducted independent of Ozaki et al. (24).

huJAM-Fc was expressed in insect cells as previously described (1). huJAM-Fc was purified with a 5 ml HiTrap Protein A Sepharose column (Amersham Pharmacia Biotech, Piscataway, NJ) and eluted with 0.1 M glycine-HCl, pH 3.0, Fractions were collected and neutralized with 1 M Tris, pH 8.0 (final concentrate of 0.2 M Tris). Peak fractions concentrated using Centriprep 30 (Millipore Products, Bedford, MA) concentrators and dialyzed extensively against PBS at 4°C. Protein assays were performed with bicinchoninic acid reagent (BCA; Pierce Chemicals, Rockford, IL), and analyzed by SDS-PAGE with Coomassie staining. The average yield was 10 µg/ml.

Antibody generation. BALB/c females were immunized and boosted with 10 µg huJAM-Fc via footpad injections as previously described (5). Single clones were screened for reactivity to huJAM-Fc and not to human IgG, titrated out to single cell densities, and rescreened. A single clone termed 10A5 (IgG1 kappa ) was discovered and used for ascites fluid generation (2). Antibody was purified using Protein G (Amersham Pharmacia Biotech) and eluted with 0.1 M glycine, pH 3.0. Purified antibody was dialyzed into PBS; protein concentration was obtained using the Pierce BCA reagent.

Expression of huJAM in CHO cells. huJAM cDNA was amplified by PCR from a human colon cDNA library (Clontech, Palo Alto, CA) using the primers specific for the 5' and 3' ends of the coding sequence (5' sequence: TTAGGATCCCCCACCATGGGGACAAAGGCGCAAGTCGAGAGGAAA; 3' sequence: TTAAAGCTTTCACACCAGGAATGACGAGGTCTGTTTGAA). The amplified fragment was gel purified, digested (BamH I and Hind III), extracted in phenol-chloroform-isoamyl alcohol (GIBCO BRL, Life Technologies, Gaithersburg, MD), lyophilized, and ligated into pSD5 expression vector (pSD5.huJAM), transfected into Chinese hamster ovary cells (CHO), and selected as previously described (14). Colonies were lifted with 2.5 mM EDTA and screened for huJAM expression by flow cytometry using monoclonal antibody (MAb) 10A5 (5 µg/ml) with FITC-conjugated goat anti-mouse IgG1 Fc (Jackson Immunoresearch, Burlingame, CA). One clone, CuL8r, was selected for further analysis.

Clontech multiple human tissue mRNA expression array. A multiple human tissue mRNA expression array (Clontech) was used as described by the manufacturer. Hybridization was performed using 25 ng of pSD5.huJAM labeled with [32P]dATP (Strip-EZ; Ambion, Austin, TX) and purified with a MicroSpin G50 column (Amersham Pharmacia Biotech). The blot was exposed overnight using a BAS phosphoimaging plate (Fuji, Japan) and developed on a BAS-2000 phosphoimager (Fuji).

Staining. Confluent monolayers of Caco-2 cells or A549 cells were cultured as previously described (26, 28). Staining was done using a variation of previous descriptions (23). Monolayers were fixed/permeabilized with methanol for 20 min at -20°C. Then, 10A5 or Alexa 488-conjugated 10A5 (Alexa 488 Protein Labeling Kit; Molecular Probes, Eugene, OR) was used at 10 µg/ml; polyclonal antibody against occludin or ZO-1 (Zymed, South San Francisco, CA) was used at 1:200. FITC- or Cy5-conjugated goat anti-mouse or anti-rabbit IgG (Caltag, Burlingame, CA) was used at 1:200. Monolayers were mounted in Vectashield mounting medium (Vector, Burlingame, CA). For some conditions, Caco-2 monolayers were either washed three times in Hanks' balanced salt solution without calcium and magnesium [HBSS(-), GIBCO BRL, Life Technologies] and incubated in HBSS(-) for 30 min at 37°C (calcium starvation) or treated with 2 mM EDTA in HBSS(-) for 12 min at 37°C (EDTA disruption) before staining as stated. Slides were analyzed with a spectral confocal microscope (model TCS SP; Leica Microsystems, Heidelberg, Germany).

PCR primers (5'-GAGTCCTTCGGCGGCTGTT and 3'-CGGGTGCTTTTGGGATTCGTA) were designed to amplify a part of the 5'-untranslated region and most of the extracellular domain. Primers included T7 or T3 RNA polymerase initiation sites for in vitro transcription of sense or antisense riboprobes. All tissues were fixed in 4% formalin and embedded in paraffin. Sections 5-µm thick were deparaffinized, deproteinated in 4 µg/ml of proteinase K (30 min at 37°C), and further processed for in situ hybridization as previously described (13).

Immunohistochemical staining was performed on 5-µm thick frozen sections using a DAKO Autostainer. Endogenous peroxidase activity was blocked with Kirkegaard and Perry blocking solution (1:10, 4 min at 20°C). Normal goat serum (NGS) at 10% in TBS/0.05% Tween-20 (DAKO) was used for dilution and blocking. MAb 10A5 or mouse IgG was used at 0.13 µg/ml. Biotinylated goat anti-mouse IgG (Vector) was used at 1:200 and detected with Standard ABC Elite Kit (Vector). Slides were developed using metal-enhanced diaminobenzidine (Pierce Chemicals). In some conditions, 10A5 (0.13 µg/ml) was preabsorbed against purified huJAM-Fc (1 µg/ml).

Immunoprecipitation and purification of huJAM. 10A5 was conjugated at 2 mg/ml to CNBr-activated Sepharose 6MB (Amersham Pharmacia Biotech). Cell preparation, biotinylation, lysis, and protein purification were all carried out at 4°C. Caco-2 or 293 cells (108 cells/162 cm2) were washed with HBSS without phenol red, and sodium bicarbonate (HBSS+; GIBCO BRL, Life Technologies). Cells were biotinylated with sulfo-NHS-biotin (Pierce Chemicals) and lysed as previously described (25). CNBr-conjugated 10A5 beads were used at 1 mg/109 cells. Beads were washed with lysis buffer (HBSS+ with 2% Triton X-100, 2 mM phenylmethylsulfonyl fluoride, 0.4 TIU/ml aprotinin, 10 mM NaF, 10 mM NaOV3, and 10 mM iodoacetamide) followed by OG wash buffer [lysis buffer containing 1% n-octylglucoside (OG)] and eluted for 30 min with 0.1 M glycine-HCl + 1% OG, pH 3.0, at 4°C. Eluate was neutralized by the addition of Tris, pH 8.0, to a final concentration of 0.2 M. The eluates were concentrated on a 10-kDa cut-off Centricon or Centriprep concentrator (Millipore Products) and analyzed by SDS-PAGE and Western blot.

In some cases Caco-2 monolayers, cultured as previously described (26), were selectively biotinylated as described (18), and immunoprecipitation was performed using methods outlined above.

For deglycosylation studies, an enzyme deglycosylation kit (Bio-Rad Laboratories, Hercules, CA) was used, per manufacturer's instructions.

Western blotting. Samples were run out on gels (4-15% or 4-20% Bio-Rad Tris-HCl Ready Gels, Bio-Rad Laboratories) under reducing (20 mM beta -mercaptoethanol) or nonreducing (40 mM iodoacetamide) conditions and transferred onto nitrocellulose. The blots were blocked 1 h with Blotto [5% milk with TBS containing 0.5% Tween-20 (Bio-Rad Laboratories)]. Biotinylated samples were probed with 30 ng/ml horseradish peroxidase (HRP)-conjugated streptavidin (Amersham Pharmacia Biotech) in TTBS (TBS containing 0.5% Tween-20); samples without biotinylation were probed with either 10A5 or mouse IgG1 (10 µg/ml) in Blotto (1 h), washed with TTBS, and incubated for 30 min with 1 µg/ml HRP-conjugated goat anti-mouse IgG1 (Caltag). The blots were washed with TTBS and developed with the ECL Plus developing reagent (Amersham Pharmacia Biotech). Blots were exposed to Kodak BioMax ML Film and developed with the Kodak M35A X-OMAT Film Processor.

huJAM homotypic binding. Purified huJAM or CuL8r (huJAM expressing CHO cells) were plated onto Nunc Maxisorb 96-well plates [50 µl per well, 2 h at room temperature in binding buffer (TBS plus 2 mM CaCl2, 2 mM MgCl2, and 2 mM MnCl2) for purified huJAM; CuL8r was plated to a confluent monolayer in tissue culture conditions]. The plate was washed and blocked in blocking buffer (binding buffer containing 0.5% BSA for Fc fusion/protein binding, media for Fc fusion/cell binding), 30 min at room temperature. huJAM-Fc, human IgG1, or the control Fc fusion protein was applied at 100 ng/well (50 µl/well) for 1 h; where appropriate, MAb 10A5 or mouse IgG1 Fab fragments (generated using with ImmunoPure Fab Preparation kit, Pierce Chemicals) were used at 4 µg/well (200 µl/well). The plates were washed, incubated for 1 h with 50 µl/well of a 1:1,000 dilution of HRP-conjugated mouse anti-human IgG1 Fc (Caltag) in blocking buffer. Color change was observed using TMB Peroxidase Substrate (Kirkegaard and Perry Laboratories). Color development was stopped by the addition of 1 M phosphoric acid; plates were read at 450 nm on the ThermoMax Microplate Reader (Molecular Devices, Sunnyvale, CA). For flow cytometry-based experiments, CuL8r was lifted using trypsin/EDTA (GIBCO BRL, Life Technologies) and incubated in media (containing 0.03% NaN3) with 1 µg/ml huJAM-Fc.Alexa 488 (conjugated using Alexa 488 conjugation kit, Molecular Probes) for 30 min at 4°C. Cells were pelleted, washed three times, and analyzed on a FACScan (Becton-Dickinson, Franklin Lakes, NJ).

Epithelial monolayer restitution assay. Confluent monolayers of Caco-2 cells were grown on collagen-coated 1-cm2 polycarbonate Transwell filters as previously described (28). At full confluence, monolayers achieve a transepithelial resistance (TER) of >500 Omega  · cm2, as measured using a "chopstick" voltmeter (Millicell-ERS; Millipore). Monolayers were washed twice with PBS at 37°C followed by the addition of 200 µl PBS containing 10 mM EDTA and 100 µl 0.25% trypsin in HBSS(-) (GIBCO BRL) to the apical compartment. PBS containing 10 mM EDTA (1 ml) was introduced to the basolateral compartment. After 30 min at 37°C, TER values were consistently between 140-160 Omega  · cm2. Buffer was removed from both compartments and replaced with culture media (28) containing either 10 µg/ml huJAM-Fc, 10A5, human IgG1, or mouse IgG1 control. TER readings were obtained over the next 60 h using the "chopstick" voltmeter.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

huJAM expression and localization. To initially localize huJAM, a monoclonal antibody termed 10A5 (MAb 10A5) was generated against an huJAM/human IgG1 Fc fusion protein (huJAM-Fc). MAb 10A5 was found to react exclusively to huJAM-Fc and not to human IgG1 or a human CD4/human IgG1 Fc fusion protein (CD4-Fc).

Immunolocalization of huJAM on Caco-2 monolayers with 10A5 showed strong pericellular staining similar to patterns observed with occludin and ZO-1 (Fig. 1, a, b, and c, respectively). Although the cells were fixed and permeabilized, no appreciable intracellular staining was seen in these conditions. Colocalization studies in the xz-plane showed distinct labeling patterns for ZO-1 and huJAM (Fig. 1d) and extensive colocalization for occludin and huJAM (Fig. 1e). ZO-1 was present in a punctate pattern at the apical "neck" of Caco-2 cells, whereas occludin was present in the same apical punctate manner as well as along the lateral membrane of Caco-2 cells. huJAM staining was most intense in the apical lateral membrane, where it showed good overlap with occludin staining. This overlap seems to transition to a singular huJAM staining toward the basal portion of the lateral space. No significant overlap was seen between ZO-1 and huJAM in these studies; nor was there any observable apical or basal plasma membrane huJAM staining.


View larger version (154K):
[in this window]
[in a new window]
 
Fig. 1.   Immunolocalizations of human junctional adhesion molecule (huJAM) in epithelial cells were done on confluent Caco-2 monolayers. Monolayers were immunostained for huJAM (a), occludin (b), or ZO-1 (c). All three proteins stained in a pericellular manner. The xz images of the labeling conditions showed differences between ZO-1 (c, xz), punctate apical staining (asterisk indicates the basal surface), and huJAM (a, xz), lateral staining with decreasing staining intensity from apical to basal. Occludin (b, xz) and huJAM staining in the xz plane was more similar, although huJAM seem to extend further basal than occludin. Colocalization experiments in the xz plane were performed. In d, ZO-1 (arrowheads) resides in an area apical (AP) of huJAM staining (huJAM in green, ZO-1 in red), although the resolution of the image is insufficient to conclude whether ZO-1 staining was coincidental to huJAM staining. In e, occludin colocalized extensively with huJAM in the apical lateral membrane (huJAM in green, occludin in red, overlapped staining in orange); however, huJAM staining was found to be seemingly independent of occludin in the basolateral (BA) membrane (arrowheads). Scale bar = 10 µm.

Biochemical characterization of huJAM. MAb 10A5 was subsequently used for biochemical studies. Caco-2 cells were grown to confluence (TER >500 Omega  · cm2) and surface biotinylated on either the apical or the basolateral surface. It was previously demonstrated that an intact monolayer with functional TJs allows for selective biotinylation of either the apical or basolateral surfaces of polarized epithelial cells (19). The biotinylated monolayers were then lysed and immunoprecipitated with MAb 10A5-conjugated CNBr-activated beads. Each immunoprecipitation condition was then subjected to Western blotting with HRP-conjugated streptavidin (to observe polarized expression) or MAb 10A5 (as an immunoprecipitation control).

Basolaterally biotinylated lysates immunoprecipitated with MAb 10A5 (Fig. 2A, lane 4) showed, under nonreducing conditions, a strong streptavidin reactive band of ~40 kDa, whereas apically biotinylated lysates (Fig. 2A, lane 1) exhibited no such banding. The basolateral-specific epithelial marker CD29 (integrin beta 1) was used as a selective biotinylation control (Fig. 2A, lane 6) and was only observed in the basolaterally biotinylated conditions. Immunoblotting of a replicate gel with MAb 10A5 showed equally intense bands corresponding to huJAM in both apically and basolaterally biotinylated membrane preparations (Fig. 2A, lanes 7 and 10), showing that selective biotinylation had no effect on the ability of MAb 10A5 to immunoprecipitate huJAM from Caco-2 monolayers and reiterating that the appearance of a 10A5-reactive, streptavidin-positive band on the basolaterally biotinylated conditions was due specifically to selective biotinylation. Results from these selective biotinylation studies suggest that huJAM is localized in a basolateral fashion and confirms the confocal studies outlined above.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2.   Caco-2 monolayers were grown to confluence, biotinylated on the apical (AP) or basolateral (BA) surface, lysed, and immunoprecipitated against conditions (A). Streptavidin was used to detect the biotinylated proteins in A, lanes 1-6. For MAb 10A5 purified conditions (A, lanes 1 and 4), a ~40-kDa streptavidin-reactive band was observed only in the basolaterally biotinylated condition (A, lane 4). The control mouse IgG1 conditions were negative (A, lanes 2 and 5). Anti-CD29 (integrin beta 1) was used as an internal control (A, lanes 3 and 6). A replicate gel was blotted with 10A5 (A, lanes 7-12). An ~40/37-kDa, 10A5-reactive doublet was observed at similar intensities in both the apical and basolaterally biotinylated conditions (A, lanes 7 and 10, respectively). This 10A5-reactive band was only observed in 10A5 purified conditions but not in anti-CD29 (A, lanes 9 and 12) nor mouse IgG1 (A, lanes 8 and 11) purified conditions. Purified huJAM was subjected to digestion with PNGaseF (B, lane 1) or NANase and O-glycanase treatment (B, lane 2). The occurrence of a new 35-kDa band under PNGaseF treatment suggest huJAM to be differentially glycosylated by N-linked carbohydrates.

While huJAM appears as a single streptavidin-positive band of ~40 kDa, a doublet of ~40 and ~37 kDa (Fig. 2A, lanes 7 and 10) is observed under the more sensitive method of Western blotting. Initial biochemical analysis of the doublet revealed a difference between the two bands in the amount of total carbohydrate. Further biochemical analysis of the protein doublet revealed that the ~3-kDa discrepancy in molecular weight was the result of differential N-linked glycosylation, as treatment of the purified protein with PNGaseF resulted in a reduction of the doublet to a single band of ~35 kDa (Fig. 2B, lane 1). Treatment with O-glycanase and NANase II resulted in no further shift in apparent molecular weight (Fig. 2B, lane 2). Experiments were conducted to examine differential phosphorylation of huJAM. No evidence of phosphorylation on tyrosine, threonine, or serine (polyclonal antibodies were obtained from Zymed) was discovered on huJAM from confluent, subconfluent, or wounded Caco-2 monolayers (data not shown).

Tissue distribution of huJAM. To further localize huJAM expression in tissue, a multiple human tissue Northern blot was probed with the full-length cDNA of huJAM. Expression was greatest in placenta and lung and was demonstrated in most major organ systems. The cerebellum and the spinal cord were the only two nonreactive samples (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Multiple human tissue mRNA array probed with full-length cDNA of huJAM

Tissue expression of huJAM was also investigated through in situ hybridization techniques. Moderate diffuse expression of huJAM mRNA was detected in the mucosal epithelial cells of the gall bladder, gastric mucosa, colon, tonsils, hepatocytes, thymic epithelial cells (data not shown), and pulmonary bronchioles (Fig. 3, A-D). Compared with normal bronchioles (Fig. 3, A and B), huJAM mRNA was significantly increased in inflamed (suppurative bronchiolitis) pulmonary bronchiolar mucosal epithelium (Fig. 3, C and D). Further localization was conducted on sections of human colon using immunohistochemical techniques. Staining with MAb 10A5 identified diffuse lateral membrane huJAM expression on the colonic mucosal epithelium (Fig. 3E), confirming both the Caco-2 staining and in situ hybridization results. Strong huJAM expression was also observed on venous and arteriolar vascular endothelium of the colon (Fig. 3F).


View larger version (91K):
[in this window]
[in a new window]
 
Fig. 3.   Expression of huJAM was determined by in situ hybridization. Dark-field images of normal pulmonary bronchiole (B) shows huJAM mRNA to be present in areas that represent the mucosal epithelia by hematoxylin and eosin staining (A). In inflamed (superlative bronchiolitis) pulmonary bronchiole sections (C and D), there is observed a significant increase in huJAM mRNA. Further localization of huJAM was done through immunohistochemical staining of human colon sections. huJAM was observed in the mucosal epithelium along the lateral membrane (E). Significant huJAM staining was also observed in arteries and veins (F).

huJAM can homotypically associate. For the purpose of further biochemical studies, native huJAM was isolated from the 293 (human embryonic kidney epithelial cell line) cells using MAb 10A5 coupled affinity matrix. The 293 cells were chosen for the large-scale purification, because of their ease of maintenance and rapidity of growth. Bulk purified protein migrated as a 45/40-kDa doublet under reducing conditions (data not shown). Under nonreducing conditions, a doublet of 40/37 kDa was observed (Fig. 4, lane 1). Western blotting the bulk-purified protein with MAb 10A5 confirmed the doublet to be huJAM (Fig. 4, lane 3). Mouse IgG-coupled control matrix was negative in all cases (Fig. 4, lanes 2 and 4). In handling the bulk-purified protein, we noted the appearance of a strong ~60-kDa protein upon concentration of the protein or prolonged refrigeration of the bulk-purified preparation (Fig. 4, lane 5). Similarly treated, mouse IgG matrix purified, control preparations had an absence of this 60-kDa band (Fig. 4, lane 6). NH2-terminal sequencing of the 60-kDa band provided the sequence SVTVHSSEP, which was a 100% match with huJAM, suggesting the 60-kDa band to be a representation of an SDS-insensitive homodimer of huJAM. Also matching in amino acid sequence was human platelet F11 antigen (21). Published sequences of the human platelet F11 antigen fragments were examined and found to be 100% homologous to fragments of huJAM. To confirm possible huJAM expression on platelets, human platelet lysates were blotted with MAb 10A5; an antibody-specific doublet at ~40/37 kDa was observed on whole platelet lysates (data not shown).


View larger version (82K):
[in this window]
[in a new window]
 
Fig. 4.   huJAM was purified to homogeneity from 293 cells (human embryonic kidney epithelia) and analyzed by Coomassie staining. A ~40/37-kDa doublet unique to the 10A5 purification condition (lane 1) was observed. Mouse IgG1 purification control (lane 2) showed no appreciable staining. The ~40/37-kDa Coomassie-stained doublet was reactive to 10A5 in a Western blot (lane 3). Mouse IgG1 control was negative (lane 4). Concentrated protein was ran under nonreducing conditions; a new ~60-kDa band was observed in the concentrated huJAM sample (lane 5). This appearance of the ~60-kDa band correlated with a disappearance of the huJAM doublet. By NH2-terminal sequencing, the ~60-kDa band was discovered to be huJAM. Concentrated mouse IgG1 control (lane 6) was negative.

To further investigate the "homodimerization" of huJAM, and to investigate whether this dimerization only occurs under the highly physiologically irrelevant conditions of SDS-PAGE, we established two solid-phase ELISA using the bulk-purified native huJAM, the fusion protein huJAM-Fc, as well as the huJAM transfected CHO line, CuL8r. Bulk-purified huJAM was coated on 96-well plates along with a mouse IgG1- purified protein control for a protein-protein (huJAM:huJAM-Fc) ELISA. huJAM-Fc was found to bind preferentially to the huJAM coated wells in a dose-dependent manner. This interaction was not seen when a control Fc fusion protein was used (Fig. 5A). CuL8r was grown to confluence on 96-well plates for a cell-protein (CuL8r monolayer:huJAM-Fc) ELISA. huJAM-Fc was observed to bind specifically to CuL8r monolayers in an MAb 10A5 Fab-sensitive manner (Fig. 5B). Furthermore, CuL8r cells, in suspension, were analyzed for huJAM binding by flow cytometry. Clearly, there was specific huJAM-Fc binding by suspension CuL8r cells (Fig. 5C).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   huJAM was purified from 293 cells using an MAb 10A5-conjugated affinity matrix. Coating the concentrated huJAM or mouse IgG1 purification control fractions on a microtiter plate, we show huJAM-Fc to bind specifically to the concentrated huJAM fraction-coated wells (A) in a dose-dependent manner (average of 4 wells per dilution, representative of 4 independent experiments). huJAM-Fc was also examined for binding to the huJAM transfected CHO cell line, CuL8r (B). Compared with human IgG1 and an irrelevant human IgG1 Fc fusion protein, huJAM-Fc was seen to bind specifically in a fashion sensitive to inhibition by Fab fragments generated from MAb 10A5 but not Fab fragments generated from mouse IgG1 (average of 5 wells per conditions, representative of 3 independent experiments). We also show huJAM-Fc/CuL8r interaction in solution. By incubating Alexa 488-conjugated huJAM-Fc to a cell suspension of CuL8r, we show a significant shift in FITC intensity FL1-H over that of CuL8r incubated with Alexa 488-conjugated control Fc fusion protein (C). For these studies 10,000 cells were collected; these data are representative of 3 independent experiments.

huJAM is involved in TJ restitution after monolayer disruption. Confluent Caco-2 monolayers with TER of >500 Omega  · cm2 were treated with EDTA and trypsin to disrupt intercellular TJ interactions, resulting in a decline of measured TER values to 140-160 Omega  · cm2. Disrupted monolayers were then allowed to recover in media or in the presence of 10 µg/ml huJAM-Fc or human IgG1.

The presence of huJAM-Fc significantly slowed the rate in the recovery of TER values in this restitutive system (Fig. 6A). At 13 h into recovery, a 50% recovery in the TER was observed in human IgG1-treated monolayers. A 50% recovery was not seen in the huJAM-Fc-treated monolayers until after ~30 h into recovery. TER values were not affected by the addition of either human IgG1 or huJAM-Fc to intact, confluent Caco-2 monolayers. A similar result was demonstrated using the anti-huJAM antibody, MAb 10A5, in the same experimental system. MAb 10A5 significantly slowed the rate of recovery in TER values of Caco-2 monolayers recovering from trypsin/EDTA-mediated TJ disruption (Fig. 6B). At 7 h into recovery, MAb 10A5-treated monolayers reached 39.6% recovery in TER, whereas the mouse IgG1 control conditions recovered to 63.7% of their initial TER. The huJAM-Fc-treated conditions exhibited a reduction in TER recovery not unlike MAb 10A5-treated conditions (39.6% recovery in TER for MAb 10A5-treated vs. 39.4% recover in TER for huJAM-Fc-treated conditions). The use of MAb 10A5 and huJAM-Fc in conjunction exhibited no significant synergism in TER retardation (34.3% recovery for MAb 10A5 plus huJAM-Fc vs. 39.6% recovery for MAb 10A5 alone).


View larger version (90K):
[in this window]
[in a new window]
 
Fig. 6.   Caco-2 cells were grown to confluence on a Transwell filter. Monolayers were disrupted with trypsin/EDTA or kept in HBSS(-) as controls. The monolayers were allowed to recover in the presence of 10 µg/ml of huJAM-Fc or human IgG1 (A). Disrupted monolayers recovering under the condition of huJAM-Fc were retarded, in transepithelial resistance (TER) measurement, (47% recovery at 33 h) compared with human IgG1 conditions (70% recovery at 33 h). Monolayers that had no disruption showed no resistance drop under conditions of huJAM or human IgG1 (average of 4 Transwells per condition; representative of 3 independent experiments). A similar experiment was conducted using MAb 10A5 at 10 µg/ml (B). MAb 10A5 showed a similar effect on TER (at 7 h, 39.7% recovery for MAb 10A5, 39.4% recovery for huJAM-Fc, 63.7% recovery for mouse IgG1); however, no synergy was seen when MAb 10A5 was used in conjunction with huJAM-Fc (39.7% recovery for MAb 10A5, 34.2% recovery for MAb 10A5 + huJAM-Fc) (average of 9 Transwells per condition; representative of 3 independent experiments). huJAM distribution on Caco-2 monolayers was observed after EDTA disruption (EDTA treated) (C). After EDTA treatment, a complete loss of pericellular huJAM staining (green) was observed along with an accumulation of huJAM staining intracellularly (arrowhead). Occludin staining (red), is markedly reduced. In xz images, a clear loss of lateral occludin and huJAM staining coincided with an emergence of a general membranous occludin and huJAM staining (arrowhead); furthermore, distinct intracellular huJAM staining is observed throughout.

Occludin (red) and huJAM (green) distribution was also investigated after TJ disruption by EDTA treatment. Marked loss of pericellular occludin staining was observed in the en face (Fig. 6C, EDTA treated). In the xz images, the occludin staining has all but disappeared from the lateral membrane and has become disorganized into a general membranous fashion (Fig. 6C, EDTA treated, xz sections, arrowheads). huJAM staining was also observed to undergo a similar metamorphosis. The previously sharp, pericellular chicken-wired staining observed in the en face has transformed into a diffused, intracellular pattern, suggestive of protein internalization (Fig. 6C, EDTA treated, arrowheads). In the xz, huJAM also shifted from lateral to general membranous (Fig. 6C, EDTA treated, xz sections, arrowheads), with distinct pockets of intracellular staining observed throughout. It is of interest to note that, in all cases observed, lateral membrane loss of huJAM precedes that of occludin (data not shown). The reverse is true in recovering monolayers; occludin is established laterally in advance of huJAM (data not shown).

huJAM is present along cell-cell contacts. Results obtained from the restitution studies, combined with the insights of huJAM-huJAM homotypic interactions, lead us to postulate huJAM as an adhesion molecule important in cell-cell contact formation. To further examine this function of huJAM, A549 cells were used. A549 is a human airway epithelial line which, compared with Caco-2, has the advantage of an accelerated growth rate, making it an ideal cell line for monolayer formation and cell-cell contact studies. A549 cells were plated on collagen-coated Costar Transwell filters at subconfluent densities and stained with MAb 10A5 as the cells were coming to confluence. After the initial cell adhesion to the collagen matrix, huJAM staining on A549 cells were seen as a general, diffused membranous staining (Fig. 7A). As the cells were given time to establish cell-cell contacts and allowed to spread, a shift in staining pattern was observed. At hour 4, two types of huJAM staining were seen. Cells that are spreading and making contact with a neighboring cell exhibited the distinct cell-cell junction huJAM staining observed in confluent Caco-2 monolayers (Fig. 7B). Cells that are not forming cell-cell contacts, on the other hand, retained the diffused membranous staining seen after the initial cell adhesion (Fig. 7B). At hour 8, the distinct cell-cell junction huJAM staining was predominant, as most of the cells observed were settled into clusters or patches of monolayers (Fig. 7C). On a higher power view of these cell clusters, huJAM staining was seen as fine membrane interdigitations in areas of cell-cell contacts; huJAM staining was not observed in the borders of A549 cell clusters, where cells have no cell-cell contact (Fig. 7D). In the xz-plane, this distinct huJAM staining was observed along the lateral membrane of the cells, concentrating in the apical-most lateral compartment (Fig. 7E). On confluent A549 monolayers, huJAM staining was pericellular, resembling what was seen on Caco-2 monolayers (data not shown).


View larger version (139K):
[in this window]
[in a new window]
 
Fig. 7.   A549 cells were plated at subconfluent densities on collagen-coated Costar Transwell filters. Filters were removed and stained for huJAM (FITC, green) at 2 h, 4 h, 8 h, and 24 h after plating. For cells that were allowed to attach for 2 h (A), huJAM staining was observed in a general diffused membranous manner. This diffused membranous staining was still present at 4 h (B, solid arrows); however, concentrated huJAM staining was observed at cell-cell contacts (B, open arrows). By hour 8 after plating, the majority of huJAM staining has migrated to a pericellular, cell-cell contact fashion (C). Under higher (×100) magnification (D), one notices the pericellular huJAM staining to be present in an interdigitated fashion (open arrows) and is starkly absent in the borders of the cell clusters where no cell-cell contacts are present (solid arrows). Under the xz plane (E), the huJAM staining was observed to be along the lateral membrane and concentrated at the apical lateral compartment; very little apical or basal membrane staining is observed. Scale bar = 10 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Here we have presented data concerning epithelial huJAM and described its function, through a probable homotypic interaction, as a mediator of the rate of TJ restitution and cell-cell adhesion. We have also localized the tissue distribution of huJAM through the use of in situ hybridization and immunohistochemical staining. This finding furthers our understanding of JAM, which was first described in the human platelet.

Human platelet F11 antigen is a integral membrane protein shown to be capable of activating, aggregating, and degranulating platelets when cross-linked with the Fc gamma -RII receptor (21). This platelet antigen was discovered to share a 100% amino acid sequence homology to that of huJAM.

Recently, a flurry of publications has provided great insight into the function of JAM in both the human and murine systems. huJAM was recently described in the endothelial cell system as a protein that is regulated through a TNF-alpha - and IFN-gamma -sensitive pathway (24). In the mouse, murine JAM (mJAM) was recently shown to participate in the formation of cell-cell contact as well as monocyte migration (16). Further findings also implicated mJAM in cell trafficking and fate determination of MHC class II-positive antigen-presenting cells of the thymic medulla and the germinal centers of peripheral lymphoid organs (15).

Using MAb 10A5, we have biochemically localized huJAM to the basolateral compartment of polarized Caco-2 monolayers. Biochemically, we also discovered huJAM to be a protein that resolves to a doublet of 40 and 37 kDa. This difference in molecular weight was resulted from differential N-glycosylation of a core huJAM protein of ~35 kDa. Taking into account that the average molecular mass of a single N-linked sugar is 3-4 kDa (29), we reached the conclusion that huJAM is expressed heterogeneously on epithelial cell surfaces, one population having two N-linked sugars (40 kDa), and the other having only one N-linked sugar (37 kDa). Further localization of huJAM was obtained through confocal microscopy, placing huJAM in the lateral membrane, in an area that resides basolateral of the epithelial TJ. There was no noticeable intracellular staining of huJAM on the confluent Caco-2 monolayers. The apical plasma membrane of Caco-2 monolayers was also devoid of noticeable huJAM staining, although some basal huJAM staining resembling that of basal actin stress fibers was observed (data not shown). These observations would suggest that huJAM is important as an adhesion molecule in areas of cell-cell, and perhaps cell-matrix, contact.

Through immunohistochemistry and in situ hybridization, we have localized huJAM to the vascular endothelium and the mucosal epithelium of numerous organs and have noted an elevation of huJAM mRNA in inflamed pulmonary bronchioles. Such findings concerning huJAM mRNA upregulation in inflamed tissue correlate well with the previous findings concerning mJAM, where the antibody against mJAM (BV11) was discovered to inhibit murine monocyte migration in an "air-pouch" assay (16).

We were also able to purify huJAM to homogeneity using an MAb 10A5 affinity matrix, allowing us to demonstrate an huJAM-huJAM homotypic interaction that seems to be SDS insensitive. This biochemically established homotypic interaction was later reaffirmed through solid-phase assays, demonstrating both protein-protein (huJAM:huJAM-Fc) and cell-protein [CuL8r (huJAM transfected CHO cell line):huJAM-Fc] interactions. Further support was lent to the observed homotypic interactions by flow cytometry analysis of the interaction between soluble huJAM-Fc and CuL8r, in suspension. Supporting this idea of huJAM homotypic interaction, huJAM staining on A549 cells during monolayers formation showed a shift from a diffused membranous staining to a pericellular-staining pattern restricted to areas of cell-cell contacts. Such a shift in protein localization suggests huJAM to be either a mediator of cell-cell contact or a molecular cue directing the establishment and the maintenance of the cell-cell contacts. We were able to further explore this hypothesis through the characterization of huJAM distribution during TJ disruption. When Caco-2 monolayers were EDTA treated, the huJAM staining becomes clearly intracellular and disorganized, suggestive of huJAM being involved in the scaffolding and trafficking of important adhesion molecules at the lateral membrane during events of cell-cell contact formation or disruption. The use of the huJAM-Fc molecule as well as MAb 10A5 also provided further clues to huJAM function. By first disrupting an established TJ using trypsin-EDTA, we were able to retard TJ restitution through the addition of huJAM-Fc or MAb 10A5. The ability of huJAM-Fc to disrupt the reformation of a disrupted TJ suggests that huJAM-Fc is interacting with either native huJAM or a thus far unidentified epithelial counter ligand. This interaction is certainly an important step in the formation of a functional TJ and may serve as a molecular cue to either accelerate or, as the case may be, arrest TJ restitution in the event of TJ disruption. The ability of MAb 10A5 to assert the same effect on TJ restitution as huJAM-Fc suggests that MAb 10A5 is able to bind to a domain of huJAM important to its function. Further insight is given to the role of huJAM in epithelial biology by the fact that neither the Fc fusion protein or MAb 10A5 was found to perturb the TJ integrity of intact epithelial monolayers. This lack of function in the disruption of intact TJ would indicate two possible routes of action. First, for huJAM-Fc or MAb 10A5 to act, access must be granted to the lateral surfaces of epithelial cells via the pericellular transport pathway or to the native huJAM itself, which may be otherwise engaged in a static interaction with its native epithelial counterpart. Second, the function of native huJAM resides in the recovery or re-formation of epithelial TJ or cell contacts; this specific function would not be required in intact monolayers until the epithelial cells first receive a disruptive signal such as a loss of TJ integrity or cell-cell adhesion. This participation in the process of TJ restitution is reminiscent of the roles E-cadherin and occludin play in the assembly as well as the maintenance of the TJ (3, 4, 9, 12, 31). Although we have noted similar staining patters between huJAM and E-cadherin (data not shown), we have thus far been unable to establish a functional hierarchy in the involvement of E-cadherin, huJAM, and the other TJ proteins, including occludin, during the formation and polarization of the lateral membrane. However, because the "intracellularization" of huJAM precedes that of occludin, with the reverse being true during events of TJ restitution (occludin being transferred from an intracellular locale to a membrane locale in advance of huJAM), we believe it would be logical to place huJAM function somewhere downstream of E-cadherin and upstream of occludin. In that E-cadherin is responsible for making the initial adhesive cell-cell contacts, huJAM is responsible for the organization of the various other adhesive events, and occludin is responsible, in part, for the final sealing of the TJ.

Through these functional and localization findings, we conclude that huJAM is located in a key position to be an effector of epithelial barrier integrity and may indeed be a mediator of inflammatory cell infiltration as well as a participant in recovery from resulting epithelial barrier damage. These qualities make huJAM an attractive potential target for therapies intended for inflammatory diseases.


    ACKNOWLEDGEMENTS

We thank Gretchen D. Frantz, Barbara D. Wright, and Ilona Holcomb for expert help on in situ hybridization and immunohistochemistry.


    FOOTNOTES

Address for reprint requests and other correspondence: T. W. Liang, Genentech, MS34, 1 DNA Way, South San Francisco, CA 94080 (E-mail: vonbek{at}gene.com).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 9 May 2000; accepted in final form 5 July 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Ashkenazi, A, and Chamow SM. Immunoadhesins as research tools and therapeutic agents. Curr Opin Immunol 9: 195-200, 1997[Web of Science][Medline].

2.   Azrin, MA, Ling FS, Chen Q, Pawashe A, Migliaccio F, Homer R, Todd M, and Ezekowitz MD. Preparation, characterization, and evaluation of a monoclonal antibody against the rabbit platelet glycoprotein IIb/IIIa in an experimental angioplasty model. Circ Res 75: 268-277, 1994[Abstract/Free Full Text].

3.   Balda, MS, and Matter K. Tight junctions. J Cell Sci 111: 541-547, 1998[Abstract].

4.   Behrens, J, Birchmeier W, Goodman SL, and Imhof BA. Dissociation of Madin-Darby canine kidney epithelial cells by the monoclonal antibody anti-arc-1: mechanistic aspects and identification of the antigen as a component related to uvomorulin. J Cell Biol 101: 1307-1315, 1985[Abstract/Free Full Text].

5.   Deng, B, Banu N, Malloy B, Hass P, Wang JF, Cavacini L, Eaton D, and Avraham H. An agonist murine monoclonal antibody to the human c-Mpl receptor stimulates megakaryocytopoiesis. Blood 92: 1981-1988, 1998[Abstract/Free Full Text].

6.   Furuse, M, Fujita K, Hiiragi T, Fujimoto K, and Tsukita S. Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin. J Cell Biol 141: 1539-1550, 1998[Abstract/Free Full Text].

7.   Furuse, M, Hirase T, Itoh M, Nagafuchi A, Yonemura S, and Tsukita S. Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol 123: 1777-1788, 1993[Abstract/Free Full Text].

8.   Furuse, M, Sasaki H, Fujimoto K, and Tsukita S. A single gene product, claudin-1 or -2, reconstitutes tight junction strands and recruits occludin in fibroblasts. J Cell Biol 143: 391-401, 1998[Abstract/Free Full Text].

9.   Gumbiner, B, and Simons K. A functional assay for proteins involved in establishing an epithelial occluding barrier: identification of a uvomorulin-like polypeptide. J Cell Biol 102: 457-468, 1986[Abstract/Free Full Text].

10.   Gumbiner, B, Stevenson B, and Grimaldi A. The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. J Cell Biol 107: 1575-1587, 1988[Abstract/Free Full Text].

11.   Haskins, J, Gu L, Wittchen ES, Hibbard J, and Stevenson BR. ZO-3, a novel member of the MAGUK protein family found at the tight junction, interacts with ZO-1 and occludin. J Cell Biol 141: 199-208, 1998[Abstract/Free Full Text].

12.   Lacaz-Vieira, F, Jaeger MM, Farshori P, and Kachar B. Small synthetic peptides homologous to segments of the first external loop of occludin impair tight junction resealing. J Membr Biol 168: 289-297, 1999[Web of Science][Medline].

13.   Lu, LH, and Gillett NA. An optimized protocol for in situ hybridization using PCR-generated 33P-labeled riboprobes. Cell Vision 1: 169-176, 1994.

14.   Lucas, BK, Giere LM, DeMarco RA, Shen A, Chisholm V, and Crowley CW. High-level production of recombinant proteins in CHO cells using a dicistronic DHFR intron expression vector. Nucleic Acids Res 24: 1774-1779, 1996[Abstract/Free Full Text].

15.   Malergue, F, Galland F, Martin F, Mansuelle P, Aurrand-Lions M, and Naquet P. A novel immunoglobulin superfamily junctional molecule expressed by antigen presenting cells, endothelial cells and platelets. Mol Immunol 35: 1111-1119, 1998[Web of Science][Medline].

16.   Martin-Padura, I, Lostaglio S, Schneemann M, Williams L, Romano M, Fruscella P, Panzeri C, Stoppacciaro A, Ruco L, Villa A, Simmons D, and Dejana E. Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J Cell Biol 142: 117-127, 1998[Abstract/Free Full Text].

17.   Matter, K, and Balda MS. Occludin and the functions of tight junctions. Int Rev Cytol 186: 117-146, 1999[Web of Science][Medline].

18.   McCormick, BA, Nusrat A, Parkos CA, D'Andrea L, Hofman PM, Carnes D, Liang TW, and Madara JL. Unmasking of intestinal epithelial lateral membrane beta1 integrin consequent to transepithelial neutrophil migration in vitro facilitates inv-mediated invasion by Yersinia pseudotuberculosis. Infect Immun 65: 1414-1421, 1997[Abstract].

19.   McCormick, BA, Parkos CA, Colgan SP, Carnes DK, and Madara JL. Apical secretion of a pathogen-elicited epithelial chemoattractant activity in response to surface colonization of intestinal epithelia by Salmonella typhimurium. J Immunol 160: 455-466, 1998[Abstract/Free Full Text].

20.   Mitic, LL, and Anderson JM. Molecular architecture of tight junctions. Annu Rev Physiol 60: 121-142, 1998[Web of Science][Medline].

21.   Naik, UP, Ehrlich YH, and Kornecki E. Mechanisms of platelet activation by a stimulatory antibody: cross-linking of a novel platelet receptor for monoclonal antibody F11 with the Fc gamma RII receptor. Biochem J 310: 155-162, 1995.

22.   Nash, S, Stafford J, and Madara JL. Effects of polymorphonuclear leukocyte transmigration on the barrier function of cultured intestinal epithelial monolayers. J Clin Invest 80: 1104-1113, 1987.

23.   Nusrat, A, Parkos CA, Liang TW, Carnes DK, and Madara JL. Neutrophil migration across model intestinal epithelia: monolayer disruption and subsequent events in epithelial repair. Gastroenterology 113: 1489-1500, 1997[Web of Science][Medline].

24.   Ozaki, H, Ishii K, Horiuchi H, Arai H, Kawamoto T, Okawa K, Iwamatsu A, and Kita T. Cutting edge: combined treatment of TNF-alpha and IFN-gamma causes redistribution of junctional adhesion molecule in human endothelial cells. J Immunol 163: 553-557, 1999[Abstract/Free Full Text].

25.   Parkos, CA, Colgan SP, Diamond MS, Nusrat A, Liang TW, Springer TA, and Madara JL. Expression and polarization of intercellular adhesion molecule-1 on human intestinal epithelia: consequences for CD11b/CD18-mediated interactions with neutrophils. Mol Med 2: 489-505, 1996[Web of Science][Medline].

26.   Parkos, CA, Delp C, Arnaout MA, and Madara JL. Neutrophil migration across a cultured intestinal epithelium. Dependence on a CD11b/CD18-mediated event and enhanced efficiency in physiological direction. J Clin Invest 88: 1605-1612, 1991.

27.   Parsons, PE, Sugahara K, Cott GR, Mason RJ, and Henson PM. The effect of neutrophil migration and prolonged neutrophil contact on epithelial permeability. Am J Pathol 129: 302-312, 1987[Abstract].

28.   Rubas, W, Villagran J, Cromwell M, McLeod A, Wassenberg J, and Mrsny R. Correlation of solute flux across Caco-2 monolayers and colonic tissue in vitro. STP Pharma Sci 5: 93-97, 1995.

29.   Scott, JL, Dunn SM, Jin B, Hillam AJ, Walton S, Berndt MC, Murray AW, Krissansen GW, and Burns GF. Characterization of a novel membrane glycoprotein involved in platelet activation. J Biol Chem 264: 13475-13482, 1989[Abstract/Free Full Text].

30.   Tsukita, S, and Furuse M. Occludin and claudins in tight-junction strands: leading or supporting players? Trends Cell Biol 9: 268-273, 1999[Web of Science][Medline].

31.   Wong, V, and Gumbiner BM. A synthetic peptide corresponding to the extracellular domain of occludin perturbs the tight junction permeability barrier. J Cell Biol 136: 399-409, 1997[Abstract/Free Full Text].

32.   Yap, AS, Stevenson BR, Keast JR, and Manley SW. Cadherin-mediated adhesion and apical membrane assembly define distinct steps during thyroid epithelial polarization and lumen formation. Endocrinology 136: 4672-4680, 1995[Abstract].


Am J Physiol Cell Physiol 279(6):C1733-C1743
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
E. A. Severson, L. Jiang, A. I. Ivanov, K. J. Mandell, A. Nusrat, and C. A. Parkos
Cis-Dimerization Mediates Function of Junctional Adhesion Molecule A
Mol. Biol. Cell, May 1, 2008; 19(5): 1862 - 1872.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. J. Mrsny, G. T. Brown, K. Gerner-Smidt, A. G. Buret, J. B. Meddings, C. Quan, M. Koval, and A. Nusrat
A Key Claudin Extracellular Loop Domain is Critical for Epithelial Barrier Integrity
Am. J. Pathol., April 1, 2008; 172(4): 905 - 915.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. T. Braiterman, S. Heffernan, L. Nyasae, D. Johns, A. P. See, R. Yutzy, A. McNickle, M. Herman, A. Sharma, U. P. Naik, et al.
JAM-A is both essential and inhibitory to development of hepatic polarity in WIF-B cells
Am J Physiol Gastrointest Liver Physiol, February 1, 2008; 294(2): G576 - G588.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
K. J. Mandell, L. Berglin, E. A. Severson, H. F. Edelhauser, and C. A. Parkos
Expression of JAM-A in the Human Corneal Endothelium and Retinal Pigment Epithelium: Localization and Evidence for Role in Barrier Function
Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 3928 - 3936.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. M. Shasby
Cell-cell adhesion in lung endothelium
Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L593 - L607.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
D. Mehta and A. B. Malik
Signaling Mechanisms Regulating Endothelial Permeability
Physiol Rev, January 1, 2006; 86(1): 279 - 367.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
O. M. Martinez-Estrada, L. Manzi, P. Tonetti, E. Dejana, and G. Bazzoni
Opposite effects of tumor necrosis factor and soluble fibronectin on junctional adhesion molecule-A in endothelial cells
Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1081 - L1088.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. Zen, B. A. Babbin, Y. Liu, J. B. Whelan, A. Nusrat, and C. A. Parkos
JAM-C Is a Component of Desmosomes and a Ligand for CD11b/CD18-mediated Neutrophil Transepithelial Migration
Mol. Biol. Cell, August 1, 2004; 15(8): 3926 - 3937.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. Bazzoni and E. Dejana
Endothelial Cell-to-Cell Junctions: Molecular Organization and Role in Vascular Homeostasis
Physiol Rev, July 1, 2004; 84(3): 869 - 901.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. Ebnet, A. Suzuki, S. Ohno, and D. Vestweber
Junctional adhesion molecules (JAMs): more molecules with dual functions?
J. Cell Sci., January 1, 2004; 117(1): 19 - 29.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. W. Liang, H. H. Chiu, A. Gurney, A. Sidle, D. B. Tumas, P. Schow, J. Foster, T. Klassen, K. Dennis, R. A. DeMarco, et al.
Vascular Endothelial-Junctional Adhesion Molecule (VE-JAM)/JAM 2 Interacts with T, NK, and Dendritic Cells Through JAM 3
J. Immunol., February 15, 2002; 168(4): 1618 - 1626.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Aurrand-Lions, C. Johnson-Leger, C. Wong, L. Du Pasquier, and B. A. Imhof
Heterogeneity of endothelial junctions is reflected by differential expression and specific subcellular localization of the three JAM family members
Blood, December 15, 2001; 98(13): 3699 - 3707.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. K. Shaw, B. N. Perkins, Y.-C. Lim, Y. Liu, A. Nusrat, F. J. Schnell, C. A. Parkos, and F. W. Luscinskas
Reduced Expression of Junctional Adhesion Molecule and Platelet/Endothelial Cell Adhesion Molecule-1 (CD31) at Human Vascular Endothelial Junctions by Cytokines Tumor Necrosis Factor-{alpha} Plus Interferon-{gamma} Does Not Reduce Leukocyte Transmigration Under Flow
Am. J. Pathol., December 1, 2001; 159(6): 2281 - 2291.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. J. Cohen, J. T. C. Shieh, R. J. Pickles, T. Okegawa, J.-T. Hsieh, and J. M. Bergelson
The coxsackievirus and adenovirus receptor is a transmembrane component of the tight junction
PNAS, December 18, 2001; 98(26): 15191 - 15196.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, T. W.
Right arrow Articles by Fong, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, T. W.
Right arrow Articles by Fong, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online