|
|
||||||||
1 Laboratoire de Génétique et Physiologie du Développement, Institut de Biologie du Développement de Marseille, Centre National de la Recherche Scientifique, Institut National de la Santé et de la Recherche Médicale, Université de la Méditerranée, Assistance Publique de Marseille, 13288 Marseille cedex 09, France; and 2 Department of Cell Biology and Histology, University of Nijmegen, 6500 HB Nijmegen, The Netherlands
| |
ABSTRACT |
|---|
|
|
|---|
To follow the transport of human syntaxin (Syn) 3 to the
apical surface of intestinal cells, we produced and expressed in Caco-2
cells a chimera made of the entire Syn3 coding sequence and the
extracellular domain of the human transferrin receptor (TfR). This
chimera (Syn3TfR) was localized to the apical membrane and was
transported along the direct apical pathway, suggesting that this is
also the case for endogenous Syn3. To test the potential role of Syn3
in apical transport, we overexpressed it in Caco-2 cells and measured
the efficiency of apical and basolateral delivery of several endogenous
markers. We observed a strong inhibition of apical delivery of
sucrase-isomaltase (SI), an apical transmembrane protein, and of
-glucosidase, an apically secreted protein. No effect was observed
on the basolateral delivery of Ag525, a basolateral antigen, strongly
suggesting that Syn3 is necessary for efficient delivery of proteins to
the apical surface of intestinal cells.
apical transport; soluble N-ethylmaleimide-sensitive factor attachment protein receptors; Caco-2 cells
| |
INTRODUCTION |
|---|
|
|
|---|
THE PLASMA MEMBRANE of epithelial cells is divided into specialized subdomains such as the apical (or luminal) domain, which faces the external medium, and the basolateral domain, which mediates contact with the surrounding cells and the basement membrane. These plasma membrane domains have different lipid and protein compositions, and their specific organization is a prerequisite for their physiological functions (for a recent review, see Ref. 41). How plasma membrane proteins are transported to their final site after biosynthesis has been investigated in several different epithelial models in the last decade (for review, see Ref. 26). Some epithelial cells such as Madin-Darby canine kidney (MDCK; Ref. 20) and Fisher rat thyroid (Ref. 42) cells favor a direct transport of apical and basolateral proteins to their respective membranes after exit from the Golgi complex. On the other hand, epithelial cells from the digestive tract such as hepatocytes (1) or enterocytes (18, 25) tend to transport apical proteins via an indirect pathway that includes a transcytotic step from the basolateral to the apical membrane. As yet, there is no mechanistic explanation for this major difference between epithelial cells.
At least two sorting steps are involved in the transport of plasma
membrane proteins from the Golgi complex. The first step is the
recognition of apical and basolateral proteins through intrinsic
sorting signals and their packaging into distinct transport vesicles.
The second step of sorting involves specific recognition between
transport vesicles and their target domain in the plasma membrane. This
specific fusion event could be accomplished through the specific
pairing of soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins located on the vesicle (v-SNAREs) and SNARE proteins located on the target membrane (t-SNAREs) (32, 37). SNARE complexes are supposed to participate in
the fusion event and in the specificity of the membrane fusion
(33, 38, 39). Besides SNAREs, several other proteins are
involved in the regulation of membrane trafficking and fusion. Among
them are N-ethylmaleimide-sensitive factor (NSF),
-soluble NSF attachment protein (
-SNAP), Sec1, and rab proteins
(5, 10, 35).
Targeting of transport vesicles to apical or basolateral membranes is
likely to use the same mechanisms as other transport steps, and,
indeed, several t-SNAREs have been localized to the plasma membrane of
epithelial cells. Syntaxins (Syn)2, -3, and -4 are expressed in
epithelial cells, and, although Syn2 is not polarized in MDCK cells,
Syn3 is found apically in both MDCK (21) and Caco-2 cells
(4) and Syn4 is found basolaterally in MDCK cells
(21). Syntaxins form a SNARE complex with proteins of the
SNAP-25 family (36), and it has been shown that SNAP-23 (a
SNAP-25 homologue) is localized on both membranes in MDCK cells (23), suggesting that SNAP-23 may form complexes with Syn3
and Syn4. Despite the accumulation of data on a potential SNARE
machinery at the apical membrane, it has been suggested that apical
transport does not rely on this machinery in permeabilized MDCK cells
but uses another mechanism (12) in which annexin XIIIb
appears to be a crucial component (15). On the other hand,
basolateral transport is NSF dependent and utilizes rab 8 (11),
-SNAP (12), SNAP-23
(22), and the sec6/8 complex also found in yeast and in
neurons (8). The finding that transport to apical membrane was SNARE independent was recently challenged by a study on the role of
components of the SNARE fusion machinery in the same MDCK cells;
overexpression of rat Syn3 in these cells caused an inhibition of
trans-Golgi network (TGN)-to-apical transport and of apical recycling (22). Furthermore, toxin E from
Clostridium botulinum (which cleaves SNAP-23) and antibodies
against
-SNAP were able to inhibit both TGN-to-apical and
basolateral transport in permeabilized MDCK cells, suggesting that the
SNARE machinery is indeed involved in apical transport. Both groups
(12, 22), however, found no involvement of
NSF in direct apical transport, indicating that this process is NSF
independent. Recently, Lafont et al. (16) found
that Syn3 and SNAP-23 were involved in apical transport in MDCK cells
together with a v-SNARE called Ti-VAMP. These conflicting results
demonstrate that more work needs to be done on the role of SNARE
components in apical fusion. Caco-2 cells provide a good epithelial
model to test the role of potential elements of the sorting and
transport machineries to the apical membrane.
To identify the biosynthetic pathway followed by Syn3 in intestinal
cells, we have produced a chimera (Syn3TfR) with this protein and the
extracellular domain of the human TfR. This chimera was localized at
the apical membrane of Caco-2 cells like endogenous Syn3, indicating
that the chimera could be used to follow the biogenetic pathways of
Syn3. Using a combination of metabolic pulse chase and selective
surface biotinylation, we showed that Syn3TfR was mainly transported
along the direct pathway to the apical surface, most likely to prevent
formation of basolateral complexes and unwanted fusion events. When
Syn3 was overexpressed in Caco-2 cells, we observed a reduced delivery
of two apical markers following the direct apical pathway, i.e.,
sucrase-isomaltase (SI) and
-glucosidase. No effect could be
detected on the delivery of a basolateral marker. This is the first
report of the transport and potential function of a t-SNARE in
polarized human intestinal cells.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents and antibodies.
Sulfo NHS-SS biotin, sulfo-NHS-LC biotin, and immobilized streptavidin
were purchased from Pierce Chemical (Rockford, IL); protein A-Sepharose
was from Pharmacia (Uppsala, Sweden). Monoclonal antibodies against SI
and dipeptidyl peptidase IV (DPPIV) were from Dr. A. Quaroni (Ithaca,
NY), and the monoclonal antibody against Ag525 had been characterized
previously (17). Polyclonal anti-placental alkaline
phosphatase (PLAP) was from Accurate Chemical and Scientific (Westbury,
NY). The monoclonal antibody against the extracellular domain
of TfR was from Roche Diagnostics (Meylan, France), and the monoclonal
antibody against the cytoplasmic domain was provided by Dr. I. Trowbridge (La Jolla, CA). The polyclonal antibody against SNAP-23 was
produced as described for anti-Syn3 (4) by injecting
purified histidine (His)-tagged full-length SNAP-23 into a rabbit (20 µg/boost, 1 boost every 3 wk). His-tagged SNAP-23 was also coupled to
CNBr-activated Sepharose beads to purify polyclonal antibodies raised
against SNAP-23. Monoclonal anti-syntaxin 4 (S40220) was purchased from
Transduction Laboratories (Lexington, KY). Anti-
-glucosidase (118G3)
was described previously (13).
Constructs, cell culture, and transfection.
Human Syn3 full-length cDNA (U32315) was subcloned in bicistronic
pIRES1-neo (Clontech Laboratories, Palo Alto, CA) and resequenced
entirely. A human Syn3TfR chimera was obtained by PCR using human Syn3
cDNA and human TfR as template (30). Two sets of primers
were designed: 5'GCGGCCGCATGAAGGACCGTCGGAGCAG3' and
5'AGAATTCAGGCCAACGGAAAGTCCAAT3' for Syn3 and 5'GAATTCA
GGGGTAGAACCAAAAACTGA3' and 5'GGATCCTTAAAACTCATTGTC AATGTC3' for TfR.
EcoR I restriction sites in 3' and 5' ends of Syn3 and TfR,
respectively, allowed us to fuse in frame Syn3 and TfR cDNA, replacing
the stop codon of Syn3 by a TCA codon encoding a serine. Chimeric cDNA
was subcloned in pIRES1-neo. SNAP-23 cDNA was isolated by PCR on a
sample of human intestine cDNA library in
gt11 (Clontech) using two
designed primers, 5'GAATTCATGGATAATCTGTCATCA3' and 5'TCTAGATTAGCTAATGA GTTT3'. PCR products were subcloned in pIRES1-neo, and one clone was
entirely sequenced. His-tagged SNAP-23 was obtained by subcloning the
cDNA in pQE-30 vector from Qiagen (Chatsworth, CA) and expressing it in
M15 Escherichia coli according to the manufacturer's
instructions. Caco-2 cells were from Dr. A. Zweibaum (Villejuif,
France) and were grown as previously described (6) with
neomycin (0.25 mg/ml) when transfected. Caco-2 cells were transfected
using lipofectamine (GIBCO, Grand Island, NY), and positive clones were
isolated using 1 mg/ml G418 and tested for Syn3 expression by
immunofluorescence after sodium butyrate induction (10 mM, 16 h).
The sequence of Syn3 in clone 33 was determined by RT-PCR using a
Superscript kit (GIBCO), a high-fidelity PCR kit (Roche Diagnostics),
and primers located 5' and 3' in the expression vector pIRES. All clones were tested for correct polarization of endogenous markers by
selective surface biotinylation (34). Using the same
experiments, we determined the polarity of the Syn3TfR chimera.
Immunofluorescence and confocal microscopy.
Cells were grown on glass coverslips and processed as described
previously (19). For Syn4, methanol fixation was performed by placing coverslips in pure methanol at
20°C for 3 min and in PBS
containing Ca2+ and Mg2+ for rehydration.
Confocal microscopy analysis was performed using Zeiss confocal
microscope (LSM 410 invert).
Pulse-chase and transport assays. Cells were grown on Transwells (Costar Data Packaging, Cambridge, MA) to confluence and processed 10-15 days later. Filters were incubated for 20 min in DMEM without methionine and cysteine and for 30 min in the same medium supplemented with radiolabeled [35S]methionine and cysteine [Redivue Promix (35S) cell, Amersham]. Newly synthesized proteins were chased for 0.5-8 (chimera targeting), 1 (basolateral antigens), or 4 (apical antigens) h in the presence of a 100-fold excess of cold methionine and cysteine. After three washes in ice-cold PBS containing Ca2+ and Mg2+, cells were biotinylated from the apical or basolateral side. After cell lysis, antigens were immunoprecipitated, eluted from beads, and 1/10 analyzed by SDS-PAGE (total fraction). The surface fraction of the antigen was recovered by streptavidin immunopurification from the eluate and quantified by SDS-PAGE, autoradiography, and BioImage Quantifier software (BioImage, Ann Arbor, MI) analysis. The surface appearance of the chimera on both domains of the cells was expressed as the percentage of the amount at the time of maximal expression at the cell surface. The percentage of apical or basolateral SI was expressed as the ratio of surface to total antigen. From the same experiments, autoradiographic analysis with Bio Image IQ allowed us to calculate the percentage of mature and immature SI. Chimera-processing experiments were carried out as described above. Pulse-chased cells (0-180 min) were lysed, and newly synthesized proteins were precipitated with anti-Syn3 or anti-TfR. Immunoprecipitates were analyzed by SDS-PAGE.
For
-glucosidase secretion, cells were processed as described for
apical delivery of SI. Apical medium was harvested, cells were lysed,
and both medium and cells were submitted to immunoprecipitation in 1%
Triton X-100 with monoclonal anti-
-glucosidase. Antigens were eluted
from beads, and an aliquot was analyzed by SDS-PAGE and
autoradiography.
-Glucosidase was quantified using BioImage Quantifier software. The percentage of secreted
-glucosidase was
expressed as the ratio of secreted to total antigen.
| |
RESULTS |
|---|
|
|
|---|
Localization and transport of Syn3TfR chimera in Caco-2 cells.
To follow the intracellular transport of Syn3 after biosynthesis, we
designed a chimera comprising the entire sequence of human Syn3
(4) linked to the extracellular domain of the human TfR
(Fig. 1). This construct allowed us to
use the selective surface biotinylation technique developed previously
(19). This chimera, Syn3TfR, was expressed into Caco-2
cells by stable transfection, and several clones were selected for
chimera expression by immunofluorescence using anti-Syn3 antibodies.
Because endogenous Syn3 gave a weak signal with this antibody,
expression of the chimera could be detected easily over the background.
Localization of Syn3TfR was performed by double labeling with apical
and basolateral markers in transfected cells and confocal microscopy
analysis (Fig. 2). Syn3TfR labeled with
anti-Syn3 antibody colocalized with SI (Fig. 2C), suggesting
that it behaved like endogenous Syn3, which we localized at the apical
membrane in a previous study (4). As for transfected Syn3
(Fig. 2A), we could observe some subapical staining in
Syn3TfR-transfected cells. To ascertain whether the apical labeling
observed with the antibodies against Syn3 was indeed caused by the
chimera, we used a monoclonal antibody directed against the
extracellular domain of TfR to label transfected cells. Again, a strong
labeling of the apical membrane could be observed over the normal
basolateral and intracellular staining usually found for the endogenous
TfR. This labeling colocalized with the staining obtained with
polyclonal antibodies against Syn3 or PLAP, an apical marker (Fig. 2,
F and H, respectively). Conversely, with a
monoclonal antibody against the cytoplasmic domain of TfR, no apical
staining and no colocalization with Syn3 or PLAP was observed in
transfected cells (Fig. 2, E and G), indicating
that the chimera was most likely to be the protein responsible for the
apical staining. This surface localization was confirmed biochemically using the selective surface labeling with sulfo-NHS-biotin followed by
immunoprecipitation and peroxidase-coupled streptavidin blotting. Surface Syn3TfR was concentrated at the apical membrane (>95%; Fig.
3B), whereas endogenous TfR
(84 kDa) was mainly found at the basolateral membrane (>80%). The
apparent molecular mass of the chimera was 120 kDa, in good agreement
with the calculated mass of 105 kDa. Because TfR contains
complex N-glycans, we followed the maturation of the chimera
to make sure that it was correctly processed. Both TfR and the chimera
showed a concomitant increase in apparent molecular mass during a chase
after a short metabolic pulse, indicating that this was indeed the
case.
|
|
|
Selection and characterization of Caco-2 clones overexpressing
Syn3.
To test the potential role of Syn3 in direct apical delivery in Caco-2
cells, we chose to overexpress it in these cells because it has been
shown for other syntaxins that overexpression inhibits fusion (3,
28, 40). Caco-2 cells were transfected with pIRES1-neo
(Clonetech) containing the human cDNA coding for Syn3 (4)
and selected using 1 mg/ml of G418. This plasmid allows us to select
high-expressing clones via its bicistronic organization. Several clones
were obtained and tested for expression of Syn3 compared with control
cells transfected with neurotrophin receptor p75 (p75NTR)
(Ref. 27). We observed that strong overexpression of Syn3 prevented a
normal growth of transfected cells; therefore, we used overnight sodium
butyrate induction to stimulate transcription and to select clones that
could only express high levels of Syn3 after stimulation. Several
clones were selected that grew normally in nonstimulated conditions
while expressing high levels of Syn3 after butyrate treatment. Clones
Syn3-9, -21, and -33 and control cells expressing p75NTR
(75-25) were treated for 16 h with 10 mM of sodium
butyrate and tested for expression of Syn3 by Western blotting on a
microsomal fraction (Fig. 4A).
The extent of Syn3 overexpression over control levels was 10-fold for
clone Syn3-21 and 4- to 5-fold for clones Syn3-9 and Syn3-33 after
butyrate stimulation. The homogeneity of the Syn3-9, -21 and -33 clones
was tested by immunofluorescence using an affinity purified anti-Syn3
antibody. On average, the percentage of cells overexpressing Syn3 was
between 50 and 70% (Fig. 4B). To take into account the
heterogeneity of Syn3 expression, we calculated the ratio between the
level of Syn3 (determined by Western blotting) and the percentage of
positive cells (determined by immunofluorescence) with clone 3-21 taken
as 1 (Fig. 4C). The percentage of cells expressing SI, an
apical differentiation marker, was also quantified; it was 68% in
Syn3-21 and 73% in Syn3-33 cells (not shown). These percentages were
typical of Caco-2 cells, which always expressed apical markers in a
mosaic pattern (2). The polarized distribution of apical
and basolateral markers was examined in Syn3-overexpressing clones and
control cells using selective surface biotinylation. All clones
expressed apical (SI, DPPIV) and basolateral (Ag525) markers in a
polarized fashion (not shown), indicating that no important change in
the polarity of the clones was provoked by selection.
|
Cell surface delivery of newly synthesized apical and basolateral
markers in cells overexpressing Syn3.
To evaluate the impact of Syn3 overexpression on membrane trafficking
to the apical or basolateral surfaces, cell surface delivery of an
apical and a basolateral marker was studied using a combination of
metabolic pulse chase and cell surface biotinylation. Cells grown on
filters and treated overnight with butyrate were pulsed for 30 min with
[35S]methionine and cysteine, chased for 1 (half-time of
basolateral delivery of the Ag525) or 4 (half-time of apical delivery
of SI) h, and biotinylated on the basolateral side for Ag525 or the
apical side for SI. Four filters were used for each clone, and the
amount of newly synthesized surface Ag525 or SI was quantified after immunoprecipitation and streptavidin precipitation followed by SDS-PAGE
analysis and fluorography (19). In cells overexpressing Syn3, an inhibition of SI delivery to the apical membrane was observed,
with a stronger effect in Syn 3-21 and Syn3-9 cells (Fig.
5A). The level of inhibition
was >50% in Syn3-21 and Syn3-9 cells, whereas it was ~15% in
Syn3-33 cells. In contrast, no modification of the delivery of Ag525
was detected (Fig. 5B), indicating that overexpression of
Syn3 only affected delivery of the apical marker. This inhibition of
apical delivery of SI was not caused by missorting, because no increase
could be detected in the basolateral delivery of this enzyme in the
same cells after 4 h (Fig.
6A). A delay in apical
delivery of SI could be explained by a slower processing of the
immature enzyme by the Golgi apparatus. To test this hypothesis, we
measured the percentage of immature SI (9) after 4 h
of chase in control and Syn3-21 cells (Fig. 6B). Processing
of SI was similar in both cells, indicating that the delay in apical delivery was not caused by a lack of addition of complex glycans by the
Golgi complex.
|
|
-glucosidase, an enzyme that
is apically secreted in Caco-2 cells (13). Cells grown on
filters and treated overnight with butyrate were pulsed for 30 min with
[35S]methionine and cysteine and chased for 4 h.
-Glucosidase was precipitated from the apical medium and analyzed by
SDS-PAGE and fluorography. A strong inhibition of
-glucosidase
secretion was observed in Syn3-21 and Syn3-9 cells (80%), whereas only
a small effect could be observed in Syn3-33 cells (Fig.
7), indicating that the inhibition of SI
and
-glucosidase apical delivery might be dose dependent. In fact,
when the relative quantity of Syn3 per cell was calculated in each
clone, clone 33 showed the lowest value, suggesting that the threshold
for a dominant negative effect was close to that level. To rule out a
possible mutation that might have invalidated Syn3 function after
clonal selection, we checked the Syn3 sequence in clone 33 by
amplification of the transgene by RT-PCR. Two cDNA clones were
sequenced, and neither of them exhibited a mutation, confirming the
hypothesis that the weaker inhibition of apical delivery might be
caused by lower levels of expression. These data also suggest that
correct levels of Syn3 could be necessary for proper protein delivery
to the apical membrane of intestinal cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
Expression and transport of Syn3TfR. We have designed a chimera comprising the entire coding sequence of Syn3 and the extracellular domain of TfR. We chose this receptor because its extracellular domain has already been used as a reporter in polarity studies, because it does not appear to contain strong sorting information (14, 29). In the case of our chimera, this seems to be true, because we could not detect any difference in subcellular localization between Syn3 (endogenous or transfected) and Syn3TfR. Syn3TfR was localized at the apical membrane by using antibodies recognizing either the Syn3 part or the extracellular domain of TfR. As expected, antibodies against the intracellular domain of TfR did not label the apical membrane. The chimera was transported along the Golgi apparatus and processed as the endogenous TfR, because we could observe a shift in mobility during maturation. Finally, it reached the apical membrane mainly using the direct apical pathway, because very little of the chimera population was detected even transiently on the basolateral membrane whereas the endogenous apical protein DPPIV, using the indirect pathway, was easily detected on the same membrane in the meantime. It is likely that the transport pattern of the chimera reflects the actual transport of endogenous Syn3, because most apical proteins in Caco-2 cells follow the indirect pathway (18, 25) and thus entry in the direct pathway was likely to be driven by the Syn3 part of the chimera. In terms of the regulation of Syn3 activity, the use of the direct pathway could be important because we have shown that Syn3 is complexed to another t-SNARE, SNAP-23, on the apical membrane. SNAP-23 is also present on the basolateral membrane in Caco-2 cells (Fig. 2B), where it is complexed to Syn4 (not shown) also expressed on that membrane (Fig. 2A). Thus a transient expression of Syn3 on the basolateral membrane could induce the formation of potentially active complexes and provoke unwanted membrane delivery. This work is the first description of the intracellular transport of a polarized t-SNARE in epithelial cells. It is striking that Syn3 is not always expressed at the apical membrane of epithelial cells. In particular, it has been reported to localize at the basolateral membrane of renal intercalated cells (24) but to be apical in kidney-derived MDCK cells (21). These data raise the possibility that syntaxins may control the expression of a subset of plasma membrane proteins with a tight physiological regulation of their polarized expression in a tissue-specific manner. In our case, we showed that Syn3 is localized apically both in Caco-2 and in normal colonic cells in vivo (4).
Effects of Syn3 overexpression. To study the potential role of Syn3 in intestinal cells, we have transfected it in Caco-2 cells and selected clones that overexpress it after butyrate treatment. To overcome the possible additional effects of selection and butyrate treatment, as a control we used a clone transfected with wild-type p75NTR, an apical protein, as previously described (27). Control cells were kept under the same conditions and treated during experiments like the clones overexpressing Syn3. Three different clones with various levels of expression were selected and tested for transport of one basolateral and two apical markers. We found that overexpression of Syn3 did not significantly alter delivery of Ag525 to the basolateral surface, indicating that the basolateral pathway was not dependent on the level of Syn3 present in the cells. Accordingly, overexpression of Syn3 also had no effect on the basolateral transport of the polymeric immunoglobulin receptor, confirming that in epithelial cells Syn3 is probably not involved in this pathway (22).
Overexpression of Syn3, on the other hand, caused a specific inhibition of apical delivery of a transmembrane protein, SI, and a secreted protein,
-glucosidase. Apical delivery of both proteins was
significantly reduced in clones 9 and 21, whereas the effect was much
more reduced in clone 33, suggesting a dose-dependent effect. This
could be explained by a higher ratio (0.54 vs. 0.47) of the amount of
Syn3 and the percentage of cells expressing it in clone 9 vs. clone 33 or by a different balance between putative partners of Syn3 in clone
33. In clone 21, both the level of Syn3 and the percentage of
overexpressing cells were higher than in clone 33. We have ruled out a
possible mutation of Syn3 leading to a deficient protein in clone 33. Our efforts to obtain clones either expressing more Syn3 or exhibiting
a higher percentage of overexpressing cells failed, probably because
their normal growth was impaired above a certain level of expression.
It is likely that in each cloned population, transport of SI to the apical surface was even more inhibited in cells overexpressing Syn3
than the average numbers (50% of inhibition) found in Fig. 5A. Conversely, in the same population, cells with normal
levels of Syn3 were likely to show no effect, reducing the overall
measured effect. Our assay measured cell surface delivery as an average for the population tested with a balance between normal and
overexpressing cells. Apical markers most probably were transported in
these cells with much slower kinetics rather than being accumulated intracellularly, because we never observed a strong accumulation of SI,
for example, inside the cells (not shown).
The delay we observed in the apical delivery of both SI and
-glucosidase was not caused by a change in the kinetics of
processing by the Golgi enzymes, because there was no significant
difference of the percentage of endoglycosidase H-resistant SI between
control and clone 21 cells after 4 h of chase. Reduced apical
delivery of SI was also not caused by missorting of this protein to the basolateral membrane, because there was no significant increase of
basolateral newly synthesized SI after 4 h of chase. Therefore, inhibition of apical transport in cells overexpressing Syn3 is most
probably a post-Golgi event. The question remains as to whether Syn3 is
involved in the targeting or in the fusion of apical transport vesicles. Both SI and
-glucosidase use the direct apical transport route, and thus we postulate that Syn3 is a key component regulating this pathway, as also suggested by Low et al. (22). The
implication of Syn3 in the indirect (or transcytotic) pathway remains
to be investigated in intestinal cells, even though it was shown by the
same authors that in MDCK cells the overexpression of Syn3 did not
affect this pathway. The mechanism by which this inhibition is
mediated is not clear, but similar effects have been observed previously in other systems. For example, in Drosophila the
overexpression of Syn1 provoked a specific inhibition of synaptic
vesicle fusion (40), whereas in pancreatic island cells,
overexpression of Syn1A inhibited glucose-stimulated insulin secretion
(28). Even in constitutive transport, such as endoplasmic
reticulum to Golgi transport, overexpression of Syn5 caused an
inhibition (3). In these studies, the effect was
restricted to one transport pathway. This inhibitory effect of
overexpression of Syn3 could be mediated by association with munc 18-2, which is also enriched in the apical membrane of Caco-2 cells
(31), preventing the recycling of SNARE complexes at the
apical membrane after their participation in a fusion event. Any change
in the balance of apical SNAREs in epithelial cells might lead to a
perturbation in the efficiency of the vesicular targeting or fusion.
After some debate (12, 22), it now appears that in MDCK
cells the apical pathway also relies on Syn3/SNAP-23 (16,
22), indicating that it might be a common feature for apical
transport in epithelial cells. The results presented here strongly
suggest that the direct apical pathway involves the SNARE machinery to operate in Caco-2 cells, establishing that this pathway is of the same
nature as in MDCK cells even if the two cell lines show different
behaviors in sorting and delivery of apical proteins.
| |
ACKNOWLEDGEMENTS |
|---|
We thank C. Moretti for help with the confocal microscope, A. Quaroni for providing monoclonal antibodies against SI, and J.-P. Arsanto for electron microscopy and critical reading of the manuscript.
| |
FOOTNOTES |
|---|
This work was supported by a fellowship from the Ministry of Education and La Ligue Nationale contre le Cancer (L. Breuza) and by Centre National de la Recherche Scientifique UMR 6545, Université de la Méditerranée, Institut de Biologie du Développement de Marseille, Association pour la recherche sur le Cancer 9297, Association Française de lutte contre la Mucoviscidose, and Mizutani Foundation (A. Le Bivic).
Address for reprint requests and other correspondence: A. Le Bivic, Laboratoire de Génétique et Physiologie du Développement, IBDM, CNRS/INSERM, Univ. de la Méditerranée, AP de Marseille, Parc Scientifique de Luminy, Case 907, 13288 Marseille cedex 09, France (E-mail: lebivic{at}ibdm.univ-mrs.fr).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 1 December 1999; accepted in final form 15 May 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bartles, JR,
Feracci HM,
Stieger B,
and
Hubbard AL.
Biogenesis of the rat hepatocyte plasma membrane in vivo: comparison of the pathways taken by apical and basolateral proteins using subcellular fractionation.
J Cell Biol
105:
1241-1251,
1987
2.
Chantret I, Rodolosse A, Barbat A, Dussaulx E, Brot LE, Zweibaum A, and
Rousset M. Differential expression of sucrase-isomaltase in clones
isolated from early and late passages of the cell line Caco-2: evidence
for glucose-dependent negative regulation. J Cell Sci :
213-225, 1994.
3.
Dascher, C,
Matteson J,
and
Balch WE.
Syntaxin 5 regulates endoplasmic reticulum to Golgi transport.
J Biol Chem
269:
29363-29366,
1994
4.
Delgrossi, MH,
Breuza L,
Mirre C,
Chavrier P,
and
Le Bivic A.
Human syntaxin 3 is localized apically in human intestinal cells.
J Cell Sci
110:
2207-2214,
1997[Abstract].
5.
Garcia, EP,
Gatti E,
Butler M,
Burton J,
and
De Camilli P.
A rat brain Sec1 homologue related to Rop and UNC18 interacts with syntaxin.
Proc Natl Acad Sci USA
91:
2003-2007,
1994
6.
Garcia M, Mirre C, Quaroni A, Reggio H, and Le Bivic A. GPI-anchored proteins associate to form microdomains during their
intracellular transport in Caco-2 cells. J Cell Sci :
1281-1290, 1993.
7.
Gilbert, T,
Le Bivic A,
Quaroni A,
and
Rodriguez-Boulan E.
Microtubular organization and its involvement in the biogenetic pathways of plasma membrane proteins in Caco-2 intestinal epithelial cells.
J Cell Biol
113:
275-288,
1991
8.
Grindstaff, KK,
Yeaman C,
Anandasabapathy N,
Hsu SC,
Rodriguez-Boulan E,
Scheller RH,
and
Nelson WJ.
Sec6/8 complex is recruited to cell-cell contacts and specifies transport vesicle delivery to the basal-lateral membrane in epithelial cells.
Cell
93:
731-740,
1998[ISI][Medline].
9.
Hauri, HP,
Quaroni A,
and
Isselbacher KJ.
Monoclonal antibodies to sucrase/isomaltase: probes for the study of postnatal development and biogenesis of the intestinal microvillus membrane.
Proc Natl Acad Sci USA
77:
6629-6633,
1980
10.
Hay, JC,
and
Scheller RH.
SNAREs and NSF in targeted membrane fusion.
Curr Opin Cell Biol
9:
505-512,
1997[ISI][Medline].
11.
Huber, LA,
Pimplikar S,
Parton RG,
Virta H,
Zerial M,
and
Simons K.
Rab8, a small GTPase involved in vesicular traffic between the TGN and the basolateral plasma membrane.
J Cell Biol
123:
35-45,
1993
12.
Ikonen, E,
Tagaya M,
Ullrich O,
Montecucco C,
and
Simons K.
Different requirements for NSF, SNAP, and Rab proteins in apical and basolateral transport in MDCK cells.
Cell
81:
571-580,
1995[ISI][Medline].
13.
Klumperman, J,
Fransen JA,
Boekestijn TC,
Oude Elferink RP,
Matter K,
Hauri HP,
Tager JM,
and
Ginsel LA.
Biosynthesis and transport of lysosomal alpha-glucosidase in the human colon carcinoma cell line Caco-2: secretion from the apical surface.
J Cell Sci
100:
339-347,
1991
14.
Kundu, A,
Avalos RT,
Sanderson CM,
and
Nayak DP.
Transmembrane domain of influenza virus neuraminidase, a type II protein, possesses an apical sorting signal in polarized MDCK cells.
J Virol
70:
6508-6515,
1996[Abstract].
15.
Lafont, F,
Lecat S,
Verkade P,
and
Simons K.
Annexin XIIIb associates with lipid microdomains to function in apical delivery.
J Cell Biol
142:
1413-1427,
1998
16.
Lafont, F,
Verkade P,
Galli T,
Wimmer C,
Louvard D,
and
Simons K.
Raft association of SNAP receptors acting in apical trafficking in Madin-Darby canine kidney cells.
Proc Natl Acad Sci USA
96:
3734-3738,
1999
17.
Le Bivic, A,
Bosc-Biern I,
and
Reggio H.
Characterization of a glycoprotein expressed on the basolateral membrane of human intestinal epithelial cells and cultured colonic cell lines.
Eur J Cell Biol
46:
113-120,
1988[ISI][Medline].
18.
Le Bivic, A,
Quaroni A,
Nichols B,
and
Rodriguez-Boulan E.
Biogenetic pathways of plasma membrane proteins in Caco-2, a human intestinal epithelial cell line.
J Cell Biol
111:
1351-1361,
1990
19.
Le Bivic, A,
Real FX,
and
Rodriguez-Boulan E.
Vectorial targeting of apical and basolateral plasma membrane proteins in a human adenocarcinoma epithelial cell line.
Proc Natl Acad Sci USA
86:
9313-9317,
1989
20.
Lisanti, MP,
Le Bivic A,
Sargiacomo M,
and
Rodriguez-Boulan E.
Steady-state distribution and biogenesis of endogenous Madin-Darby canine kidney glycoproteins: evidence for intracellular sorting and polarized cell surface delivery.
J Cell Biol
109:
2117-2127,
1989
21.
Low, SH,
Chapin SJ,
Weimbs T,
Komuves LG,
Bennett MK,
and
Mostov KE.
Differential localization of syntaxin isoforms in polarized Madin-Darby canine kidney cells.
Mol Biol Cell
7:
2007-2018,
1996[Abstract].
22.
Low, SH,
Chapin SJ,
Wimmer C,
Whiteheart SW,
Komuves LG,
Mostov KE,
and
Weimbs T.
The SNARE machinery is involved in apical plasma membrane trafficking in MDCK cells.
J Cell Biol
141:
1503-1513,
1998
23.
Low, SH,
Roche PA,
Anderson HA,
van Ijzendoorn SC,
Zhang M,
Mostov KE,
and
Weimbs T.
Targeting of SNAP-23 and SNAP-25 in polarized epithelial cells.
J Biol Chem
273:
3422-3430,
1998
24.
Mandon, B,
Nielsen S,
Kishore BK,
and
Knepper MA.
Expression of syntaxins in rat kidney.
Am J Physiol Renal Physiol
273:
F718-F730,
1997.
25.
Matter, K,
Brauchbar M,
Bucher K,
and
Hauri HP.
Sorting of endogenous plasma membrane proteins occurs from two sites in cultured human intestinal epithelial cells (Caco-2).
Cell
60:
429-437,
1990[ISI][Medline].
26.
Matter, K,
and
Mellman I.
Mechanisms of cell polarity: sorting and transport in epithelial cells.
Curr Opin Cell Biol
6:
545-554,
1994[ISI][Medline].
27.
Monlauzeur, L,
Breuza L,
and
Le Bivic A.
Putative O-glycosylation sites and a membrane anchor are necessary for apical delivery of the human neurotrophin receptor in Caco-2 cells.
J Biol Chem
273:
30263-30270,
1998
28.
Nagamatsu, S,
Fujiwara T,
Nakamichi Y,
Watanabe T,
Katahira H,
Sawa H,
and
Akagawa K.
Expression and functional role of syntaxin 1/HPC-1 in pancreatic beta cells. Syntaxin 1A, but not 1B, plays a negative role in regulatory insulin release pathway.
J Biol Chem
271:
1160-1155,
1996
29.
Odorizzi, G,
and
Trowbridge IS.
Structural requirements for basolateral sorting of the human transferrin receptor in the biosynthetic and endocytic pathways of Madin-Darby canine kidney cells.
J Cell Biol
137:
1255-1264,
1997
30.
Owen, D,
and
Kuhn LC.
Noncoding 3' sequences of the transferrin receptor gene are required for mRNA regulation by iron.
EMBO J
6:
1287-1293,
1987[ISI][Medline].
31.
Riento K, Galli T, Jansson S, Ehnholm C, Lehtonen E, and Olkkonen
VM. Interaction of Munc-18-2 with syntaxin 3 controls the
association of apical SNAREs in epithelial cells. J Cell
Sci : 2681-2688, 1998.
32.
Rothman, JE,
and
Warren G.
Implications of the SNARE hypothesis for intracellular membrane topology and dynamics.
Curr Biol
4:
220-233,
1994[ISI][Medline].
33.
Rothman, JE,
and
Wieland FT.
Protein sorting by transport vesicles.
Science
272:
227-234,
1996[Abstract].
34.
Sargiacomo, M,
Lisanti M,
Graeve L,
Le Bivic A,
and
Rodriguez-Boulan E.
Integral and peripheral protein composition of the apical and basolateral membrane domains in MDCK cells.
J Membr Biol
107:
277-286,
1989[ISI][Medline].
35.
Sogaard, M,
Tani K,
Ye RR,
Geromanos S,
Tempst P,
Kirchhausen T,
Rothman JE,
and
Sollner T.
A rab protein is required for the assembly of SNARE complexes in the docking of transport vesicles.
Cell
78:
937-948,
1994[ISI][Medline].
36.
Sollner, T,
Bennett MK,
Whiteheart SW,
Scheller RH,
and
Rothman JE.
A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion.
Cell
75:
409-418,
1993[ISI][Medline].
37.
Sollner, T,
Whiteheart SW,
Brunner M,
Erdjument BH,
Geromanos S,
Tempst P,
and
Rothman JE.
SNAP receptors implicated in vesicle targeting and fusion.
Nature
362:
318-324,
1993[Medline].
38.
Sudhof, TC.
The synaptic vesicle cycle: a cascade of protein-protein interactions.
Nature
375:
645-653,
1995[Medline].
39.
Weber, T,
Zemelman BV,
McNew JA,
Westermann B,
Gmachl M,
Parlati F,
Sollner TH,
and
Rothman JE.
SNAREpins: minimal machinery for membrane fusion.
Cell
92:
759-772,
1998[ISI][Medline].
40.
Wu, MN,
Littleton JT,
Bhat MA,
Prokop A,
and
Bellen HJ.
ROP, the Drosophila Sec1 homolog, interacts with syntaxin and regulates neurotransmitter release in a dosage-dependent manner.
EMBO J
17:
127-139,
1998[ISI][Medline].
41.
Yeaman, C,
Grindstaff KK,
and
Nelson WJ.
New perspectives on mechanisms involved in generating epithelial cell polarity.
Physiol Rev
79:
73-98,
1999
42.
Zurzolo, C,
Le Bivic A,
Quaroni A,
Nitsch L,
and
Rodriguez-Boulan E.
Modulation of transcytotic and direct targeting pathways in a polarized thyroid cell line.
EMBO J
11:
2337-2344,
1992[ISI][Medline].
This article has been cited by other articles:
![]() |
T. Pocard, A. Le Bivic, T. Galli, and C. Zurzolo Distinct v-SNAREs regulate direct and indirect apical delivery in polarized epithelial cells J. Cell Sci., September 15, 2007; 120(18): 3309 - 3320. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Suzuki, H. Ohnishi, A. Wada, T. Hirayama, H. Ohno, N. Ueda, H. Yasuda, T. Iiri, Y. Wada, M. Futai, et al. Involvement of Syntaxin 7 in Human Gastric Epithelial Cell Vacuolation Induced by the Helicobacter pylori-produced Cytotoxin VacA J. Biol. Chem., July 3, 2003; 278(28): 25585 - 25590. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. TUMA and A. L. HUBBARD Transcytosis: Crossing Cellular Barriers Physiol Rev, July 1, 2003; 83(3): 871 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kauppi, G. Wohlfahrt, and V. M. Olkkonen Analysis of the Munc18b-Syntaxin Binding Interface. USE OF A MUTANT Munc18b TO DISSECT THE FUNCTIONS OF SYNTAXINS 2 AND 3 J. Biol. Chem., November 8, 2002; 277(46): 43973 - 43979. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, S. H. Low, M. Miura, and T. Weimbs SNARE expression and localization in renal epithelial cells suggest mechanism for variability of trafficking phenotypes Am J Physiol Renal Physiol, November 1, 2002; 283(5): F1111 - F1122. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lemmers, E. Medina, M.-H. Delgrossi, D. Michel, J.-P. Arsanto, and A. Le Bivic hINADl/PATJ, a Homolog of Discs Lost, Interacts with Crumbs and Localizes to Tight Junctions in Human Epithelial Cells J. Biol. Chem., July 5, 2002; 277(28): 25408 - 25415. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |