|
|
||||||||
1 Department of Immunology, 2 Department of Pharmacology Research and Development, 3 Department of Molecular Biology, 4 Department of Cell Biology and Technology, 5 Department of Antibody Technology, and 6 Department of Pathology, Genentech, South San Francisco, California 94080
| |
ABSTRACT |
|---|
|
|
|---|
Cell-cell interactions of the mucosal epithelia are important for the maintenance and establishment of epithelial barrier function. During events of inflammation, such cell-cell interactions are often disrupted, resulting in a leaky epithelial barrier, which in turn can lead to various inflammatory and infective dysfunctions. Human junctional adhesion molecule (huJAM), found on the mucosal epithelia and vascular endothelia of many major organ systems, is a membrane glycoprotein which resolves to a doublet band of ~40 and ~37 kDa under SDS-PAGE analysis, representing differentially glycosylated forms of the same protein. huJAM was localized to the lateral membrane of Caco-2 cells (a human colonic epithelial cell line) monolayers, in an area basolateral of the epithelial tight junctions (TJ). Through functional and biochemical assays, we show huJAM to be able to homotypically associate and to participate in TJ restitution after trypsin-EDTA disruption. Furthermore, we also observed a migration of huJAM expression toward areas of cell-cell contacts during events of cell adhesion and monolayer formation. These qualities makes huJAM a likely player in the regulation of cell-cell contacts and the subsequent formation of TJs.
epithelial permeability; junctions; immunoglobulin superfamily; adhesion molecule; cell contact
| |
INTRODUCTION |
|---|
|
|
|---|
ON POLARIZED CELLS of the epithelium, the tight junction (TJ) is a physical barrier with both a "fence" and a "gate" function. While the fence function of the TJ represents and maintains the boundary between the physically distinct apical and basolateral compartments of the polarized epithelium (17), the "gate" function describes the rate-limiting step in the trafficking of cells and particles through the paracellular pathway (20). A dysfunction in these TJ functions can result in pericellular leakage of fluid and particles as well as a loss of cellular polarization (17, 22, 27). Functional TJs in a polarized epithelium are comprised of three major membrane components: occludin (7) and the claudin family members, claudin-1 and -2 (6, 30). Claudin-1 and claudin-2 are thought to be responsible for the recruitment of occludin to the TJ strands (8), which in turn interacts with the apical F-actin ring through associations with ZO-1, ZO-2, and ZO-3 (11, 20). Key in the process of establishing and maintaining a functional TJ as well as organizing polarized epithelia is the adherence junction molecule E-cadherin (10, 32).
Recently, murine junctional adhesion molecule (mJAM), a protein
possessing two putative Ig domains, a single transmembrane, and a short
cytoplasmic tail, was localized to murine epithelial TJs
(16), platelets, endothelial junctions, myosin heavy chain (MHC) class II-positive antigen presenting cells of the thymic medulla,
and T-cell areas of the peripheral lymphoid organs (15). Functionally, mJAM has been shown to participate in cell-cell adhesion
and monocyte migration (16) and has been implicated in
cell trafficking and cell fate determination (15).
Although human junctional adhesion molecule (huJAM) was recently
described, not much is understood beyond its tumor necrosis factor-
(TNF-
) and interferon-
(IFN-
) downregulatable endothelial
membrane expression (24). Here, we present data that
describes huJAM as a protein that is significantly different from mJAM
in localization and tissue distribution; we further characterize the
involvement of huJAM in cell-cell contact formation and epithelial TJ
regulation through a potential homotypic interaction.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of huJAM-Fc. huJAM was initially identified in expressed sequence tag (EST) databases through homology to CD22 and was cloned from human fetal kidney using TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT as a probe. The identification of huJAM was conducted independent of Ozaki et al. (24).
huJAM-Fc was expressed in insect cells as previously described (1). huJAM-Fc was purified with a 5 ml HiTrap Protein A Sepharose column (Amersham Pharmacia Biotech, Piscataway, NJ) and eluted with 0.1 M glycine-HCl, pH 3.0, Fractions were collected and neutralized with 1 M Tris, pH 8.0 (final concentrate of 0.2 M Tris). Peak fractions concentrated using Centriprep 30 (Millipore Products, Bedford, MA) concentrators and dialyzed extensively against PBS at 4°C. Protein assays were performed with bicinchoninic acid reagent (BCA; Pierce Chemicals, Rockford, IL), and analyzed by SDS-PAGE with Coomassie staining. The average yield was 10 µg/ml.Antibody generation.
BALB/c females were immunized and boosted with 10 µg huJAM-Fc via
footpad injections as previously described (5). Single clones were screened for reactivity to huJAM-Fc and not to human IgG,
titrated out to single cell densities, and rescreened. A single
clone termed 10A5 (IgG1
) was discovered and used for ascites fluid
generation (2). Antibody was purified using Protein G
(Amersham Pharmacia Biotech) and eluted with 0.1 M glycine, pH 3.0. Purified antibody was dialyzed into PBS; protein concentration was
obtained using the Pierce BCA reagent.
Expression of huJAM in CHO cells. huJAM cDNA was amplified by PCR from a human colon cDNA library (Clontech, Palo Alto, CA) using the primers specific for the 5' and 3' ends of the coding sequence (5' sequence: TTAGGATCCCCCACCATGGGGACAAAGGCGCAAGTCGAGAGGAAA; 3' sequence: TTAAAGCTTTCACACCAGGAATGACGAGGTCTGTTTGAA). The amplified fragment was gel purified, digested (BamH I and Hind III), extracted in phenol-chloroform-isoamyl alcohol (GIBCO BRL, Life Technologies, Gaithersburg, MD), lyophilized, and ligated into pSD5 expression vector (pSD5.huJAM), transfected into Chinese hamster ovary cells (CHO), and selected as previously described (14). Colonies were lifted with 2.5 mM EDTA and screened for huJAM expression by flow cytometry using monoclonal antibody (MAb) 10A5 (5 µg/ml) with FITC-conjugated goat anti-mouse IgG1 Fc (Jackson Immunoresearch, Burlingame, CA). One clone, CuL8r, was selected for further analysis.
Clontech multiple human tissue mRNA expression array. A multiple human tissue mRNA expression array (Clontech) was used as described by the manufacturer. Hybridization was performed using 25 ng of pSD5.huJAM labeled with [32P]dATP (Strip-EZ; Ambion, Austin, TX) and purified with a MicroSpin G50 column (Amersham Pharmacia Biotech). The blot was exposed overnight using a BAS phosphoimaging plate (Fuji, Japan) and developed on a BAS-2000 phosphoimager (Fuji).
Staining.
Confluent monolayers of Caco-2 cells or A549 cells were cultured as
previously described (26, 28). Staining was done using a
variation of previous descriptions (23). Monolayers were
fixed/permeabilized with methanol for 20 min at
20°C. Then, 10A5 or
Alexa 488-conjugated 10A5 (Alexa 488 Protein Labeling Kit; Molecular
Probes, Eugene, OR) was used at 10 µg/ml; polyclonal antibody against
occludin or ZO-1 (Zymed, South San Francisco, CA) was used at
1:200. FITC- or Cy5-conjugated goat anti-mouse or anti-rabbit
IgG (Caltag, Burlingame, CA) was used at 1:200. Monolayers were mounted
in Vectashield mounting medium (Vector, Burlingame, CA). For some conditions, Caco-2 monolayers were either washed three times in Hanks'
balanced salt solution without calcium and magnesium [HBSS(
), GIBCO
BRL, Life Technologies] and incubated in HBSS(
) for 30 min at 37°C
(calcium starvation) or treated with 2 mM EDTA in HBSS(
) for 12 min
at 37°C (EDTA disruption) before staining as stated. Slides were
analyzed with a spectral confocal microscope (model TCS SP; Leica
Microsystems, Heidelberg, Germany).
Immunoprecipitation and purification of huJAM. 10A5 was conjugated at 2 mg/ml to CNBr-activated Sepharose 6MB (Amersham Pharmacia Biotech). Cell preparation, biotinylation, lysis, and protein purification were all carried out at 4°C. Caco-2 or 293 cells (108 cells/162 cm2) were washed with HBSS without phenol red, and sodium bicarbonate (HBSS+; GIBCO BRL, Life Technologies). Cells were biotinylated with sulfo-NHS-biotin (Pierce Chemicals) and lysed as previously described (25). CNBr-conjugated 10A5 beads were used at 1 mg/109 cells. Beads were washed with lysis buffer (HBSS+ with 2% Triton X-100, 2 mM phenylmethylsulfonyl fluoride, 0.4 TIU/ml aprotinin, 10 mM NaF, 10 mM NaOV3, and 10 mM iodoacetamide) followed by OG wash buffer [lysis buffer containing 1% n-octylglucoside (OG)] and eluted for 30 min with 0.1 M glycine-HCl + 1% OG, pH 3.0, at 4°C. Eluate was neutralized by the addition of Tris, pH 8.0, to a final concentration of 0.2 M. The eluates were concentrated on a 10-kDa cut-off Centricon or Centriprep concentrator (Millipore Products) and analyzed by SDS-PAGE and Western blot.
In some cases Caco-2 monolayers, cultured as previously described (26), were selectively biotinylated as described (18), and immunoprecipitation was performed using methods outlined above. For deglycosylation studies, an enzyme deglycosylation kit (Bio-Rad Laboratories, Hercules, CA) was used, per manufacturer's instructions.Western blotting.
Samples were run out on gels (4-15% or 4-20% Bio-Rad
Tris-HCl Ready Gels, Bio-Rad Laboratories) under reducing (20 mM
-mercaptoethanol) or nonreducing (40 mM iodoacetamide) conditions
and transferred onto nitrocellulose. The blots were blocked 1 h
with Blotto [5% milk with TBS containing 0.5% Tween-20 (Bio-Rad
Laboratories)]. Biotinylated samples were probed with 30 ng/ml
horseradish peroxidase (HRP)-conjugated streptavidin (Amersham
Pharmacia Biotech) in TTBS (TBS containing 0.5% Tween-20); samples
without biotinylation were probed with either 10A5 or mouse IgG1 (10 µg/ml) in Blotto (1 h), washed with TTBS, and incubated for 30 min
with 1 µg/ml HRP-conjugated goat anti-mouse IgG1 (Caltag). The blots
were washed with TTBS and developed with the ECL Plus developing
reagent (Amersham Pharmacia Biotech). Blots were exposed to Kodak
BioMax ML Film and developed with the Kodak M35A X-OMAT Film Processor.
huJAM homotypic binding. Purified huJAM or CuL8r (huJAM expressing CHO cells) were plated onto Nunc Maxisorb 96-well plates [50 µl per well, 2 h at room temperature in binding buffer (TBS plus 2 mM CaCl2, 2 mM MgCl2, and 2 mM MnCl2) for purified huJAM; CuL8r was plated to a confluent monolayer in tissue culture conditions]. The plate was washed and blocked in blocking buffer (binding buffer containing 0.5% BSA for Fc fusion/protein binding, media for Fc fusion/cell binding), 30 min at room temperature. huJAM-Fc, human IgG1, or the control Fc fusion protein was applied at 100 ng/well (50 µl/well) for 1 h; where appropriate, MAb 10A5 or mouse IgG1 Fab fragments (generated using with ImmunoPure Fab Preparation kit, Pierce Chemicals) were used at 4 µg/well (200 µl/well). The plates were washed, incubated for 1 h with 50 µl/well of a 1:1,000 dilution of HRP-conjugated mouse anti-human IgG1 Fc (Caltag) in blocking buffer. Color change was observed using TMB Peroxidase Substrate (Kirkegaard and Perry Laboratories). Color development was stopped by the addition of 1 M phosphoric acid; plates were read at 450 nm on the ThermoMax Microplate Reader (Molecular Devices, Sunnyvale, CA). For flow cytometry-based experiments, CuL8r was lifted using trypsin/EDTA (GIBCO BRL, Life Technologies) and incubated in media (containing 0.03% NaN3) with 1 µg/ml huJAM-Fc.Alexa 488 (conjugated using Alexa 488 conjugation kit, Molecular Probes) for 30 min at 4°C. Cells were pelleted, washed three times, and analyzed on a FACScan (Becton-Dickinson, Franklin Lakes, NJ).
Epithelial monolayer restitution assay.
Confluent monolayers of Caco-2 cells were grown on collagen-coated
1-cm2 polycarbonate Transwell filters as previously
described (28). At full confluence, monolayers achieve a
transepithelial resistance (TER) of >500
· cm2, as measured using a "chopstick"
voltmeter (Millicell-ERS; Millipore). Monolayers were washed twice with
PBS at 37°C followed by the addition of 200 µl PBS containing 10 mM
EDTA and 100 µl 0.25% trypsin in HBSS(
) (GIBCO BRL) to the apical
compartment. PBS containing 10 mM EDTA (1 ml) was introduced to the
basolateral compartment. After 30 min at 37°C, TER values
were consistently between 140-160
· cm2.
Buffer was removed from both compartments and replaced with culture
media (28) containing either 10 µg/ml huJAM-Fc, 10A5, human IgG1, or mouse IgG1 control. TER readings were obtained over the
next 60 h using the "chopstick" voltmeter.
| |
RESULTS |
|---|
|
|
|---|
huJAM expression and localization. To initially localize huJAM, a monoclonal antibody termed 10A5 (MAb 10A5) was generated against an huJAM/human IgG1 Fc fusion protein (huJAM-Fc). MAb 10A5 was found to react exclusively to huJAM-Fc and not to human IgG1 or a human CD4/human IgG1 Fc fusion protein (CD4-Fc).
Immunolocalization of huJAM on Caco-2 monolayers with 10A5 showed strong pericellular staining similar to patterns observed with occludin and ZO-1 (Fig. 1, a, b, and c, respectively). Although the cells were fixed and permeabilized, no appreciable intracellular staining was seen in these conditions. Colocalization studies in the xz-plane showed distinct labeling patterns for ZO-1 and huJAM (Fig. 1d) and extensive colocalization for occludin and huJAM (Fig. 1e). ZO-1 was present in a punctate pattern at the apical "neck" of Caco-2 cells, whereas occludin was present in the same apical punctate manner as well as along the lateral membrane of Caco-2 cells. huJAM staining was most intense in the apical lateral membrane, where it showed good overlap with occludin staining. This overlap seems to transition to a singular huJAM staining toward the basal portion of the lateral space. No significant overlap was seen between ZO-1 and huJAM in these studies; nor was there any observable apical or basal plasma membrane huJAM staining.
|
Biochemical characterization of huJAM.
MAb 10A5 was subsequently used for biochemical studies. Caco-2 cells
were grown to confluence (TER >500
· cm2) and
surface biotinylated on either the apical or the basolateral surface. It was previously demonstrated that an intact
monolayer with functional TJs allows for selective biotinylation of
either the apical or basolateral surfaces of polarized epithelial cells (19). The biotinylated monolayers were then lysed and
immunoprecipitated with MAb 10A5-conjugated CNBr-activated
beads. Each immunoprecipitation condition was then subjected
to Western blotting with HRP-conjugated streptavidin (to observe
polarized expression) or MAb 10A5 (as an immunoprecipitation control).
1) was used as
a selective biotinylation control (Fig. 2A, lane
6) and was only observed in the basolaterally biotinylated
conditions. Immunoblotting of a replicate gel with MAb 10A5 showed
equally intense bands corresponding to huJAM in both apically and
basolaterally biotinylated membrane preparations (Fig. 2A,
lanes 7 and 10), showing that selective
biotinylation had no effect on the ability of MAb 10A5 to
immunoprecipitate huJAM from Caco-2 monolayers and reiterating that the
appearance of a 10A5-reactive, streptavidin-positive band on the
basolaterally biotinylated conditions was due specifically to selective
biotinylation. Results from these selective biotinylation studies
suggest that huJAM is localized in a basolateral fashion and confirms
the confocal studies outlined above.
|
Tissue distribution of huJAM.
To further localize huJAM expression in tissue, a multiple human tissue
Northern blot was probed with the full-length cDNA of huJAM.
Expression was greatest in placenta and lung and was demonstrated in
most major organ systems. The cerebellum and the spinal cord were the
only two nonreactive samples (Table 1).
|
|
huJAM can homotypically associate.
For the purpose of further biochemical studies, native huJAM was
isolated from the 293 (human embryonic kidney epithelial cell line)
cells using MAb 10A5 coupled affinity matrix. The 293 cells were chosen
for the large-scale purification, because of their ease of maintenance
and rapidity of growth. Bulk purified protein migrated as a 45/40-kDa
doublet under reducing conditions (data not shown). Under nonreducing
conditions, a doublet of 40/37 kDa was observed (Fig.
4, lane 1). Western blotting
the bulk-purified protein with MAb 10A5 confirmed the doublet to be
huJAM (Fig. 4, lane 3). Mouse IgG-coupled control matrix was
negative in all cases (Fig. 4, lanes 2 and 4). In
handling the bulk-purified protein, we noted the appearance of a strong
~60-kDa protein upon concentration of the protein or prolonged
refrigeration of the bulk-purified preparation (Fig. 4, lane
5). Similarly treated, mouse IgG matrix purified, control
preparations had an absence of this 60-kDa band (Fig. 4, lane
6). NH2-terminal sequencing of the 60-kDa
band provided the sequence SVTVHSSEP, which was a 100% match with
huJAM, suggesting the 60-kDa band to be a representation of an
SDS-insensitive homodimer of huJAM. Also matching in amino acid
sequence was human platelet F11 antigen (21). Published
sequences of the human platelet F11 antigen fragments were examined and
found to be 100% homologous to fragments of huJAM. To confirm possible
huJAM expression on platelets, human platelet lysates were blotted with
MAb 10A5; an antibody-specific doublet at ~40/37 kDa was observed on
whole platelet lysates (data not shown).
|
|
huJAM is involved in TJ restitution after monolayer disruption.
Confluent Caco-2 monolayers with TER of >500
· cm2 were treated with EDTA and trypsin to
disrupt intercellular TJ interactions, resulting in a decline of
measured TER values to 140-160
· cm2.
Disrupted monolayers were then allowed to recover in media or in the
presence of 10 µg/ml huJAM-Fc or human IgG1.
|
huJAM is present along cell-cell contacts.
Results obtained from the restitution studies, combined with the
insights of huJAM-huJAM homotypic interactions, lead us to postulate
huJAM as an adhesion molecule important in cell-cell contact formation.
To further examine this function of huJAM, A549 cells were used. A549
is a human airway epithelial line which, compared with Caco-2, has the
advantage of an accelerated growth rate, making it an ideal cell line
for monolayer formation and cell-cell contact studies. A549 cells were
plated on collagen-coated Costar Transwell filters at subconfluent
densities and stained with MAb 10A5 as the cells were coming to
confluence. After the initial cell adhesion to the collagen matrix,
huJAM staining on A549 cells were seen as a general, diffused
membranous staining (Fig. 7A).
As the cells were given time to establish cell-cell contacts and
allowed to spread, a shift in staining pattern was observed. At
hour 4, two types of huJAM staining were seen. Cells that
are spreading and making contact with a neighboring cell exhibited the
distinct cell-cell junction huJAM staining observed in confluent Caco-2
monolayers (Fig. 7B). Cells that are not forming cell-cell
contacts, on the other hand, retained the diffused membranous staining
seen after the initial cell adhesion (Fig. 7B). At
hour 8, the distinct cell-cell junction huJAM staining was
predominant, as most of the cells observed were settled into clusters
or patches of monolayers (Fig. 7C). On a higher power view
of these cell clusters, huJAM staining was seen as fine membrane
interdigitations in areas of cell-cell contacts; huJAM staining was not
observed in the borders of A549 cell clusters, where cells have no
cell-cell contact (Fig. 7D). In the xz-plane,
this distinct huJAM staining was observed along the lateral membrane of
the cells, concentrating in the apical-most lateral compartment (Fig.
7E). On confluent A549 monolayers, huJAM staining was
pericellular, resembling what was seen on Caco-2 monolayers (data not
shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
Here we have presented data concerning epithelial huJAM and described its function, through a probable homotypic interaction, as a mediator of the rate of TJ restitution and cell-cell adhesion. We have also localized the tissue distribution of huJAM through the use of in situ hybridization and immunohistochemical staining. This finding furthers our understanding of JAM, which was first described in the human platelet.
Human platelet F11 antigen is a integral membrane protein shown to be
capable of activating, aggregating, and degranulating platelets when
cross-linked with the Fc
-RII receptor (21). This platelet antigen was discovered to share a 100% amino acid sequence homology to that of huJAM.
Recently, a flurry of publications has provided great insight into the
function of JAM in both the human and murine systems. huJAM was
recently described in the endothelial cell system as a protein that is
regulated through a TNF-
- and IFN-
-sensitive pathway
(24). In the mouse, murine JAM (mJAM) was recently shown to participate in the formation of cell-cell contact as well as monocyte migration (16). Further findings also implicated
mJAM in cell trafficking and fate determination of MHC class
II-positive antigen-presenting cells of the thymic medulla and the
germinal centers of peripheral lymphoid organs
(15).
Using MAb 10A5, we have biochemically localized huJAM to the basolateral compartment of polarized Caco-2 monolayers. Biochemically, we also discovered huJAM to be a protein that resolves to a doublet of 40 and 37 kDa. This difference in molecular weight was resulted from differential N-glycosylation of a core huJAM protein of ~35 kDa. Taking into account that the average molecular mass of a single N-linked sugar is 3-4 kDa (29), we reached the conclusion that huJAM is expressed heterogeneously on epithelial cell surfaces, one population having two N-linked sugars (40 kDa), and the other having only one N-linked sugar (37 kDa). Further localization of huJAM was obtained through confocal microscopy, placing huJAM in the lateral membrane, in an area that resides basolateral of the epithelial TJ. There was no noticeable intracellular staining of huJAM on the confluent Caco-2 monolayers. The apical plasma membrane of Caco-2 monolayers was also devoid of noticeable huJAM staining, although some basal huJAM staining resembling that of basal actin stress fibers was observed (data not shown). These observations would suggest that huJAM is important as an adhesion molecule in areas of cell-cell, and perhaps cell-matrix, contact.
Through immunohistochemistry and in situ hybridization, we have localized huJAM to the vascular endothelium and the mucosal epithelium of numerous organs and have noted an elevation of huJAM mRNA in inflamed pulmonary bronchioles. Such findings concerning huJAM mRNA upregulation in inflamed tissue correlate well with the previous findings concerning mJAM, where the antibody against mJAM (BV11) was discovered to inhibit murine monocyte migration in an "air-pouch" assay (16).
We were also able to purify huJAM to homogeneity using an MAb 10A5 affinity matrix, allowing us to demonstrate an huJAM-huJAM homotypic interaction that seems to be SDS insensitive. This biochemically established homotypic interaction was later reaffirmed through solid-phase assays, demonstrating both protein-protein (huJAM:huJAM-Fc) and cell-protein [CuL8r (huJAM transfected CHO cell line):huJAM-Fc] interactions. Further support was lent to the observed homotypic interactions by flow cytometry analysis of the interaction between soluble huJAM-Fc and CuL8r, in suspension. Supporting this idea of huJAM homotypic interaction, huJAM staining on A549 cells during monolayers formation showed a shift from a diffused membranous staining to a pericellular-staining pattern restricted to areas of cell-cell contacts. Such a shift in protein localization suggests huJAM to be either a mediator of cell-cell contact or a molecular cue directing the establishment and the maintenance of the cell-cell contacts. We were able to further explore this hypothesis through the characterization of huJAM distribution during TJ disruption. When Caco-2 monolayers were EDTA treated, the huJAM staining becomes clearly intracellular and disorganized, suggestive of huJAM being involved in the scaffolding and trafficking of important adhesion molecules at the lateral membrane during events of cell-cell contact formation or disruption. The use of the huJAM-Fc molecule as well as MAb 10A5 also provided further clues to huJAM function. By first disrupting an established TJ using trypsin-EDTA, we were able to retard TJ restitution through the addition of huJAM-Fc or MAb 10A5. The ability of huJAM-Fc to disrupt the reformation of a disrupted TJ suggests that huJAM-Fc is interacting with either native huJAM or a thus far unidentified epithelial counter ligand. This interaction is certainly an important step in the formation of a functional TJ and may serve as a molecular cue to either accelerate or, as the case may be, arrest TJ restitution in the event of TJ disruption. The ability of MAb 10A5 to assert the same effect on TJ restitution as huJAM-Fc suggests that MAb 10A5 is able to bind to a domain of huJAM important to its function. Further insight is given to the role of huJAM in epithelial biology by the fact that neither the Fc fusion protein or MAb 10A5 was found to perturb the TJ integrity of intact epithelial monolayers. This lack of function in the disruption of intact TJ would indicate two possible routes of action. First, for huJAM-Fc or MAb 10A5 to act, access must be granted to the lateral surfaces of epithelial cells via the pericellular transport pathway or to the native huJAM itself, which may be otherwise engaged in a static interaction with its native epithelial counterpart. Second, the function of native huJAM resides in the recovery or re-formation of epithelial TJ or cell contacts; this specific function would not be required in intact monolayers until the epithelial cells first receive a disruptive signal such as a loss of TJ integrity or cell-cell adhesion. This participation in the process of TJ restitution is reminiscent of the roles E-cadherin and occludin play in the assembly as well as the maintenance of the TJ (3, 4, 9, 12, 31). Although we have noted similar staining patters between huJAM and E-cadherin (data not shown), we have thus far been unable to establish a functional hierarchy in the involvement of E-cadherin, huJAM, and the other TJ proteins, including occludin, during the formation and polarization of the lateral membrane. However, because the "intracellularization" of huJAM precedes that of occludin, with the reverse being true during events of TJ restitution (occludin being transferred from an intracellular locale to a membrane locale in advance of huJAM), we believe it would be logical to place huJAM function somewhere downstream of E-cadherin and upstream of occludin. In that E-cadherin is responsible for making the initial adhesive cell-cell contacts, huJAM is responsible for the organization of the various other adhesive events, and occludin is responsible, in part, for the final sealing of the TJ.
Through these functional and localization findings, we conclude that huJAM is located in a key position to be an effector of epithelial barrier integrity and may indeed be a mediator of inflammatory cell infiltration as well as a participant in recovery from resulting epithelial barrier damage. These qualities make huJAM an attractive potential target for therapies intended for inflammatory diseases.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Gretchen D. Frantz, Barbara D. Wright, and Ilona Holcomb for expert help on in situ hybridization and immunohistochemistry.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: T. W. Liang, Genentech, MS34, 1 DNA Way, South San Francisco, CA 94080 (E-mail: vonbek{at}gene.com).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 9 May 2000; accepted in final form 5 July 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ashkenazi, A,
and
Chamow SM.
Immunoadhesins as research tools and therapeutic agents.
Curr Opin Immunol
9:
195-200,
1997[ISI][Medline].
2.
Azrin, MA,
Ling FS,
Chen Q,
Pawashe A,
Migliaccio F,
Homer R,
Todd M,
and
Ezekowitz MD.
Preparation, characterization, and evaluation of a monoclonal antibody against the rabbit platelet glycoprotein IIb/IIIa in an experimental angioplasty model.
Circ Res
75:
268-277,
1994
3.
Balda, MS,
and
Matter K.
Tight junctions.
J Cell Sci
111:
541-547,
1998[Abstract].
4.
Behrens, J,
Birchmeier W,
Goodman SL,
and
Imhof BA.
Dissociation of Madin-Darby canine kidney epithelial cells by the monoclonal antibody anti-arc-1: mechanistic aspects and identification of the antigen as a component related to uvomorulin.
J Cell Biol
101:
1307-1315,
1985
5.
Deng, B,
Banu N,
Malloy B,
Hass P,
Wang JF,
Cavacini L,
Eaton D,
and
Avraham H.
An agonist murine monoclonal antibody to the human c-Mpl receptor stimulates megakaryocytopoiesis.
Blood
92:
1981-1988,
1998
6.
Furuse, M,
Fujita K,
Hiiragi T,
Fujimoto K,
and
Tsukita S.
Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin.
J Cell Biol
141:
1539-1550,
1998
7.
Furuse, M,
Hirase T,
Itoh M,
Nagafuchi A,
Yonemura S,
and
Tsukita S.
Occludin: a novel integral membrane protein localizing at tight junctions.
J Cell Biol
123:
1777-1788,
1993
8.
Furuse, M,
Sasaki H,
Fujimoto K,
and
Tsukita S.
A single gene product, claudin-1 or -2, reconstitutes tight junction strands and recruits occludin in fibroblasts.
J Cell Biol
143:
391-401,
1998
9.
Gumbiner, B,
and
Simons K.
A functional assay for proteins involved in establishing an epithelial occluding barrier: identification of a uvomorulin-like polypeptide.
J Cell Biol
102:
457-468,
1986
10.
Gumbiner, B,
Stevenson B,
and
Grimaldi A.
The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex.
J Cell Biol
107:
1575-1587,
1988
11.
Haskins, J,
Gu L,
Wittchen ES,
Hibbard J,
and
Stevenson BR.
ZO-3, a novel member of the MAGUK protein family found at the tight junction, interacts with ZO-1 and occludin.
J Cell Biol
141:
199-208,
1998
12.
Lacaz-Vieira, F,
Jaeger MM,
Farshori P,
and
Kachar B.
Small synthetic peptides homologous to segments of the first external loop of occludin impair tight junction resealing.
J Membr Biol
168:
289-297,
1999[ISI][Medline].
13.
Lu, LH,
and
Gillett NA.
An optimized protocol for in situ hybridization using PCR-generated 33P-labeled riboprobes.
Cell Vision
1:
169-176,
1994.
14.
Lucas, BK,
Giere LM,
DeMarco RA,
Shen A,
Chisholm V,
and
Crowley CW.
High-level production of recombinant proteins in CHO cells using a dicistronic DHFR intron expression vector.
Nucleic Acids Res
24:
1774-1779,
1996
15.
Malergue, F,
Galland F,
Martin F,
Mansuelle P,
Aurrand-Lions M,
and
Naquet P.
A novel immunoglobulin superfamily junctional molecule expressed by antigen presenting cells, endothelial cells and platelets.
Mol Immunol
35:
1111-1119,
1998[ISI][Medline].
16.
Martin-Padura, I,
Lostaglio S,
Schneemann M,
Williams L,
Romano M,
Fruscella P,
Panzeri C,
Stoppacciaro A,
Ruco L,
Villa A,
Simmons D,
and
Dejana E.
Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration.
J Cell Biol
142:
117-127,
1998
17.
Matter, K,
and
Balda MS.
Occludin and the functions of tight junctions.
Int Rev Cytol
186:
117-146,
1999[ISI][Medline].
18.
McCormick, BA,
Nusrat A,
Parkos CA,
D'Andrea L,
Hofman PM,
Carnes D,
Liang TW,
and
Madara JL.
Unmasking of intestinal epithelial lateral membrane beta1 integrin consequent to transepithelial neutrophil migration in vitro facilitates inv-mediated invasion by Yersinia pseudotuberculosis.
Infect Immun
65:
1414-1421,
1997[Abstract].
19.
McCormick, BA,
Parkos CA,
Colgan SP,
Carnes DK,
and
Madara JL.
Apical secretion of a pathogen-elicited epithelial chemoattractant activity in response to surface colonization of intestinal epithelia by Salmonella typhimurium.
J Immunol
160:
455-466,
1998
20.
Mitic, LL,
and
Anderson JM.
Molecular architecture of tight junctions.
Annu Rev Physiol
60:
121-142,
1998[ISI][Medline].
21.
Naik, UP,
Ehrlich YH,
and
Kornecki E.
Mechanisms of platelet activation by a stimulatory antibody: cross-linking of a novel platelet receptor for monoclonal antibody F11 with the Fc gamma RII receptor.
Biochem J
310:
155-162,
1995.
22.
Nash, S,
Stafford J,
and
Madara JL.
Effects of polymorphonuclear leukocyte transmigration on the barrier function of cultured intestinal epithelial monolayers.
J Clin Invest
80:
1104-1113,
1987.
23.
Nusrat, A,
Parkos CA,
Liang TW,
Carnes DK,
and
Madara JL.
Neutrophil migration across model intestinal epithelia: monolayer disruption and subsequent events in epithelial repair.
Gastroenterology
113:
1489-1500,
1997[ISI][Medline].
24.
Ozaki, H,
Ishii K,
Horiuchi H,
Arai H,
Kawamoto T,
Okawa K,
Iwamatsu A,
and
Kita T.
Cutting edge: combined treatment of TNF-alpha and IFN-gamma causes redistribution of junctional adhesion molecule in human endothelial cells.
J Immunol
163:
553-557,
1999
25.
Parkos, CA,
Colgan SP,
Diamond MS,
Nusrat A,
Liang TW,
Springer TA,
and
Madara JL.
Expression and polarization of intercellular adhesion molecule-1 on human intestinal epithelia: consequences for CD11b/CD18-mediated interactions with neutrophils.
Mol Med
2:
489-505,
1996[ISI][Medline].
26.
Parkos, CA,
Delp C,
Arnaout MA,
and
Madara JL.
Neutrophil migration across a cultured intestinal epithelium. Dependence on a CD11b/CD18-mediated event and enhanced efficiency in physiological direction.
J Clin Invest
88:
1605-1612,
1991.
27.
Parsons, PE,
Sugahara K,
Cott GR,
Mason RJ,
and
Henson PM.
The effect of neutrophil migration and prolonged neutrophil contact on epithelial permeability.
Am J Pathol
129:
302-312,
1987[Abstract].
28.
Rubas, W,
Villagran J,
Cromwell M,
McLeod A,
Wassenberg J,
and
Mrsny R.
Correlation of solute flux across Caco-2 monolayers and colonic tissue in vitro.
STP Pharma Sci
5:
93-97,
1995.
29.
Scott, JL,
Dunn SM,
Jin B,
Hillam AJ,
Walton S,
Berndt MC,
Murray AW,
Krissansen GW,
and
Burns GF.
Characterization of a novel membrane glycoprotein involved in platelet activation.
J Biol Chem
264:
13475-13482,
1989
30.
Tsukita, S,
and
Furuse M.
Occludin and claudins in tight-junction strands: leading or supporting players?
Trends Cell Biol
9:
268-273,
1999[ISI][Medline].
31.
Wong, V,
and
Gumbiner BM.
A synthetic peptide corresponding to the extracellular domain of occludin perturbs the tight junction permeability barrier.
J Cell Biol
136:
399-409,
1997
32.
Yap, AS,
Stevenson BR,
Keast JR,
and
Manley SW.
Cadherin-mediated adhesion and apical membrane assembly define distinct steps during thyroid epithelial polarization and lumen formation.
Endocrinology
136:
4672-4680,
1995[Abstract].
This article has been cited by other articles:
![]() |
E. A. Severson, L. Jiang, A. I. Ivanov, K. J. Mandell, A. Nusrat, and C. A. Parkos Cis-Dimerization Mediates Function of Junctional Adhesion Molecule A Mol. Biol. Cell, May 1, 2008; 19(5): 1862 - 1872. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Mrsny, G. T. Brown, K. Gerner-Smidt, A. G. Buret, J. B. Meddings, C. Quan, M. Koval, and A. Nusrat A Key Claudin Extracellular Loop Domain is Critical for Epithelial Barrier Integrity Am. J. Pathol., April 1, 2008; 172(4): 905 - 915. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. Braiterman, S. Heffernan, L. Nyasae, D. Johns, A. P. See, R. Yutzy, A. McNickle, M. Herman, A. Sharma, U. P. Naik, et al. JAM-A is both essential and inhibitory to development of hepatic polarity in WIF-B cells Am J Physiol Gastrointest Liver Physiol, February 1, 2008; 294(2): G576 - G588. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Mandell, L. Berglin, E. A. Severson, H. F. Edelhauser, and C. A. Parkos Expression of JAM-A in the Human Corneal Endothelium and Retinal Pigment Epithelium: Localization and Evidence for Role in Barrier Function Invest. Ophthalmol. Vis. Sci., September 1, 2007; 48(9): 3928 - 3936. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Shasby Cell-cell adhesion in lung endothelium Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L593 - L607. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Mehta and A. B. Malik Signaling Mechanisms Regulating Endothelial Permeability Physiol Rev, January 1, 2006; 86(1): 279 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. M. Martinez-Estrada, L. Manzi, P. Tonetti, E. Dejana, and G. Bazzoni Opposite effects of tumor necrosis factor and soluble fibronectin on junctional adhesion molecule-A in endothelial cells Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1081 - L1088. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zen, B. A. Babbin, Y. Liu, J. B. Whelan, A. Nusrat, and C. A. Parkos JAM-C Is a Component of Desmosomes and a Ligand for CD11b/CD18-mediated Neutrophil Transepithelial Migration Mol. Biol. Cell, August 1, 2004; 15(8): 3926 - 3937. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Bazzoni and E. Dejana Endothelial Cell-to-Cell Junctions: Molecular Organization and Role in Vascular Homeostasis Physiol Rev, July 1, 2004; 84(3): 869 - 901. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ebnet, A. Suzuki, S. Ohno, and D. Vestweber Junctional adhesion molecules (JAMs): more molecules with dual functions? J. Cell Sci., January 1, 2004; 117(1): 19 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. W. Liang, H. H. Chiu, A. Gurney, A. Sidle, D. B. Tumas, P. Schow, J. Foster, T. Klassen, K. Dennis, R. A. DeMarco, et al. Vascular Endothelial-Junctional Adhesion Molecule (VE-JAM)/JAM 2 Interacts with T, NK, and Dendritic Cells Through JAM 3 J. Immunol., February 15, 2002; 168(4): 1618 - 1626. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Aurrand-Lions, C. Johnson-Leger, C. Wong, L. Du Pasquier, and B. A. Imhof Heterogeneity of endothelial junctions is reflected by differential expression and specific subcellular localization of the three JAM family members Blood, December 15, 2001; 98(13): 3699 - 3707. [Abstract] [Full Text] [PDF] |
||||