Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 279: C1239-C1248, 2000;
0363-6143/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Breuza, L.
Right arrow Articles by Le Bivic, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Breuza, L.
Right arrow Articles by Le Bivic, A.
Vol. 279, Issue 4, C1239-C1248, October 2000

Transport and function of syntaxin 3 in human epithelial intestinal cells

Lionel Breuza1, Jack Fransen2, and André Le Bivic1

1 Laboratoire de Génétique et Physiologie du Développement, Institut de Biologie du Développement de Marseille, Centre National de la Recherche Scientifique, Institut National de la Santé et de la Recherche Médicale, Université de la Méditerranée, Assistance Publique de Marseille, 13288 Marseille cedex 09, France; and 2 Department of Cell Biology and Histology, University of Nijmegen, 6500 HB Nijmegen, The Netherlands


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

To follow the transport of human syntaxin (Syn) 3 to the apical surface of intestinal cells, we produced and expressed in Caco-2 cells a chimera made of the entire Syn3 coding sequence and the extracellular domain of the human transferrin receptor (TfR). This chimera (Syn3TfR) was localized to the apical membrane and was transported along the direct apical pathway, suggesting that this is also the case for endogenous Syn3. To test the potential role of Syn3 in apical transport, we overexpressed it in Caco-2 cells and measured the efficiency of apical and basolateral delivery of several endogenous markers. We observed a strong inhibition of apical delivery of sucrase-isomaltase (SI), an apical transmembrane protein, and of alpha -glucosidase, an apically secreted protein. No effect was observed on the basolateral delivery of Ag525, a basolateral antigen, strongly suggesting that Syn3 is necessary for efficient delivery of proteins to the apical surface of intestinal cells.

apical transport; soluble N-ethylmaleimide-sensitive factor attachment protein receptors; Caco-2 cells


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE PLASMA MEMBRANE of epithelial cells is divided into specialized subdomains such as the apical (or luminal) domain, which faces the external medium, and the basolateral domain, which mediates contact with the surrounding cells and the basement membrane. These plasma membrane domains have different lipid and protein compositions, and their specific organization is a prerequisite for their physiological functions (for a recent review, see Ref. 41). How plasma membrane proteins are transported to their final site after biosynthesis has been investigated in several different epithelial models in the last decade (for review, see Ref. 26). Some epithelial cells such as Madin-Darby canine kidney (MDCK; Ref. 20) and Fisher rat thyroid (Ref. 42) cells favor a direct transport of apical and basolateral proteins to their respective membranes after exit from the Golgi complex. On the other hand, epithelial cells from the digestive tract such as hepatocytes (1) or enterocytes (18, 25) tend to transport apical proteins via an indirect pathway that includes a transcytotic step from the basolateral to the apical membrane. As yet, there is no mechanistic explanation for this major difference between epithelial cells.

At least two sorting steps are involved in the transport of plasma membrane proteins from the Golgi complex. The first step is the recognition of apical and basolateral proteins through intrinsic sorting signals and their packaging into distinct transport vesicles. The second step of sorting involves specific recognition between transport vesicles and their target domain in the plasma membrane. This specific fusion event could be accomplished through the specific pairing of soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins located on the vesicle (v-SNAREs) and SNARE proteins located on the target membrane (t-SNAREs) (32, 37). SNARE complexes are supposed to participate in the fusion event and in the specificity of the membrane fusion (33, 38, 39). Besides SNAREs, several other proteins are involved in the regulation of membrane trafficking and fusion. Among them are N-ethylmaleimide-sensitive factor (NSF), alpha -soluble NSF attachment protein (alpha -SNAP), Sec1, and rab proteins (5, 10, 35).

Targeting of transport vesicles to apical or basolateral membranes is likely to use the same mechanisms as other transport steps, and, indeed, several t-SNAREs have been localized to the plasma membrane of epithelial cells. Syntaxins (Syn)2, -3, and -4 are expressed in epithelial cells, and, although Syn2 is not polarized in MDCK cells, Syn3 is found apically in both MDCK (21) and Caco-2 cells (4) and Syn4 is found basolaterally in MDCK cells (21). Syntaxins form a SNARE complex with proteins of the SNAP-25 family (36), and it has been shown that SNAP-23 (a SNAP-25 homologue) is localized on both membranes in MDCK cells (23), suggesting that SNAP-23 may form complexes with Syn3 and Syn4. Despite the accumulation of data on a potential SNARE machinery at the apical membrane, it has been suggested that apical transport does not rely on this machinery in permeabilized MDCK cells but uses another mechanism (12) in which annexin XIIIb appears to be a crucial component (15). On the other hand, basolateral transport is NSF dependent and utilizes rab 8 (11), alpha -SNAP (12), SNAP-23 (22), and the sec6/8 complex also found in yeast and in neurons (8). The finding that transport to apical membrane was SNARE independent was recently challenged by a study on the role of components of the SNARE fusion machinery in the same MDCK cells; overexpression of rat Syn3 in these cells caused an inhibition of trans-Golgi network (TGN)-to-apical transport and of apical recycling (22). Furthermore, toxin E from Clostridium botulinum (which cleaves SNAP-23) and antibodies against alpha -SNAP were able to inhibit both TGN-to-apical and basolateral transport in permeabilized MDCK cells, suggesting that the SNARE machinery is indeed involved in apical transport. Both groups (12, 22), however, found no involvement of NSF in direct apical transport, indicating that this process is NSF independent. Recently, Lafont et al. (16) found that Syn3 and SNAP-23 were involved in apical transport in MDCK cells together with a v-SNARE called Ti-VAMP. These conflicting results demonstrate that more work needs to be done on the role of SNARE components in apical fusion. Caco-2 cells provide a good epithelial model to test the role of potential elements of the sorting and transport machineries to the apical membrane.

To identify the biosynthetic pathway followed by Syn3 in intestinal cells, we have produced a chimera (Syn3TfR) with this protein and the extracellular domain of the human TfR. This chimera was localized at the apical membrane of Caco-2 cells like endogenous Syn3, indicating that the chimera could be used to follow the biogenetic pathways of Syn3. Using a combination of metabolic pulse chase and selective surface biotinylation, we showed that Syn3TfR was mainly transported along the direct pathway to the apical surface, most likely to prevent formation of basolateral complexes and unwanted fusion events. When Syn3 was overexpressed in Caco-2 cells, we observed a reduced delivery of two apical markers following the direct apical pathway, i.e., sucrase-isomaltase (SI) and alpha -glucosidase. No effect could be detected on the delivery of a basolateral marker. This is the first report of the transport and potential function of a t-SNARE in polarized human intestinal cells.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents and antibodies. Sulfo NHS-SS biotin, sulfo-NHS-LC biotin, and immobilized streptavidin were purchased from Pierce Chemical (Rockford, IL); protein A-Sepharose was from Pharmacia (Uppsala, Sweden). Monoclonal antibodies against SI and dipeptidyl peptidase IV (DPPIV) were from Dr. A. Quaroni (Ithaca, NY), and the monoclonal antibody against Ag525 had been characterized previously (17). Polyclonal anti-placental alkaline phosphatase (PLAP) was from Accurate Chemical and Scientific (Westbury, NY). The monoclonal antibody against the extracellular domain of TfR was from Roche Diagnostics (Meylan, France), and the monoclonal antibody against the cytoplasmic domain was provided by Dr. I. Trowbridge (La Jolla, CA). The polyclonal antibody against SNAP-23 was produced as described for anti-Syn3 (4) by injecting purified histidine (His)-tagged full-length SNAP-23 into a rabbit (20 µg/boost, 1 boost every 3 wk). His-tagged SNAP-23 was also coupled to CNBr-activated Sepharose beads to purify polyclonal antibodies raised against SNAP-23. Monoclonal anti-syntaxin 4 (S40220) was purchased from Transduction Laboratories (Lexington, KY). Anti-alpha -glucosidase (118G3) was described previously (13).

Constructs, cell culture, and transfection. Human Syn3 full-length cDNA (U32315) was subcloned in bicistronic pIRES1-neo (Clontech Laboratories, Palo Alto, CA) and resequenced entirely. A human Syn3TfR chimera was obtained by PCR using human Syn3 cDNA and human TfR as template (30). Two sets of primers were designed: 5'GCGGCCGCATGAAGGACCGTCGGAGCAG3' and 5'AGAATTCAGGCCAACGGAAAGTCCAAT3' for Syn3 and 5'GAATTCA GGGGTAGAACCAAAAACTGA3' and 5'GGATCCTTAAAACTCATTGTC AATGTC3' for TfR. EcoR I restriction sites in 3' and 5' ends of Syn3 and TfR, respectively, allowed us to fuse in frame Syn3 and TfR cDNA, replacing the stop codon of Syn3 by a TCA codon encoding a serine. Chimeric cDNA was subcloned in pIRES1-neo. SNAP-23 cDNA was isolated by PCR on a sample of human intestine cDNA library in lambda gt11 (Clontech) using two designed primers, 5'GAATTCATGGATAATCTGTCATCA3' and 5'TCTAGATTAGCTAATGA GTTT3'. PCR products were subcloned in pIRES1-neo, and one clone was entirely sequenced. His-tagged SNAP-23 was obtained by subcloning the cDNA in pQE-30 vector from Qiagen (Chatsworth, CA) and expressing it in M15 Escherichia coli according to the manufacturer's instructions. Caco-2 cells were from Dr. A. Zweibaum (Villejuif, France) and were grown as previously described (6) with neomycin (0.25 mg/ml) when transfected. Caco-2 cells were transfected using lipofectamine (GIBCO, Grand Island, NY), and positive clones were isolated using 1 mg/ml G418 and tested for Syn3 expression by immunofluorescence after sodium butyrate induction (10 mM, 16 h). The sequence of Syn3 in clone 33 was determined by RT-PCR using a Superscript kit (GIBCO), a high-fidelity PCR kit (Roche Diagnostics), and primers located 5' and 3' in the expression vector pIRES. All clones were tested for correct polarization of endogenous markers by selective surface biotinylation (34). Using the same experiments, we determined the polarity of the Syn3TfR chimera.

Immunofluorescence and confocal microscopy. Cells were grown on glass coverslips and processed as described previously (19). For Syn4, methanol fixation was performed by placing coverslips in pure methanol at -20°C for 3 min and in PBS containing Ca2+ and Mg2+ for rehydration. Confocal microscopy analysis was performed using Zeiss confocal microscope (LSM 410 invert).

Pulse-chase and transport assays. Cells were grown on Transwells (Costar Data Packaging, Cambridge, MA) to confluence and processed 10-15 days later. Filters were incubated for 20 min in DMEM without methionine and cysteine and for 30 min in the same medium supplemented with radiolabeled [35S]methionine and cysteine [Redivue Promix (35S) cell, Amersham]. Newly synthesized proteins were chased for 0.5-8 (chimera targeting), 1 (basolateral antigens), or 4 (apical antigens) h in the presence of a 100-fold excess of cold methionine and cysteine. After three washes in ice-cold PBS containing Ca2+ and Mg2+, cells were biotinylated from the apical or basolateral side. After cell lysis, antigens were immunoprecipitated, eluted from beads, and 1/10 analyzed by SDS-PAGE (total fraction). The surface fraction of the antigen was recovered by streptavidin immunopurification from the eluate and quantified by SDS-PAGE, autoradiography, and BioImage Quantifier software (BioImage, Ann Arbor, MI) analysis. The surface appearance of the chimera on both domains of the cells was expressed as the percentage of the amount at the time of maximal expression at the cell surface. The percentage of apical or basolateral SI was expressed as the ratio of surface to total antigen. From the same experiments, autoradiographic analysis with Bio Image IQ allowed us to calculate the percentage of mature and immature SI. Chimera-processing experiments were carried out as described above. Pulse-chased cells (0-180 min) were lysed, and newly synthesized proteins were precipitated with anti-Syn3 or anti-TfR. Immunoprecipitates were analyzed by SDS-PAGE.

For alpha -glucosidase secretion, cells were processed as described for apical delivery of SI. Apical medium was harvested, cells were lysed, and both medium and cells were submitted to immunoprecipitation in 1% Triton X-100 with monoclonal anti-alpha -glucosidase. Antigens were eluted from beads, and an aliquot was analyzed by SDS-PAGE and autoradiography. alpha -Glucosidase was quantified using BioImage Quantifier software. The percentage of secreted alpha -glucosidase was expressed as the ratio of secreted to total antigen.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Localization and transport of Syn3TfR chimera in Caco-2 cells. To follow the intracellular transport of Syn3 after biosynthesis, we designed a chimera comprising the entire sequence of human Syn3 (4) linked to the extracellular domain of the human TfR (Fig. 1). This construct allowed us to use the selective surface biotinylation technique developed previously (19). This chimera, Syn3TfR, was expressed into Caco-2 cells by stable transfection, and several clones were selected for chimera expression by immunofluorescence using anti-Syn3 antibodies. Because endogenous Syn3 gave a weak signal with this antibody, expression of the chimera could be detected easily over the background. Localization of Syn3TfR was performed by double labeling with apical and basolateral markers in transfected cells and confocal microscopy analysis (Fig. 2). Syn3TfR labeled with anti-Syn3 antibody colocalized with SI (Fig. 2C), suggesting that it behaved like endogenous Syn3, which we localized at the apical membrane in a previous study (4). As for transfected Syn3 (Fig. 2A), we could observe some subapical staining in Syn3TfR-transfected cells. To ascertain whether the apical labeling observed with the antibodies against Syn3 was indeed caused by the chimera, we used a monoclonal antibody directed against the extracellular domain of TfR to label transfected cells. Again, a strong labeling of the apical membrane could be observed over the normal basolateral and intracellular staining usually found for the endogenous TfR. This labeling colocalized with the staining obtained with polyclonal antibodies against Syn3 or PLAP, an apical marker (Fig. 2, F and H, respectively). Conversely, with a monoclonal antibody against the cytoplasmic domain of TfR, no apical staining and no colocalization with Syn3 or PLAP was observed in transfected cells (Fig. 2, E and G), indicating that the chimera was most likely to be the protein responsible for the apical staining. This surface localization was confirmed biochemically using the selective surface labeling with sulfo-NHS-biotin followed by immunoprecipitation and peroxidase-coupled streptavidin blotting. Surface Syn3TfR was concentrated at the apical membrane (>95%; Fig. 3B), whereas endogenous TfR (84 kDa) was mainly found at the basolateral membrane (>80%). The apparent molecular mass of the chimera was 120 kDa, in good agreement with the calculated mass of 105 kDa. Because TfR contains complex N-glycans, we followed the maturation of the chimera to make sure that it was correctly processed. Both TfR and the chimera showed a concomitant increase in apparent molecular mass during a chase after a short metabolic pulse, indicating that this was indeed the case.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1.   Construction of a syntaxin (Syn)3-transferrin receptor (TfR) chimera. A: scheme of Syn3 (filled boxes), TfR (open boxes), and chimera (Syn3TfR). Full-length human Syn3 with stop codon (in position 290) replaced by a serine was linked with extracellular domain of TfR (amino acids 91-760). TM, transmembrane domains of each protein. B: amino acid sequence of the chimera in the fusion region consisting of amino acid 289 of Syn3 (bold) linked to amino acid 91 of the TfR extracellular domain (underlined) via a serine in position 290 of Syn3.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2.   Immunolocalization of Syn3TfR chimera in Caco-2 cells. Syn3 (A)-, soluble N-ethylmaleimide-sensitive factor attachment protein (SNAP)-23 (B)-, and Syn3TfR (C-H)-transfected Caco-2 cells were grown on coverslips to form a polarized monolayer, processed for immunocytochemistry, and observed by confocal microscopy (z-sections). Syn4 is basolateral and excluded from the apical side of Caco-2 cells, which is enriched in exogenous Syn3 (green and red, respectively, in A). SNAP-23 (red in B) colocalizes with the apical endogenous marker sucrase-isomaltase (SI; green in B) and exhibits a typical basolateral labeling. Syn3TfR labeled with anti-Syn3 (red in C-F) or anti-extracellular domain of TfR (green in F-H) colocalizes with 2 endogenous apical markers, SI and placental alkaline phosphatase (PLAP) (C and H) but is not present on basolateral membrane labeled with anti-525. Bar = 10 µm.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Syn3TfR chimera processing and transport in Caco-2 cells. Caco-2 cells were transfected with Syn3TfR, grown on filters, and processed as described. A: chimera processing. After butyrate induction, cells were pulse-labeled for 20 min and chased for the indicated times. Cell lysates were subjected to Syn3TfR (anti-Syn3) or wild-type TfR (anticytoplasmic domain of TfR) immunoprecipitation, and precipitates were analyzed by SDS-PAGE. Molecular mass marker (left) is 83 kDa, and immature (open circle ) and mature () forms are indicated. Chimera was fully processed compared with wild-type TfR. B: steady-state distribution of Syn3TfR. Cells were biotinylated from the apical (Ap) or basolateral (Bl) side. Cell lysates were precipitated with anti-Syn3 (chimera) or anti-TfR intracellular domain (TfR). Syn3TfR is apically localized at steady state. Molecular mass marker (left) is 83 kDa. C: transport of newly synthesized Syn3TfR and dipeptidyl peptidase IV (DPPIV). Pulse-labeled cells were chased for indicated times and then biotinylated from the apical or basolateral side. Syn3TfR and DPPIV were immunoprecipitated, eluted from beads, and streptavidin precipitated sequentially. Aliquots from the immunoprecipitations (total) and streptavidin precipitations (surface) were analyzed by SDS-PAGE and fluorography. Relative apical () and basolateral () pool is expressed.

Syn3 has been proposed to play a role in apical delivery in MDCK cells, which mostly use the direct apical transport pathway. In Caco-2 cells, which favor the apical indirect pathway, it was of importance to determine the biogenetic pathway taken by Syn3. Because Syn3TfR and endogenous Syn3 had the same localization, we used the chimera to identify the biosynthetic route taken by newly synthesized Syn3, the extracellular domain of TfR being known to carry no crucial sorting information (14, 29). Transfected Caco-2 cells grown on filters were submitted to a short metabolic pulse and then chased for a given time. Cell surface apical or basolateral biotinylation was performed, and the biotinylated 35S-Syn3TfR was recovered and analyzed as described previously (19). A typical experiment is shown in Fig. 3C. Syn3TfR appeared rapidly at the apical surface (half-time of 200 min). Only a small percentage (<5%) of Syn3TfR was detected in the meantime on the basolateral surface, indicating that the chimera most probably used the direct apical pathway as did SI (18, 25). To ensure that expression of Syn3TfR did not induce a change in the biogenetic pathways of apical proteins in Caco-2 cells, we measured in the same cells the kinetics of transport of DPPIV, an apical enzyme that uses both the direct and indirect pathways (7, 25). Indeed, a sizable pool of DPPIV was detected on the basolateral surface (30% after 2 h of chase) with kinetics different from Syn3TfR. Thus transfected Caco-2 cells retained the ability to use the indirect pathway, whereas the chimera used the direct pathway almost exclusively.

Selection and characterization of Caco-2 clones overexpressing Syn3. To test the potential role of Syn3 in direct apical delivery in Caco-2 cells, we chose to overexpress it in these cells because it has been shown for other syntaxins that overexpression inhibits fusion (3, 28, 40). Caco-2 cells were transfected with pIRES1-neo (Clonetech) containing the human cDNA coding for Syn3 (4) and selected using 1 mg/ml of G418. This plasmid allows us to select high-expressing clones via its bicistronic organization. Several clones were obtained and tested for expression of Syn3 compared with control cells transfected with neurotrophin receptor p75 (p75NTR) (Ref. 27). We observed that strong overexpression of Syn3 prevented a normal growth of transfected cells; therefore, we used overnight sodium butyrate induction to stimulate transcription and to select clones that could only express high levels of Syn3 after stimulation. Several clones were selected that grew normally in nonstimulated conditions while expressing high levels of Syn3 after butyrate treatment. Clones Syn3-9, -21, and -33 and control cells expressing p75NTR (75-25) were treated for 16 h with 10 mM of sodium butyrate and tested for expression of Syn3 by Western blotting on a microsomal fraction (Fig. 4A). The extent of Syn3 overexpression over control levels was 10-fold for clone Syn3-21 and 4- to 5-fold for clones Syn3-9 and Syn3-33 after butyrate stimulation. The homogeneity of the Syn3-9, -21 and -33 clones was tested by immunofluorescence using an affinity purified anti-Syn3 antibody. On average, the percentage of cells overexpressing Syn3 was between 50 and 70% (Fig. 4B). To take into account the heterogeneity of Syn3 expression, we calculated the ratio between the level of Syn3 (determined by Western blotting) and the percentage of positive cells (determined by immunofluorescence) with clone 3-21 taken as 1 (Fig. 4C). The percentage of cells expressing SI, an apical differentiation marker, was also quantified; it was 68% in Syn3-21 and 73% in Syn3-33 cells (not shown). These percentages were typical of Caco-2 cells, which always expressed apical markers in a mosaic pattern (2). The polarized distribution of apical and basolateral markers was examined in Syn3-overexpressing clones and control cells using selective surface biotinylation. All clones expressed apical (SI, DPPIV) and basolateral (Ag525) markers in a polarized fashion (not shown), indicating that no important change in the polarity of the clones was provoked by selection.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   Characterization of Caco-2 cells clones overexpressing Syn3. Individual clones of Caco-2 cells transfected with Syn3 were screened and selected for protein expression. A: control Caco-2 cells expressing p75NTR (75-25) and clones overexpressing Syn3 (Syn3-21, Syn3-9, and Syn3-33) were grown for 10 days after confluence and treated with 10 µM sodium butyrate for 16 h. Microsomal fractions were prepared, and 25 µg of protein were analyzed by SDS-PAGE and Western blotting using affinity-purified anti-Syn3 polyclonal antibody. Fluorograms were quantified by densitometry using BioImage IQ software. Quantity of Syn3 is expressed in arbitrary units. B: Caco-2 cell clones grown on coverslips were labeled by indirect immunofluorescence with affinity-purified anti-Syn3 polyclonal antibody. Positive cells in immunofluorescence were counted and expressed as % of total cells counted using phase contrast. C: relative Syn3 level per cell. The amount of Syn3 determined by Western blotting was divided by the % of cells overexpressing Syn3, and the results are expressed in arbitrary units with clone 21 taken as 1.

Cell surface delivery of newly synthesized apical and basolateral markers in cells overexpressing Syn3. To evaluate the impact of Syn3 overexpression on membrane trafficking to the apical or basolateral surfaces, cell surface delivery of an apical and a basolateral marker was studied using a combination of metabolic pulse chase and cell surface biotinylation. Cells grown on filters and treated overnight with butyrate were pulsed for 30 min with [35S]methionine and cysteine, chased for 1 (half-time of basolateral delivery of the Ag525) or 4 (half-time of apical delivery of SI) h, and biotinylated on the basolateral side for Ag525 or the apical side for SI. Four filters were used for each clone, and the amount of newly synthesized surface Ag525 or SI was quantified after immunoprecipitation and streptavidin precipitation followed by SDS-PAGE analysis and fluorography (19). In cells overexpressing Syn3, an inhibition of SI delivery to the apical membrane was observed, with a stronger effect in Syn 3-21 and Syn3-9 cells (Fig. 5A). The level of inhibition was >50% in Syn3-21 and Syn3-9 cells, whereas it was ~15% in Syn3-33 cells. In contrast, no modification of the delivery of Ag525 was detected (Fig. 5B), indicating that overexpression of Syn3 only affected delivery of the apical marker. This inhibition of apical delivery of SI was not caused by missorting, because no increase could be detected in the basolateral delivery of this enzyme in the same cells after 4 h (Fig. 6A). A delay in apical delivery of SI could be explained by a slower processing of the immature enzyme by the Golgi apparatus. To test this hypothesis, we measured the percentage of immature SI (9) after 4 h of chase in control and Syn3-21 cells (Fig. 6B). Processing of SI was similar in both cells, indicating that the delay in apical delivery was not caused by a lack of addition of complex glycans by the Golgi complex.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   A: Syn3 overexpression affects apical delivery of the apical endogenous marker SI. Control (p75-25) and Syn3-overexpressing (Syn3-21, Syn3-9, and Syn3-33) Caco-2 clones were grown on filters and treated with 10 mM sodium butyrate for 16 h. Cells were pulse-labeled for 20 min, and newly synthesized proteins were chased for 4 h. Apical and total SI were determined as indicated in MATERIALS AND METHODS, and apical to total ratio was calculated. Data are means ± SE (n = 4 experiments) and are expressed as % of control cells (75-25).*Significant difference (P < 0.005) from control cells using ANOVA followed by Fisher's protected least significant difference (PLSD) test. B: delivery of basolateral antigen 525 is unaffected by Syn3 overexpression. Pulse-labeled cells on filters as in A were chased for 1 h and biotinylated on the basolateral side. Basolateral to total 525 ratio was determined as in A. Data are means ± SE (n = 4 experiments) and are expressed as % of control cells (75-25). No significant difference was observed compared with control cells.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6.   A: basolateral delivery of SI is unaffected in cells overexpressing Syn3. Different clones of Caco-2 cells (75-25, Syn3-21, and Syn3-33) were grown on filters to allow cells to form a polarized monolayer, sodium butyrate treated, and pulse-labeled for 20 min. Newly synthesized proteins were chased for 4 h and then biotinylated on the basolateral side of the cells. Cell lysates were submitted to SI immunoprecipitation and streptavidin precipitation. Aliquots of total and biotinylated SI were analyzed by SDS-PAGE and fluorography and quantified with BioImage IQ. In each case, basolateral to total SI ratio was determined. Data are means ± SE (n = 4 experiments) and are expressed as % of control cells (75-25). No significant difference was observed on basolateral delivery of SI. B: Syn3 overexpression does not affect SI processing. Control clone (75-25) and clone Syn3-21 of Caco-2 cells were pulse-labeled, and newly synthesized proteins were chased for 4 h. SI was immunoprecipitated and analyzed by SDS-PAGE. Respective quantities for mature (filled bars) and immature (open bars) forms of SI were determined by scanning densitometry and BioImage IQ software. Data are means ± SE (n = 4 experiments) and are expressed as % of total SI. No significant difference was observed between control (75-25) and Syn3-21.

Because SI principally uses the direct pathway (18), it was important to confirm the effect of overexpression of Syn3 on this pathway. We followed the secretion of alpha -glucosidase, an enzyme that is apically secreted in Caco-2 cells (13). Cells grown on filters and treated overnight with butyrate were pulsed for 30 min with [35S]methionine and cysteine and chased for 4 h. alpha -Glucosidase was precipitated from the apical medium and analyzed by SDS-PAGE and fluorography. A strong inhibition of alpha -glucosidase secretion was observed in Syn3-21 and Syn3-9 cells (80%), whereas only a small effect could be observed in Syn3-33 cells (Fig. 7), indicating that the inhibition of SI and alpha -glucosidase apical delivery might be dose dependent. In fact, when the relative quantity of Syn3 per cell was calculated in each clone, clone 33 showed the lowest value, suggesting that the threshold for a dominant negative effect was close to that level. To rule out a possible mutation that might have invalidated Syn3 function after clonal selection, we checked the Syn3 sequence in clone 33 by amplification of the transgene by RT-PCR. Two cDNA clones were sequenced, and neither of them exhibited a mutation, confirming the hypothesis that the weaker inhibition of apical delivery might be caused by lower levels of expression. These data also suggest that correct levels of Syn3 could be necessary for proper protein delivery to the apical membrane of intestinal cells.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of Syn3 overexpression on alpha -glucosidase apical secretion. Control (75-25) and Syn3-overexpressing (Syn3-21, Syn3-9, and Syn3-33) Caco-2 clones were grown on filters to form polarized monolayers and treated with 10 mM sodium butyrate for 16 h. Cells were pulse-labeled for 20 min, and newly synthesized proteins were chased for 4 h. alpha -Glucosidase immunoprecipitation was performed on the apical medium and cell extracts. Immunoprecipitates were analyzed by SDS-PAGE and quantified as described in Fig. 6. Data are means ± SE (n = 4 experiments) and are expressed as % of control cells (75-25). *Significant difference (P < 0.005) from control cells using ANOVA followed by Fisher's PLSD test.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Expression and transport of Syn3TfR. We have designed a chimera comprising the entire coding sequence of Syn3 and the extracellular domain of TfR. We chose this receptor because its extracellular domain has already been used as a reporter in polarity studies, because it does not appear to contain strong sorting information (14, 29). In the case of our chimera, this seems to be true, because we could not detect any difference in subcellular localization between Syn3 (endogenous or transfected) and Syn3TfR. Syn3TfR was localized at the apical membrane by using antibodies recognizing either the Syn3 part or the extracellular domain of TfR. As expected, antibodies against the intracellular domain of TfR did not label the apical membrane. The chimera was transported along the Golgi apparatus and processed as the endogenous TfR, because we could observe a shift in mobility during maturation. Finally, it reached the apical membrane mainly using the direct apical pathway, because very little of the chimera population was detected even transiently on the basolateral membrane whereas the endogenous apical protein DPPIV, using the indirect pathway, was easily detected on the same membrane in the meantime. It is likely that the transport pattern of the chimera reflects the actual transport of endogenous Syn3, because most apical proteins in Caco-2 cells follow the indirect pathway (18, 25) and thus entry in the direct pathway was likely to be driven by the Syn3 part of the chimera. In terms of the regulation of Syn3 activity, the use of the direct pathway could be important because we have shown that Syn3 is complexed to another t-SNARE, SNAP-23, on the apical membrane. SNAP-23 is also present on the basolateral membrane in Caco-2 cells (Fig. 2B), where it is complexed to Syn4 (not shown) also expressed on that membrane (Fig. 2A). Thus a transient expression of Syn3 on the basolateral membrane could induce the formation of potentially active complexes and provoke unwanted membrane delivery. This work is the first description of the intracellular transport of a polarized t-SNARE in epithelial cells. It is striking that Syn3 is not always expressed at the apical membrane of epithelial cells. In particular, it has been reported to localize at the basolateral membrane of renal intercalated cells (24) but to be apical in kidney-derived MDCK cells (21). These data raise the possibility that syntaxins may control the expression of a subset of plasma membrane proteins with a tight physiological regulation of their polarized expression in a tissue-specific manner. In our case, we showed that Syn3 is localized apically both in Caco-2 and in normal colonic cells in vivo (4).

Effects of Syn3 overexpression. To study the potential role of Syn3 in intestinal cells, we have transfected it in Caco-2 cells and selected clones that overexpress it after butyrate treatment. To overcome the possible additional effects of selection and butyrate treatment, as a control we used a clone transfected with wild-type p75NTR, an apical protein, as previously described (27). Control cells were kept under the same conditions and treated during experiments like the clones overexpressing Syn3. Three different clones with various levels of expression were selected and tested for transport of one basolateral and two apical markers. We found that overexpression of Syn3 did not significantly alter delivery of Ag525 to the basolateral surface, indicating that the basolateral pathway was not dependent on the level of Syn3 present in the cells. Accordingly, overexpression of Syn3 also had no effect on the basolateral transport of the polymeric immunoglobulin receptor, confirming that in epithelial cells Syn3 is probably not involved in this pathway (22).

Overexpression of Syn3, on the other hand, caused a specific inhibition of apical delivery of a transmembrane protein, SI, and a secreted protein, alpha -glucosidase. Apical delivery of both proteins was significantly reduced in clones 9 and 21, whereas the effect was much more reduced in clone 33, suggesting a dose-dependent effect. This could be explained by a higher ratio (0.54 vs. 0.47) of the amount of Syn3 and the percentage of cells expressing it in clone 9 vs. clone 33 or by a different balance between putative partners of Syn3 in clone 33. In clone 21, both the level of Syn3 and the percentage of overexpressing cells were higher than in clone 33. We have ruled out a possible mutation of Syn3 leading to a deficient protein in clone 33. Our efforts to obtain clones either expressing more Syn3 or exhibiting a higher percentage of overexpressing cells failed, probably because their normal growth was impaired above a certain level of expression. It is likely that in each cloned population, transport of SI to the apical surface was even more inhibited in cells overexpressing Syn3 than the average numbers (50% of inhibition) found in Fig. 5A. Conversely, in the same population, cells with normal levels of Syn3 were likely to show no effect, reducing the overall measured effect. Our assay measured cell surface delivery as an average for the population tested with a balance between normal and overexpressing cells. Apical markers most probably were transported in these cells with much slower kinetics rather than being accumulated intracellularly, because we never observed a strong accumulation of SI, for example, inside the cells (not shown).

The delay we observed in the apical delivery of both SI and alpha -glucosidase was not caused by a change in the kinetics of processing by the Golgi enzymes, because there was no significant difference of the percentage of endoglycosidase H-resistant SI between control and clone 21 cells after 4 h of chase. Reduced apical delivery of SI was also not caused by missorting of this protein to the basolateral membrane, because there was no significant increase of basolateral newly synthesized SI after 4 h of chase. Therefore, inhibition of apical transport in cells overexpressing Syn3 is most probably a post-Golgi event. The question remains as to whether Syn3 is involved in the targeting or in the fusion of apical transport vesicles. Both SI and alpha -glucosidase use the direct apical transport route, and thus we postulate that Syn3 is a key component regulating this pathway, as also suggested by Low et al. (22). The implication of Syn3 in the indirect (or transcytotic) pathway remains to be investigated in intestinal cells, even though it was shown by the same authors that in MDCK cells the overexpression of Syn3 did not affect this pathway. The mechanism by which this inhibition is mediated is not clear, but similar effects have been observed previously in other systems. For example, in Drosophila the overexpression of Syn1 provoked a specific inhibition of synaptic vesicle fusion (40), whereas in pancreatic island cells, overexpression of Syn1A inhibited glucose-stimulated insulin secretion (28). Even in constitutive transport, such as endoplasmic reticulum to Golgi transport, overexpression of Syn5 caused an inhibition (3). In these studies, the effect was restricted to one transport pathway. This inhibitory effect of overexpression of Syn3 could be mediated by association with munc 18-2, which is also enriched in the apical membrane of Caco-2 cells (31), preventing the recycling of SNARE complexes at the apical membrane after their participation in a fusion event. Any change in the balance of apical SNAREs in epithelial cells might lead to a perturbation in the efficiency of the vesicular targeting or fusion.

After some debate (12, 22), it now appears that in MDCK cells the apical pathway also relies on Syn3/SNAP-23 (16, 22), indicating that it might be a common feature for apical transport in epithelial cells. The results presented here strongly suggest that the direct apical pathway involves the SNARE machinery to operate in Caco-2 cells, establishing that this pathway is of the same nature as in MDCK cells even if the two cell lines show different behaviors in sorting and delivery of apical proteins.


    ACKNOWLEDGEMENTS

We thank C. Moretti for help with the confocal microscope, A. Quaroni for providing monoclonal antibodies against SI, and J.-P. Arsanto for electron microscopy and critical reading of the manuscript.


    FOOTNOTES

This work was supported by a fellowship from the Ministry of Education and La Ligue Nationale contre le Cancer (L. Breuza) and by Centre National de la Recherche Scientifique UMR 6545, Université de la Méditerranée, Institut de Biologie du Développement de Marseille, Association pour la recherche sur le Cancer 9297, Association Française de lutte contre la Mucoviscidose, and Mizutani Foundation (A. Le Bivic).

Address for reprint requests and other correspondence: A. Le Bivic, Laboratoire de Génétique et Physiologie du Développement, IBDM, CNRS/INSERM, Univ. de la Méditerranée, AP de Marseille, Parc Scientifique de Luminy, Case 907, 13288 Marseille cedex 09, France (E-mail: lebivic{at}ibdm.univ-mrs.fr).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 1 December 1999; accepted in final form 15 May 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Bartles, JR, Feracci HM, Stieger B, and Hubbard AL. Biogenesis of the rat hepatocyte plasma membrane in vivo: comparison of the pathways taken by apical and basolateral proteins using subcellular fractionation. J Cell Biol 105: 1241-1251, 1987[Abstract/Free Full Text].

2.  Chantret I, Rodolosse A, Barbat A, Dussaulx E, Brot LE, Zweibaum A, and Rousset M. Differential expression of sucrase-isomaltase in clones isolated from early and late passages of the cell line Caco-2: evidence for glucose-dependent negative regulation. J Cell Sci : 213-225, 1994.

3.   Dascher, C, Matteson J, and Balch WE. Syntaxin 5 regulates endoplasmic reticulum to Golgi transport. J Biol Chem 269: 29363-29366, 1994[Abstract/Free Full Text].

4.   Delgrossi, MH, Breuza L, Mirre C, Chavrier P, and Le Bivic A. Human syntaxin 3 is localized apically in human intestinal cells. J Cell Sci 110: 2207-2214, 1997[Abstract].

5.   Garcia, EP, Gatti E, Butler M, Burton J, and De Camilli P. A rat brain Sec1 homologue related to Rop and UNC18 interacts with syntaxin. Proc Natl Acad Sci USA 91: 2003-2007, 1994[Abstract/Free Full Text].

6.  Garcia M, Mirre C, Quaroni A, Reggio H, and Le Bivic A. GPI-anchored proteins associate to form microdomains during their intracellular transport in Caco-2 cells. J Cell Sci : 1281-1290, 1993.

7.   Gilbert, T, Le Bivic A, Quaroni A, and Rodriguez-Boulan E. Microtubular organization and its involvement in the biogenetic pathways of plasma membrane proteins in Caco-2 intestinal epithelial cells. J Cell Biol 113: 275-288, 1991[Abstract/Free Full Text].

8.   Grindstaff, KK, Yeaman C, Anandasabapathy N, Hsu SC, Rodriguez-Boulan E, Scheller RH, and Nelson WJ. Sec6/8 complex is recruited to cell-cell contacts and specifies transport vesicle delivery to the basal-lateral membrane in epithelial cells. Cell 93: 731-740, 1998[Web of Science][Medline].

9.   Hauri, HP, Quaroni A, and Isselbacher KJ. Monoclonal antibodies to sucrase/isomaltase: probes for the study of postnatal development and biogenesis of the intestinal microvillus membrane. Proc Natl Acad Sci USA 77: 6629-6633, 1980[Abstract/Free Full Text].

10.   Hay, JC, and Scheller RH. SNAREs and NSF in targeted membrane fusion. Curr Opin Cell Biol 9: 505-512, 1997[Web of Science][Medline].

11.   Huber, LA, Pimplikar S, Parton RG, Virta H, Zerial M, and Simons K. Rab8, a small GTPase involved in vesicular traffic between the TGN and the basolateral plasma membrane. J Cell Biol 123: 35-45, 1993[Abstract/Free Full Text].

12.   Ikonen, E, Tagaya M, Ullrich O, Montecucco C, and Simons K. Different requirements for NSF, SNAP, and Rab proteins in apical and basolateral transport in MDCK cells. Cell 81: 571-580, 1995[Web of Science][Medline].

13.   Klumperman, J, Fransen JA, Boekestijn TC, Oude Elferink RP, Matter K, Hauri HP, Tager JM, and Ginsel LA. Biosynthesis and transport of lysosomal alpha-glucosidase in the human colon carcinoma cell line Caco-2: secretion from the apical surface. J Cell Sci 100: 339-347, 1991[Abstract/Free Full Text].

14.   Kundu, A, Avalos RT, Sanderson CM, and Nayak DP. Transmembrane domain of influenza virus neuraminidase, a type II protein, possesses an apical sorting signal in polarized MDCK cells. J Virol 70: 6508-6515, 1996[Abstract].

15.   Lafont, F, Lecat S, Verkade P, and Simons K. Annexin XIIIb associates with lipid microdomains to function in apical delivery. J Cell Biol 142: 1413-1427, 1998[Abstract/Free Full Text].

16.   Lafont, F, Verkade P, Galli T, Wimmer C, Louvard D, and Simons K. Raft association of SNAP receptors acting in apical trafficking in Madin-Darby canine kidney cells. Proc Natl Acad Sci USA 96: 3734-3738, 1999[Abstract/Free Full Text].

17.   Le Bivic, A, Bosc-Biern I, and Reggio H. Characterization of a glycoprotein expressed on the basolateral membrane of human intestinal epithelial cells and cultured colonic cell lines. Eur J Cell Biol 46: 113-120, 1988[Web of Science][Medline].

18.   Le Bivic, A, Quaroni A, Nichols B, and Rodriguez-Boulan E. Biogenetic pathways of plasma membrane proteins in Caco-2, a human intestinal epithelial cell line. J Cell Biol 111: 1351-1361, 1990[Abstract/Free Full Text].

19.   Le Bivic, A, Real FX, and Rodriguez-Boulan E. Vectorial targeting of apical and basolateral plasma membrane proteins in a human adenocarcinoma epithelial cell line. Proc Natl Acad Sci USA 86: 9313-9317, 1989[Abstract/Free Full Text].

20.   Lisanti, MP, Le Bivic A, Sargiacomo M, and Rodriguez-Boulan E. Steady-state distribution and biogenesis of endogenous Madin-Darby canine kidney glycoproteins: evidence for intracellular sorting and polarized cell surface delivery. J Cell Biol 109: 2117-2127, 1989[Abstract/Free Full Text].

21.   Low, SH, Chapin SJ, Weimbs T, Komuves LG, Bennett MK, and Mostov KE. Differential localization of syntaxin isoforms in polarized Madin-Darby canine kidney cells. Mol Biol Cell 7: 2007-2018, 1996[Abstract].

22.   Low, SH, Chapin SJ, Wimmer C, Whiteheart SW, Komuves LG, Mostov KE, and Weimbs T. The SNARE machinery is involved in apical plasma membrane trafficking in MDCK cells. J Cell Biol 141: 1503-1513, 1998[Abstract/Free Full Text].

23.   Low, SH, Roche PA, Anderson HA, van Ijzendoorn SC, Zhang M, Mostov KE, and Weimbs T. Targeting of SNAP-23 and SNAP-25 in polarized epithelial cells. J Biol Chem 273: 3422-3430, 1998[Abstract/Free Full Text].

24.   Mandon, B, Nielsen S, Kishore BK, and Knepper MA. Expression of syntaxins in rat kidney. Am J Physiol Renal Physiol 273: F718-F730, 1997.

25.   Matter, K, Brauchbar M, Bucher K, and Hauri HP. Sorting of endogenous plasma membrane proteins occurs from two sites in cultured human intestinal epithelial cells (Caco-2). Cell 60: 429-437, 1990[Web of Science][Medline].

26.   Matter, K, and Mellman I. Mechanisms of cell polarity: sorting and transport in epithelial cells. Curr Opin Cell Biol 6: 545-554, 1994[Web of Science][Medline].

27.   Monlauzeur, L, Breuza L, and Le Bivic A. Putative O-glycosylation sites and a membrane anchor are necessary for apical delivery of the human neurotrophin receptor in Caco-2 cells. J Biol Chem 273: 30263-30270, 1998[Abstract/Free Full Text].

28.   Nagamatsu, S, Fujiwara T, Nakamichi Y, Watanabe T, Katahira H, Sawa H, and Akagawa K. Expression and functional role of syntaxin 1/HPC-1 in pancreatic beta cells. Syntaxin 1A, but not 1B, plays a negative role in regulatory insulin release pathway. J Biol Chem 271: 1160-1155, 1996[Abstract/Free Full Text].

29.   Odorizzi, G, and Trowbridge IS. Structural requirements for basolateral sorting of the human transferrin receptor in the biosynthetic and endocytic pathways of Madin-Darby canine kidney cells. J Cell Biol 137: 1255-1264, 1997[Abstract/Free Full Text].

30.   Owen, D, and Kuhn LC. Noncoding 3' sequences of the transferrin receptor gene are required for mRNA regulation by iron. EMBO J 6: 1287-1293, 1987[Web of Science][Medline].

31.  Riento K, Galli T, Jansson S, Ehnholm C, Lehtonen E, and Olkkonen VM. Interaction of Munc-18-2 with syntaxin 3 controls the association of apical SNAREs in epithelial cells. J Cell Sci : 2681-2688, 1998.

32.   Rothman, JE, and Warren G. Implications of the SNARE hypothesis for intracellular membrane topology and dynamics. Curr Biol 4: 220-233, 1994[Web of Science][Medline].

33.   Rothman, JE, and Wieland FT. Protein sorting by transport vesicles. Science 272: 227-234, 1996[Abstract].

34.   Sargiacomo, M, Lisanti M, Graeve L, Le Bivic A, and Rodriguez-Boulan E. Integral and peripheral protein composition of the apical and basolateral membrane domains in MDCK cells. J Membr Biol 107: 277-286, 1989[Web of Science][Medline].

35.   Sogaard, M, Tani K, Ye RR, Geromanos S, Tempst P, Kirchhausen T, Rothman JE, and Sollner T. A rab protein is required for the assembly of SNARE complexes in the docking of transport vesicles. Cell 78: 937-948, 1994[Web of Science][Medline].

36.   Sollner, T, Bennett MK, Whiteheart SW, Scheller RH, and Rothman JE. A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75: 409-418, 1993[Web of Science][Medline].

37.   Sollner, T, Whiteheart SW, Brunner M, Erdjument BH, Geromanos S, Tempst P, and Rothman JE. SNAP receptors implicated in vesicle targeting and fusion. Nature 362: 318-324, 1993[Medline].

38.   Sudhof, TC. The synaptic vesicle cycle: a cascade of protein-protein interactions. Nature 375: 645-653, 1995[Medline].

39.   Weber, T, Zemelman BV, McNew JA, Westermann B, Gmachl M, Parlati F, Sollner TH, and Rothman JE. SNAREpins: minimal machinery for membrane fusion. Cell 92: 759-772, 1998[Web of Science][Medline].

40.   Wu, MN, Littleton JT, Bhat MA, Prokop A, and Bellen HJ. ROP, the Drosophila Sec1 homolog, interacts with syntaxin and regulates neurotransmitter release in a dosage-dependent manner. EMBO J 17: 127-139, 1998[Web of Science][Medline].

41.   Yeaman, C, Grindstaff KK, and Nelson WJ. New perspectives on mechanisms involved in generating epithelial cell polarity. Physiol Rev 79: 73-98, 1999[Abstract/Free Full Text].

42.   Zurzolo, C, Le Bivic A, Quaroni A, Nitsch L, and Rodriguez-Boulan E. Modulation of transcytotic and direct targeting pathways in a polarized thyroid cell line. EMBO J 11: 2337-2344, 1992[Web of Science][Medline].


Am J Physiol Cell Physiol 279(4):C1239-C1248
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
T. Pocard, A. Le Bivic, T. Galli, and C. Zurzolo
Distinct v-SNAREs regulate direct and indirect apical delivery in polarized epithelial cells
J. Cell Sci., September 15, 2007; 120(18): 3309 - 3320.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Suzuki, H. Ohnishi, A. Wada, T. Hirayama, H. Ohno, N. Ueda, H. Yasuda, T. Iiri, Y. Wada, M. Futai, et al.
Involvement of Syntaxin 7 in Human Gastric Epithelial Cell Vacuolation Induced by the Helicobacter pylori-produced Cytotoxin VacA
J. Biol. Chem., July 3, 2003; 278(28): 25585 - 25590.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. L. TUMA and A. L. HUBBARD
Transcytosis: Crossing Cellular Barriers
Physiol Rev, July 1, 2003; 83(3): 871 - 932.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Kauppi, G. Wohlfahrt, and V. M. Olkkonen
Analysis of the Munc18b-Syntaxin Binding Interface. USE OF A MUTANT Munc18b TO DISSECT THE FUNCTIONS OF SYNTAXINS 2 AND 3
J. Biol. Chem., November 8, 2002; 277(46): 43973 - 43979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Li, S. H. Low, M. Miura, and T. Weimbs
SNARE expression and localization in renal epithelial cells suggest mechanism for variability of trafficking phenotypes
Am J Physiol Renal Physiol, November 1, 2002; 283(5): F1111 - F1122.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Lemmers, E. Medina, M.-H. Delgrossi, D. Michel, J.-P. Arsanto, and A. Le Bivic
hINADl/PATJ, a Homolog of Discs Lost, Interacts with Crumbs and Localizes to Tight Junctions in Human Epithelial Cells
J. Biol. Chem., July 5, 2002; 277(28): 25408 - 25415.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Breuza, L.
Right arrow Articles by Le Bivic, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Breuza, L.
Right arrow Articles by Le Bivic, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online