Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 278: C791-C802, 2000;
0363-6143/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (33)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stevens, A. L.
Right arrow Articles by Brown, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stevens, A. L.
Right arrow Articles by Brown, D.
Vol. 278, Issue 4, C791-C802, April 2000

Aquaporin 2 is a vasopressin-independent, constitutive apical membrane protein in rat vas deferens

Anna L. Stevens1, Sylvie Breton1,2, Corinne E. Gustafson1, Richard Bouley1, Raoul D. Nelson3, Donald E. Kohan3, and Dennis Brown1,4

1 Program in Membrane Biology & Renal Unit, Massachusetts General Hospital, and Departments of 2 Medicine and 4 Pathology, Harvard Medical School, Boston, Massachusetts 02114; and 3 Division of Nephrology, University of Utah Health Sciences Center, Salt Lake City, Utah 84132


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Aquaporin 2 (AQP2), the vasopressin-regulated water channel, was originally identified in renal collecting duct principal cells. However, our recent description of AQP2 in the vas deferens indicated that this water channel may have extra-renal functions, possibly related to sperm concentration in the male reproductive tract. In this study, we have examined the regulation and membrane insertion pathway of AQP2 in the vas deferens. The amino acid sequence of vas deferens AQP2 showed 100% identity to the renal protein. AQP2 was highly expressed in the distal portion (ampulla) of the vas deferens, but not in the proximal portion nearest the epididymis. It was concentrated on the apical plasma membrane of vas deferens principal cells, and very little was detected on intracellular vesicles. Protein expression levels and cellular localization patterns were similar in normal rats and vasopressin-deficient Brattleboro homozygous rats, and were not changed after 36 h of dehydration, or after 3 days of vasopressin infusion into Brattleboro rats. AQP2 was not found in apical endosomes (labeled with Texas Red-dextran) in vas deferens principal cells, indicating that it is not rapidly recycling in this tissue. Finally, vasopressin receptors were not detectable on vas deferens epithelial cell membranes using a [3H]vasopressin binding assay. These data indicate that AQP2 is a constitutive apical membrane protein in the vas deferens, and that it is not vasopressin-regulated in this tissue. Thus AQP2 contains targeting information that can be interpreted in a cell-type-specific fashion in vivo.

water channels; indirect immunofluorescence; cell polarity; endocytosis; male reproductive tract


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

AQUAPORIN 2 (AQP2) is a member of a family of water channel proteins that are expressed in a wide variety of cells and tissues. Originally found in the collecting duct of the kidney (26), AQP2 is regulated by the antidiuretic hormone vasopressin (ADH), and its trafficking to the cell surface increases the transepithelial reabsorption of water by principal cells (20, 31, 47, 50). Inadequate cell surface expression of AQP2 results in nephrogenic diabetes insipidus (19, 45).

The urinary concentrating capacity of the collecting duct is regulated both acutely and chronically by vasopressin. Vasopressin binding to its receptor leads to an increase in intracellular cAMP, and AQP2 is then phosphorylated at serine 256 by protein kinase A. This phosphorylation event is critical for the rapid translocation of AQP2 from an intracellular vesicular storage site to the plasma membrane (25, 37). Thus AQP2 is delivered to the cell surface via a hormonally regulated exocytotic pathway in principal cells. Chronic AQP2 regulation occurs at the level of transcription and translation; the AQP2 gene promoter possesses a cAMP/cAMP-responsive element binding site that is activated at elevated intracellular cAMP concentrations (36, 43).

We have recently used a transgenic mouse approach to examine the cell-specific expression of AQP2 in vivo, using a 14-kb region of the human AQP2 promoter to drive expression of an epitope tag (CreTag) containing a nuclear localization sequence (46). Although the expected principal cell localization of the construct was observed in collecting ducts, it was also detected in principal cells of the vas deferens in the male reproductive tract. The vas deferens is derived from the Wolffian duct during embryogenesis and is part of the excurrent duct system responsible for the transport, storage, and maturation of sperm. During its passage through this system of tubules, the fluid composition of the lumen in which sperm reside is greatly modified, and the concentration of sperm in the lumen is increased significantly after production in the testes (32, 33). We have previously shown that another aquaporin, AQP1, is located in the efferent ducts where up to 90% of the seminiferous fluid can be absorbed after leaving the testis (15, 18, 34). In this respect, the efferent ducts resemble renal proximal tubules, which also absorb up to 80% of the glomerular ultrafiltrate (18). Several studies have shown that fluid reabsorption also occurs in other parts of the reproductive tract, notably the epididymis (35, 55, 56).

This study was designed to identify and characterize AQP2 in the vas deferens, and to determine whether its pattern of regulation and cell surface expression was similar to that previously described for this aquaporin in collecting duct principal cells. We found that bona fide AQP2 is expressed in the vas deferens, that this expression is variable in different segments of the vas deferens, and that the protein is constitutively expressed on the apical cell surface of principal cells.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Antibodies

Two affinity-purified rabbit polyclonal antibodies against AQP2 peptides were used for Western blotting and immunocytochemistry in these studies. One was raised against the carboxy-terminal 16 amino acids of rat AQP2 (CVELHSPQSLPRGSKA), and the other against a 14-amino-acid segment from the second external loop of AQP2 (C-GDLAVNALHNNATA). Both antibodies have been previously characterized (28, 50). Antibodies were affinity purified with the SulfoLink Kit according to the manufacturer's instructions (Pierce, Rockford, IL). A polyclonal antibody was raised in chicken against the carboxy-terminal 14 amino acids of the 31-kDa subunit of the proton pump coupled to keyhole limpet hemocyanin, and was also affinity-purified as above. A monoclonal antibody against tubulin was purchased from Sigma (St. Louis, MO).

Experimental Animals

Experiments were conducted using mature (300-350 g) male Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) or homozygous Brattleboro rats with central diabetes insipidus (Harlan Sprague-Dawley, Indianapolis, IN). As appropriate, rats were anesthetized using a pentobarbital sodium (50 mg/ml) injection of 0.15 ml/100 g body wt. Urine samples voided on Parafilm were taken from each rat before the anesthetization and the osmolality was measured with a Wescor 5500 Vapor Pressure Osmometer.

Dehydration Experiments

Male Sprague-Dawley rats were divided into two groups of four. A constant supply of water was provided to one group, while the other group was thirsted for 12 or 36 h before anesthetization and removal of tissue. A sample of urine from each rat was taken and the urine osmolality tested.

Vasopressin Infusion by Osmotic Minipump

Three homozygous Brattleboro rats were infused with vasopressin via Alzet Osmotic Mini Pumps (Alza, Palo Alto, CA) as described by Gellai et al. (27) while three served as controls for the experiment. Rats were lightly anesthetized by injection of 0.1 ml/100 g body wt pentobarbital sodium (50 mg/ml), and the osmotic minipumps were inserted subcutaneously between the shoulder blades. The pumps were loaded with ~90 µl of 0.125 µg/µl desamino-D-arginine vasopressin (dDAVP) in saline solution (0.9% NaCl). At a pumping rate of 0.96 µl/h, ~3 µg/day of vasopressin was delivered to the rats for 3 days. Urine samples were taken before implantation and just before anesthesia after 3 days of infusion.

Colchicine Treatment

Four adult male Sprague-Dawley rats were injected with colchicine (0.5 ml/100 g body wt) in PBS (0.9% NaCl in 10 mM sodium phosphate buffer, pH 7.4) as previously described (29). Rats were anesthetized 12 h after colchicine treatment, and the kidneys and reproductive organs were perfusion-fixed for immunofluorescence as described below.

Tissue Fixation

Sprague-Dawley and homozygous Brattleboro rats were anesthetized as described above. The kidney and male reproductive organs were fixed by cardiac perfusion via the left ventricle with Hanks' balanced salt solution for 1 min followed by paraformaldehyde lysine periodate (PLP) fixation. The original PLP recipe (44) was modified to increase the paraformaldehyde concentration from 2 to 4%. The kidney and reproductive organs, specifically the epididymis, vas deferens, and testis, were removed after 5 min of perfusion with PLP and placed in the same fixative at room temperature for 4-6 h. Tissue was washed three times in PBS and kept at 4°C before use.

Enrichment of Epithelial Tissue from Vas Deferens: the Epithelial Sock Preparation

Because the bulk of the vas deferens consists of smooth muscle and connective tissue, it was necessary to enrich the preparation in epithelial tissue for more accurate and sensitive detection of AQP2 by Western blotting and mRNA analysis. We found that by gripping the epithelial layer at the cut end of the distal portion of the vas deferens with fine tweezers, and gently pulling, the entire internal distal epithelial layer could be removed from the surrounding connective tissue. Because of the shape of this tube, we have named this the epithelial sock preparation (Fig. 1A). This preparation consists mainly of epithelial cells on a basement membrane, plus a thin layer of surrounding connective tissue (Fig. 1B). However, we cannot exclude the possibility that a variable number of smooth muscle cells remained associated with the epithelial sock after dissection.


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 1.   A: epithelial sock (arrows) protruding from the thick outer muscular coat of the ampulla of the vas deferens. B: light micrograph of isolated epithelial sock, stained with toluidine blue, showing columnar epithelial cells surrounded by a thin layer of connective tissue. Apical stereocilia projecting into tubule lumen are indicated with arrows. Bar = 250 µm (A) and 25 µm (B).

Western Blotting and mRNA Extraction

Several rats were anesthetized as above and the vas deferens and kidneys were removed. The papilla was dissected from each kidney; one was taken for protein extraction and the other for mRNA preparation. The epithelial tissue was separated from the distal portion of each vas deferens (see above), taking one epithelial sock for protein analysis and the other for mRNA extraction. All tissue was snap-frozen in liquid nitrogen before storing at -80°C until use.

Immunofluorescence

The PLP-fixed vas deferens were cryoprotected in a solution of 30% sucrose in PBS for ~2 h at room temperature. The distal portion was cut into 3- to 4-mm lengths and embedded in OTC Compound 4583 (Tissue-Tek, Sakura Finetechnical, Tokyo, Japan) on a cryostat cutting block. After rapidly freezing in liquid nitrogen, the tissue was cut on a Reichert Frigocut cryomicrotome and sections were placed on Fisher Superfrost Plus microscope slides (Fisher Scientific, Pittsburgh, PA) as previously described (10). Slides were placed in PBS for 10 min followed by preincubation in 1% BSA in PBS/0.02% sodium azide for 15 min. Sections were incubated in primary anti-AQP2 antibodies, diluted 1:100 in PBS/0.02% sodium azide, for 90 min at room temperature. Sections were washed twice for 5 min in high-salt PBS (containing 2.7% NaCl instead of 0.9%) to reduce nonspecific staining, and once in normal PBS. Sections were then incubated for 1 h with secondary antibody, goat anti-rabbit IgG coupled to fluorescein isothiocyanate (FITC; Jackson ImmunoResearch, West Grove, PA). The sections were again washed as described above. Double labeling was performed by subsequent incubation of some sections with a polyclonal chicken anti-H+-ATPase antibody and goat anti-chicken CY3. The slides were coverslipped, mounted in Vectashield (Vector Labs, Burlingame, CA) diluted 1:1 with Tris buffer, pH 8.5, and examined with a Nikon FXA epifluorescence microscope. Controls included incubation of sections with no primary antibody, with preimmune serum, or with affinity-purified antibody that had been preincubated with the peptide antigen used for immunization for 1 h at room temperature. Black and white photographs were taken using Kodak T-Max 400 film pushed to ASA 1600. Double-stained sections were digitally imaged using an Optronix 3-bit color CCD camera and IP Lab Spectrum software (Scanalytic, Vienna, VA). Final images were imported into and printed from Adobe Photoshop.

Immunogold Staining for Electron Microscopy

The ampulla of the vas deferens was fixed by perfusion and then immersion in PLP (containing 4% paraformaldehyde). The tissue was left overnight, washed with PBS, and stored at 4°C in PBS containing 0.02% sodium azide until use. For immunogold labeling, segments of vas deferens fixed as above were embedded in Lowicryl K4M resin using a Leica AFS freeze-substitution apparatus (Leica, Deerfield, IL). After polymerization of the resin by ultraviolet (UV) light, thin sections were cut and incubated with affinity-purified anti-AQP2 external domain antibody (1:100) overnight at 4°C, rinsed, and incubated for 1 h at room temperature with goat anti-rabbit IgG coupled to 10 nm colloidal gold as described previously (11).

Immunoblotting (SDS-PAGE and Western Blotting)

Frozen samples of vas deferens and papilla (three of each) were pooled and placed in 1 ml of lysis buffer [10 mM Tris, pH 7.4, 160 mM NaCl, 0.05% IGEPAL CA-630, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, complete protease inhibitor (Boehringer Mannheim, Mannheim, Germany), 0.2 mM phenylmethylsulfonyl fluoride (PMSF)]. The samples were homogenized using a 1-ml Dounce tissue grinder followed by shearing with a 27.5-gauge needle and 1-ml syringe. Samples were centrifuged at 12,000 g, and the protein concentration of the supernatant was determined using the Bradford assay (Bio-Rad, Hercules, CA). Protein was added 1:1 to Laemmli sample buffer [1% SDS, 30 mM Tris · HCl, pH 6.8, 5% 2-beta -mercaptoethanol, 12% (vol/vol) glycerol]. Proteins were added at 10 µg/lane for vas deferens and 20 µg for papilla preparations, separated by SDS-PAGE, and transferred to Immobilon membranes as previously described (28, 50). Membranes were incubated for 90 min with affinity-purified AQP2 antibody (1:1,000 dilution), made against the external domain. Goat anti-rabbit IgG conjugated to horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA) was applied to membranes, and they were incubated for 1 h at room temperature. Proteins were detected using Renaissance Western Blot Chemiluminescence Reagent (New England Nuclear, Boston, MA).

mRNA Isolation

mRNA was isolated using the MicroPoly(A) Pure Kit (Ambion, Austin, TX) according to the protocol provided. Approximately three vas deferens epithelial socks or three kidney papillae were homogenized in 1 ml of lysis buffer and used for mRNA isolation. To concentrate the mRNA, it was precipitated using ammonium acetate and ethanol as directed.

Northern Blot Analysis

Northern Blotting was performed with a NorthernMax Complete Northern Blotting Kit (Ambion) according to the manufacturer's instructions. Equal amounts of mRNA samples (1.5 µg) were combined with denaturing buffer (1:3 ratio, vol/vol) and heated at 70°C for 15 min. Samples were loaded on a 1% agarose denaturing gel and run at 80 V for 2.5 h. mRNA was transferred to BrightStar-Plus nylon membranes (Ambion), then fixed at 80°C for 15 min. An RNA probe for the AQP2 gene was transcribed that was complementary to the final 575 bp of the rat AQP2 gene using a MAXIscript In Vitro Transcription Kit (Ambion). The probe was labeled using a BrightStar Psoralen Biotin Non-Isotopic Probe Labeling Kit (Ambion). The RNA probe at a concentration of 50 ng/µl in TE buffer was labeled using Psoralin-Biotin under 354-nm UV light as instructed by the manufacturer. The membrane was hybridized with a 0.2 nM labeled probe overnight at 65°C. The incubated membrane was washed twice at low stringency followed by two high-stringency washes in preheated 65°C wash solution for 15 min each.

Sequencing

mRNA (0.3 µg) obtained from the vas deferens epithelium was reverse transcribed using oligo(dT)12-18 and Superscript II as directed by the manufacturer (GIBCO-BRL, Gaithersburg, MD). Oligos were designed to flank the ends of the AQP2 mRNA sequence and add BamH I and EcoR I restriction endonuclease sites for cloning: AQP2-F, CGGGATCCATATGTGGGAACTCAGATCCAT; AQP2-R, CGGAATTCTCAGGCCTTGCTGCCGCGAGGC. The PCR-amplified DNA was purified from the agarose gel with the use of Wizard PCR Prep (Promega), digested with EcoR I and BamH I, and cloned into pcDNA3. A clone was chosen and the sequence was determined three times with the use of the Massachusetts General Hospital fluorescent ABI Prism core facility.

Texas Red-Dextran Endocytosis

Endocytosis by the ampulla portion of the vas deferens was evaluated using Texas Red-dextran. The excised vas deferens was cut open longitudinally to expose the epithelium, and the tissue was incubated at room temperature in PBS containing 5 mg/ml Texas Red-dextran (Mr 10,000; Molecular Probes, Eugene, OR) for 15 min followed by rapid washing and fixation with PLP containing 4% paraformaldehyde and 5% sucrose as previously described for kidney tissue (39). To determine whether AQP2 was localized in endocytosed vesicles, cryostat sections of Texas Red-dextran-treated tissue were stained for AQP2 followed by FITC-conjugated secondary antibody, as described above.

Vasopressin Binding in the Vas Deferens

A vasopressin binding assay was performed on membranes prepared from the vas deferens and the renal papilla (as a positive control). For each preparation, three to six vas deferens socks or papilla pieces were removed from normal rats and frozen in liquid nitrogen until use. After thawing in ice-cold hypotonic buffer (5 mM Tris · HCl, pH 7.4, 3 mM MgCl2, 1 mM EDTA) containing protease inhibitors (Complete, Boehringer-Mannheim), the tissues were minced and homogenized 3 × 10 s with a Polytron homogenizer at speed 3. The homogenate was centrifuged at 35,000 g for 20 min, and pellets were resuspended in hypotonic buffer to a final concentration of 2 mg/ml protein. Binding assays were performed as previously described (16). Two different concentrations (100 and 200 µg) of each membrane preparation were incubated for 15 min at 30°C in 250 µl of medium containing 50 mM Tris · HCl, pH 7.4, 0.75 mM MgCl2, 0.25 mM EDTA, 1 mg/ml BSA, and 9.5 nM [3H]vasopressin ([3H]AVP, 68.5 Ci/mmol; New England Nuclear). Nonspecific binding was determined in the presence of 10 µM unlabeled vasopressin (AVP; Sigma). The incubation was followed immediately by centrifugation at 10,000 g for 20 min at 4°C. The pellet was rinsed with 200 µl of cold assay buffer and solubilized in 100 µl of 0.1 N NaOH. Receptor-bound radioactivity was measured by liquid scintillation spectrometry. All assays were performed on triplicate samples.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Immunocytochemistry

AQP2 staining was variable in different regions of the vas deferens. By immunofluorescence staining with two different antibodies against distinct AQP2 peptides, AQP2 was undetectable in the proximal vas deferens (Fig. 2A), and was localized predominantly in the distal portion of the vas deferens (the ampulla) at the apical pole of all principal cells (Fig. 2C). The apical stereocilia were strongly stained, but little or no cytoplasmic vesicular staining was detectable. In the middle portion, scattered positive principal cells were found among negative cells (Fig. 2B). Double staining with antibodies against the 31-kDa subunit of the H+-ATPase revealed that some of the negative cells were proton pump-rich cells, as previously described by Breton et al. (9). Other AQP2-negative cells were also unstained with the anti-H+-ATPase antibody, indicating a previously unsuspected heterogeneity among principal cells in this intermediate segment of the vas deferens. In the proximal region, closest to the epididymis, no AQP2-positive cells were detectable, but H+-ATPase-labeled cells were frequently found (Fig. 2A). Thus there was both cellular and regional heterogeneity in AQP2 staining along the vas deferens.


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 2.   Longitudinal cryostat sections of different regions of the vas deferens, stained with antibodies against proton pumping ATPase (yellow/red) and aquaporin 2 (green). A: proximal portion, no AQP2 staining is seen, but many cells contain apical H+-ATPase (arrows), as previously described (9). The H+-ATPase staining appears orange/yellow because this micrograph was taken using a specific CY3 filter on the microscope, which produces a yellowish emission wavelength. No specific fluorescence was detectable in this section using an FITC filter combination. B: middle region, AQP2 staining (green) is seen in a few scattered cells in middle portion of the vas deferens (arrows). Proton-secreting cells are stained with H+-ATPase antibodies (red, arrowheads), but many cells do not stain with either antibody. This micrograph was produced by digitally merging two separate images taken using the CY3 filter and the FITC filter combination. Red and green channels, respectively, were isolated from each individual micrograph before merging, resulting in pure red and pure green fluorescent signals in stained cells. C: ampulla, intense apical AQP2 staining is seen in all principal cells in the ampulla of the vas deferens. Long apical stereocilia project into the lumen (see also Fig. 1B). Very little staining is seen in cytoplasm. Bar = 10 µm.

By electron microscopy, immunogold staining showed AQP2 labeling of the apical plasma membrane and stereocilia of principal cells, and little or no basolateral membrane staining. A few small subapical vesicles were weakly labeled, but most were unlabeled (Fig. 3).


View larger version (90K):
[in this window]
[in a new window]
 
Fig. 3.   Immunogold staining for AQP2 on Lowicryl K4M-embedded vas deferens ampulla. Apical stereocilia are labeled with gold particles, but only very weak staining is seen in cytoplasm and on intracellular vesicles. Bar = 0.5 µm.

For both immunofluorescence and immunogold labeling, the positive staining was completely abolished by preabsorption of the antibodies with the corresponding immunizing peptides (see Fig. 7, C and D). No staining was seen when preimmune serum was substituted for immune serum in any of the incubations.

Western Blotting

For Western blotting, the vas deferens was divided into the three regions previously examined by immunofluorescence microscopy: proximal, middle, and distal (ampulla). The intensity of staining of the AQP2 bands correlated with the respective immunofluorescence staining of these regions, with the highest signal in the ampulla, little or no signal in the proximal region, and a weaker but variable signal in the intermediate zone, presumably resulting from our inability to identify the intermediate zone with precision during the dissection. In the ampulla, there was a large positive band at the expected molecular mass of ~29 kDa, and a smaller band at ~40 kDa (Fig. 4). This larger-molecular-mass band represents glycosylated AQP2, and is detectable in the distal vas deferens only after prolonged exposure of the film. In Fig. 4, overexposure was performed to confirm the absence of AQP2 from the proximal vas deferens. There is a smaller amount of the glycosylated product in the vas deferens compared with the kidney (see also Figs. 6 and 7). Antibodies against the cytoplasmic carboxy terminus and against an external domain of AQP2 gave similar results. The detection of positive bands by both antibodies was inhibited by preincubation of the antibodies with the immunizing peptide before incubation of the Immobilon transfers, and no staining was detected when preimmune serum was used in the incubations.


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 4.   Western blot (for AQP2) of isolated vas deferens epithelial socks removed from proximal, middle, and distal (ampulla) portions of vas deferens. Virtually no staining is seen in the proximal portion (Prox), increased staining is present in the middle zone (Mid), and a stronger staining is visible in the ampulla (Distal). The lower 29-kDa band represents nonglycosylated AQP2, while the weaker 40- to 50-kDa band is the glycosylated form. Amount of staining seen in the middle portion varied among different samples, due to variations in amount of proximal (AQP2-negative) and distal (AQP2-positive) tissue that accompanied the middle portion during dissection process. This figure was overexposed to confirm that no AQP2 signal was present in proximal vas deferens; a small amount of glycosylated AQP2 can be detected in distal portion of vas deferens. This glycosylated band is not detectable at lower exposure times (e.g., Figs. 6 and 7).

Sequencing of AQP2 from the Vas Deferens

To determine whether the protein detected by antibody staining and by Western blotting was bona fide AQP2, and not a related aquaporin that fortuitously contained peptide sequences recognized by the two different antibodies, we obtained the full-length sequence of vas deferens AQP2. In our previous report, less than 70% of the reproductive tract AQP2 sequence was determined (46). PCR was performed using primers that flank the end of the collecting duct AQP2 sequence while adding restriction sites for cloning. The full sequence for the water channel in the vas deferens was obtained in the present study, and the AQP2 sequence shows complete homology to that originally isolated from rat renal papilla (26; and data not shown).

AQP2 Expression After Dehydration

In the collecting duct, an increase of transcription of AQP2 mRNA as well as an increase in AQP2 protein expression as a result of dehydration has been documented by several groups (48, 52). To determine whether AQP2 expression in the vas deferens is also regulated by vasopressin and/or by dehydration, tissue from groups of four rats dehydrated for 12 and 36 h was evaluated for AQP2 at the transcriptional level (mRNA) using Northern blot analysis, and at the protein level using immunofluorescence and Western blotting. Urine osmolalities rose from a mean of 1,319 ± 276 to 2,285 ± 189 (n = 4) after 36 h of dehydration.

Northern blotting. Northern blots comparing 1.5 µg of mRNA from the vas deferens of control rats with those subjected to 12 and 36 h of thirsting showed a marked increase in AQP2 transcription after dehydration (Fig. 5, lanes 1-3). As expected, mRNA levels in the papilla were also increased by dehydration (Fig. 5, lanes 4 and 5).


View larger version (100K):
[in this window]
[in a new window]
 
Fig. 5.   Northern blot showing mRNA levels in vas deferens epithelial sock from control rats (lane 1) and after 12- (lane 2) and 36-h (lane 3) dehydration of animals. mRNA levels in renal papilla of the same rats are shown for comparison in lanes 4 (control) and 5 (12 h dehydration). Equal amounts of mRNA were loaded onto each lane (1.5 µg).

Western blotting. Western blotting to compare the amount of AQP2 protein in 36-h dehydrated and control vas deferens showed no consistent difference between the two groups (Fig. 6, lanes 1 and 2). However, as expected, a marked increase of AQP2 protein was detected in the dehydrated papilla compared with that of the control papilla (Fig. 6, lanes 3 and 4). It is interesting that the higher molecular weight band representing glycosylated AQP2 in the papilla (Fig. 6, arrowhead) was often undetectable in the vas deferens, but could be visualized when blots were developed for longer periods of time (see Fig. 4 for example).


View larger version (75K):
[in this window]
[in a new window]
 
Fig. 6.   Detection of AQP2 by Western blotting in vas deferens and papilla of normal rats before and after dehydration. Amount of AQP2 protein is unchanged in vas deferens after 36-h dehydration (lane 1, control; lane 2, 36-h dehydration), whereas AQP2 is increased in renal papilla after the same period of dehydration (lane 3, control papilla; lane 4, papilla from 36-h dehydrated rat). Ten micrograms protein were loaded in lanes 1 and 2, and 20 µg in lanes 3 and 4. An actin loading control of the same gel is shown in bottom panel.

Immunofluorescence. Vas deferens from control and dehydrated rats were immunostained with anti-AQP2 antibodies. A strong apical labeling, as seen in Fig. 2C, was present in both the control and dehydrated tissues, with no detectable change in the distribution of AQP2 or apparent staining intensity between the two groups (data not shown).

AQP2 Localization in Vasopressin-Deficient Brattleboro Rats

To evaluate whether vasopressin is required for the membrane expression of AQP2 in the vas deferens, AQP2 distribution was examined by immunofluorescence microscopy in homozygous Brattleboro rats before and after treatment with dDAVP. Urine osmolalities were taken before (203 and 211 mosmol/kgH2O) and after (1,893 and 1,578 mosmol/kgH2O) implantation of vasopressin Alzet osmotic minipumps containing dDAVP.

Immunofluorescence. Tissue from control Brattleboro rats showed strong apical staining for AQP2 with very little intracellular staining (Fig. 7A), and cells from the ampulla of the vasopressin-treated animals exhibited no apparent alteration in the AQP2 staining pattern compared with that of the untreated Brattleboro tissue (data not shown).


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 7.   A: immunofluorescence AQP2 staining of vas deferens from control Brattleboro homozygous rat, showing intense apical staining for AQP2 (yellow/green) with little intracellular vesicular staining. Red background stain is a counterstain to allow visualization of the tissue. Bar = 25 µm. B: Western blotting to show AQP2 protein levels in vas deferens of control Brattleboro homozygous rats (lane 1), and after vasopressin infusion for 72 h (lane 2). Protein levels in vas deferens are unchanged after vasopressin infusion. In contrast, AQP2 levels in renal papilla are increased after vasopressin treatment (control, lane 3; vasopressin treated, lane 4). Amount of glycosylated AQP2 (arrowhead) is much less in vas deferens than in papilla. Arrow, nonglycosylated AQP2 band at 29 kDa. Note also that amount of AQP2 in papilla of Brattleboro rats is less than that in papilla of normal Sprague-Dawley rats (see Fig. 6, lanes 3 and 4). Ten micrograms protein were loaded in lanes 1 and 2, and 20 µg in lanes 3 and 4. C, D: serial sections of vas deferens incubated with anti-AQP2 antibody alone (C) or with antibody that had been preincubated with immunizing peptide (D). Staining is completely inhibited in D, showing that staining is specific. Bar = 12.5 µm.

Western blotting. Western blotting of equal quantities of ampulla epithelial protein from control and treated Brattleboro rats indicated no detectable change in AQP2 levels after 3 days of vasopressin treatment. In contrast, an increase in AQP2 protein was found, as expected, in the papilla of vasopressin-treated animals, although this increase was not as marked as that reported in some previous studies (Fig. 7B).

Figure 7 shows the specificity of AQP2 staining in the ampulla of the vas deferens. The strong apical staining (Fig. 7C) is completely abolished by preincubating the affinity-purified antibody with the immunizing peptide (Fig. 7D).

AQP2 Distribution After Colchicine-Induced Microtubule Disruption

Microtubule disruption by colchicine in vivo disrupts the trafficking and targeting of several recycling membrane proteins, including AQP2 in principal cells (14, 50). After 12 h of in vivo treatment with colchicine, the microtubule network of vas deferens principal cells was grossly modified, indicating that depolymerization had occurred (data not shown). A narrow apical band of tubulin staining was still detectable, however, reminiscent of the pattern of residual tubulin staining in renal epithelial cells after in vivo colchicine delivery (1). Despite extensive microtubule disruption, a considerable amount of AQP2 staining was still present on the apical membrane of these cells, similar to the distribution in nontreated cells (Fig. 8). Very little intracellular vesicular staining was seen, indicating that the apical membrane protein is not actively recycling. Unexpectedly, a significant amount of basolateral membrane staining was also present in colchicine-treated cells (Fig. 8B).


View larger version (116K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of colchicine treatment on AQP2 distribution in rat vas deferens. A: AQP2 staining in control rat vas deferens, showing intense apical localization. B: AQP2 localization in vas deferens from a colchicine-treated rat. Bright apical staining remains, but a marked basolateral membrane staining is now present in these colchicine-treated cells. Bar = 20 µm.

AQP2 is not Concentrated in Apical Endosomes: Texas Red-Dextran Endocytosis

To investigate whether AQP2 is actively internalized by endocytic vesicles in the vas deferens, Texas Red-dextran was used as a marker of fluid-phase endocytosis. The vas deferens was cut open and bathed in Texas Red-dextran (5 mg/ml) for 15 min, followed by rapid washing and fixation with PLP. The tissue was then sectioned and stained for AQP2 through the use of a secondary FITC-labeled anti-rabbit IgG. Although many apical endosomes were labeled with Texas Red, indicating extensive endocytotic activity in these cells, these endosomes showed very little if any green labeling for AQP2 (Fig. 9). Any overlap would have been detectable as a yellow endosomal staining. Thus AQP2 is not part of an active apical endocytotic pathway in principal cells of the vas deferens.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9.   Cryostat section of rat vas deferens incubated in vitro with Texas Red-dextran and double-stained with anti-AQP2 antibodies. Many apical vesicles contain Texas Red-dextran (orange/red) indicating active endocytosis in these cells. However, no AQP2 staining (green) is located in labeled endosomes. In contrast, AQP2 staining is largely restricted to apical plasma membrane and extensive stereocilia that project far into the tubule lumen. Bar = 8 µm.

Vasopressin-Receptor Binding Assay

Membranes from vas deferens socks and from the renal papilla were assayed for the presence of vasopressin V1 and V2 receptors by a radiolabeled vasopressin binding assay. Little or no specific vasopressin binding to vas deferens membranes was detectable, even when the amount of membrane added to the assay was doubled from 100 to 200 µg. Under identical assay conditions, considerable binding was found in membranes from the renal papilla, as expected (Fig. 10).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 10.   Binding of vasopressin to vas deferens and papilla membranes. Little or no binding is detectable in vas deferens, whereas significant binding is detected in membranes from renal papilla.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

AQP2 was originally identified in the kidney collecting duct (26). Several groups have provided evidence that it functions as the vasopressin-sensitive water channel in principal cells of this segment of the urinary tubule (19, 20, 31, 47, 50). Unexpectedly, we recently found that AQP2 is also present in the vas deferens of the male reproductive tract, where it is located on the apical plasma membrane of epithelial cells (46). In the present study, we now show that reproductive tract AQP2 is identical in nucleotide and amino acid sequence to renal AQP2, that it is delivered to the cell surface in a constitutive exocytotic pathway, and that it is not regulated by vasopressin either acutely or chronically in this tissue. This is in contrast to renal AQP2, which is targeted to the cell surface in a hormonally regulated exocytotic pathway (3). Thus the sorting information present within the AQP2 protein is differentially interpreted by these two cell types. Furthermore, vasopressin receptors were not detectable by hormone binding assays in the vas deferens, indicating that AQP2 cannot be regulated by antidiuretic hormone in these cells. Such cellular specificity of targeting pathways is not restricted to AQP2. It has been reported that AQP1 follows a cAMP-regulated pathway of membrane insertion in cholangiocytes (41), whereas it is constitutively inserted in most other cells (3). These findings complicate the search for specific targeting signals on aquaporins, and show that such signals can be interpreted differently in a cell type-dependent manner.

The function of AQP2 in the vas deferens is probably related to the maintenance of an appropriate luminal environment in which sperm can continue their maturation. Sperm concentration by fluid extraction from the lumen begins in the efferent ducts distal to the seminiferous tubules, where another water channel, AQP1, is abundant (15, 24). So far, aquaporins have not been identified in the epididymis, but AQP1 is found in the vas deferens, where it is most concentrated on the basolateral membrane (15). Thus, as in the kidney collecting duct, vas deferens epithelial cells engage in transepithelial fluid transport by inserting different aquaporins into distinct plasma membrane domains. Because short-term regulation of aquaporin membrane insertion does not seem to occur in the vas deferens, the reason for the presence of both AQP1 and AQP2 in the same cells is unclear. The proximal tubule, for example, achieves a similar function by inserting the same water channel into both apical and basolateral plasma membrane domains (49, 51). However, it has recently been shown that proximal tubule S3 segments in mouse kidney express AQP4 on their basolateral membrane (54), providing another example of the insertion of different aquaporins into the same membrane domain.

The distribution of AQP2 is heterogeneous along the length of the vas deferens. We have previously shown that the initial portion of the vas deferens, immediately distal to the epididymis, contains H+-ATPase-rich, proton-secreting cells, in addition to so-called principal cells (9). However, the principal cells in this early segment do not contain AQP2 or any other known aquaporin (data not shown). In the intermediate portion of the vas deferens, AQP2-positive cells begin to appear among the other epithelial cells, and in the ampulla of the vas deferens, all epithelial cells contain apical AQP2. This result indicates that the vas deferens has not only regional, but also cellular heterogeneity. This supports the idea that the vas deferens is not simply a conduit for the transit of spermatozoa, but that it can actively modify its luminal environment in ways that have as yet unknown consequences for reproductive function (33). It is interesting that only the ampulla of the vas deferens contains detectable AQP2. This region also contains the highest levels of AQP1 (15). The initial segment of the vas deferens adjacent to the epididymis, which has a much thinner muscular and connective tissue wall, may be less water permeable. The considerably thicker wall of the ampulla may, in addition to other functions, also serve as a barrier that protects this water-permeable segment from acute variations in whole-body fluid and electrolyte balance. It would presumably be detrimental to fertility if, during episodes of dehydration, fluid were extracted from the vas deferens, resulting in a more viscous and possibly immotile luminal content.

In the collecting duct, AQP2 is rapidly recycled between the plasma membrane and intracellular vesicles (3). This trafficking process can be disrupted by microtubule depolymerization, which results in the scattering of AQP2-containing vesicles throughout the cytoplasm of principal cells (50). Other rapidly recycling membrane proteins, including megalin/gp330 in proximal tubules (29) and proton pumps (H+-ATPase) in intercalated cells and proximal tubules (13) are also disrupted in a similar manner by microtubule depolymerization. In contrast, proteins that follow a constitutive exocytotic pathway and that are not rapidly recycled, including carbonic anhydrase type IV and dipeptidyl peptidase IV in the proximal tubule, and basolateral facilitated glucose transporters and the Cl-/HCO-3 exchanger AE1 in intercalated cells, do not show any detectable redistribution into cytoplasmic vesicles even several hours after microtubule disruption (12, 14). The continued abundance of apical AQP2 in the vas deferens after colchicine treatment indicates, therefore, that this protein does not enter a rapid recycling pathway in this cell type, and that its membrane half-life is considerably longer than that of AQP2 in collecting duct principal cells. This is supported by the immunocytochemical data showing a relative paucity of AQP2-containing vesicles in the cytoplasm of vas deferens epithelial cells. The absence of AQP2 from apical endosomes that contain the fluid-phase marker Texas Red-dextran in these cells also indicates that AQP2 is excluded from segments of the membrane that are destined for internalization. Electron microscopy showed that AQP2 is not concentrated in apical clathrin-coated pits in these cells, consistent with its absence from apical endosomes, although non-clathrin-mediated mechanisms of endocytosis, involving caveolae and H+-ATPase-coated vesicles for example, may be operational in some cell types (8, 12, 53).

An unexpected finding, however, was that AQP2 in the vas deferens was clearly detectable on the basolateral plasma membrane of epithelial cells after microtubule disruption. This is similar to the reported appearance of alkaline phosphatase, normally an exclusively apical protein, on the basolateral surface of intestinal enterocytes after in vivo treatment of rats with colchicine (2, 30). Although this result was interpreted as reflecting the redistribution of apical protein to the basolateral cell surface of the enterocyte, there is an alternative explanation. It is possible that proteins that show this behavior after microtubule disruption are first delivered to the basolateral plasma membrane after synthesis, from where they are relocated to the apical membrane by transcytosis. These proteins, therefore, may follow an indirect route of targeting to their final destination. Although the biological advantage of such an indirect targeting pathway is generally unknown, it has been reported for several proteins in a variety of cell types, including hepatocytes (4) and intestinal absorptive cells (17). In the case of AQP2 in the vas deferens, further studies to distinguish the intracellular fate of preexisting vs. newly synthesized AQP2 after microtubule disruption will be necessary. It is interesting to note that basolateral AQP2 has also been detected in collecting duct principal cells under some conditions, including exposure of tubules to low temperature (7).

The regulation of AQP2 expression in the vas deferens is distinct from that in the collecting duct, but there are also some similarities. Our initial studies showed that a 14-kb region of the aquaporin gene promoter region was able to drive expression of a CRE recombinase reporter construct in these cells in transgenic mice (46), suggesting that some aspects of the transcriptional regulation of the AQP2 gene may be common to the kidney and the vas deferens. Indeed, in the present study, dehydration of rats resulted in a large increase in AQP2 mRNA in both vas deferens and renal papilla, but an increase in AQP2 protein was detectable only in the papilla. The explanation for this finding is unknown, but could include message instability, rapid protein degradation, or some other undetermined disconnect between mRNA levels and mRNA translation. However, it is important to note that no consistent differences in protein content and intracellular location were detectable between normal rats and vasopressin-deficient Brattleboro homozygous rats. Thus transcription of the AQP2 gene does not appear to depend on the interaction of vasopressin with the V2 receptor, as is the case in renal principal cells. This suggestion was confirmed by our inability to detect vasopressin receptors by radiolabeled vasopressin binding assays in vas deferens epithelial cell membranes. Thus the mRNA increase seen in the vas deferens after dehydration is the result of an as yet unknown physiological or hormonal stimulus.

One clear difference between AQP2 from the collecting duct and the vas deferens is the extent of glycosylation, as determined from the relative density of the higher molecular weight band detected with anti-AQP2 antibodies. Although extensive glycosylated AQP2 was detectable in the papillary tissue, the glycosylated band was detectable in the vas deferens only when blots were developed for longer periods of time. Gel densitometry revealed that between 38 and 59% of the AQP2 in kidney was glycosylated, whereas in the vas deferens this value was between 0 and 5% in blots that were not overexposed. It is possible that the glycosylation state of AQP2 could modify its intracellular targeting and trafficking, although it has been shown that unglycosylated AQP2 is targeted normally in transfected Madin-Darby canine kidney (MDCK) cells, and that it functions as a water channel (5). Although the general role of glycosylation of proteins is poorly understood, glycosylation has in some cases been shown to be necessary for the correct intracellular targeting, processing, and folding of some transmembrane and secreted proteins (6, 21-23, 42). However, an absence of correct glycosylation often results in defective delivery of membrane proteins to the cell surface (38, 40), not to an increased delivery as observed for AQP2 in the vas deferens. Nevertheless, the possibility that differences in AQP2 glycosylation are involved in AQP2 targeting in vivo is intriguing, and further work will be required to address this issue.

In summary, AQP2 is located in the apical plasma membrane of epithelial cells in the ampulla of the vas deferens. In these cells, it is a constitutive membrane protein, and is not regulated by vasopressin, either acutely or chronically. The epididymis and vas deferens of the male reproductive tract are, like the kidney collecting duct, derived from the Wolffian duct during development, and the presence of AQP2 in these tissues may reflect this common embryological origin.


    ACKNOWLEDGEMENTS

We thank Mary McKee for help with the immunoelectron microscopy.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-38452 (D. Brown, S. Breton), K0-8 DK-02132-06 (R. D. Nelson), and DK-52043 (D. E. Kohan), by a fellowship from the Heart and Stroke Foundation of Canada (R. Bouley), and by a Claflin Distinguished Investigator award from the Massachusetts General Hospital (S. Breton).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: D. Brown, Renal Unit, MGH-East, 149 13th St., Charlestown, MA 02129 (E-mail: brown{at}receptor.mgh.harvard.edu).

Received 31 August 1999; accepted in final form 29 October 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abbate, M, Bonventre JV, and Brown D. The microtubule network of renal epithelial cells is disrupted by ischemia and reperfusion. Am J Physiol Renal Fluid Electrolyte Physiol 267: F971-F978, 1994[Abstract/Free Full Text].

2.   Achler, C, Filmer D, Merte C, and Drenckhahn D. Role of microtubules in polarized delivery of apical membrane proteins to the brush border of the intestinal epithelium. J Cell Biol 109: 179-189, 1989[Abstract/Free Full Text].

3.   Agre, P, Brown D, and Nielsen S. Aquaporin water channels: unanswered questions and unresolved controversies. Curr Opin Cell Biol 7: 472-483, 1995[Web of Science][Medline].

4.   Bartles, JR, and Hubbard AL. Biogenesis of the rat hepatocyte plasma membrane. Meth Enzymol 191: 825-841, 1990[Medline].

5.   Baumgarten, R, Van De Pol MH, Wetzels JF, Van Os CH, and Deen PM. Glycosylation is not essential for vasopressin-dependent routing of aquaporin-2 in transfected Madin-Darby canine kidney cells. J Am Soc Nephrol 9: 1553-1559, 1998[Abstract].

6.   Benting, JH, Rietveld AG, and Simons K. N-Glycans mediate the apical sorting of a GPI-anchored, raft-associated protein in Madin-Darby canine kidney cells. J Cell Biol 146: 313-320, 1999[Abstract/Free Full Text].

7.   Breton, S, and Brown D. Cold-induced microtubule disruption and relocalization of membrane proteins in kidney epithelial cells. J Am Soc Nephrol 9: 155-166, 1998[Abstract].

8.   Breton, S, Lisanti MP, Tyszkowski R, McLaughlin M, and Brown D. Basolateral distribution of caveolin-1 in the kidney: Absence from H+-ATPase-coated endocytic vesicles in intercalated cells. J Histochem Cytochem 46: 205-214, 1998[Abstract/Free Full Text].

9.   Breton, S, Smith PJ, Lui B, and Brown D. Acidification of the male reproductive tract by a proton pumping H+-ATPase. Nat Med 2: 470-472, 1996[Web of Science][Medline].

10.   Breton, S, Tyszkowski R, Sabolic I, and Brown D. Postnatal development of H+-ATPase (proton-pump)-rich cells in rat epididymis. Histochem Cell Biol 111: 97-105, 1999[Web of Science][Medline].

11.   Brown, D, Hirsch S, and Gluck S. Localization of a proton-pumping ATPase in rat kidney. J Clin Invest 82: 2114-2126, 1988.

12.   Brown, D, and Sabolic I. Endosomal pathways for water channel and proton pump recycling in kidney epithelial cells. J Cell Sci (Suppl) 17: 49-59, 1993[Medline].

13.   Brown, D, Sabolic I, and Gluck S. Colchicine-induced redistribution of proton pumps in kidney epithelial cells. Kidney Int 40, Suppl 33: S79-S83, 1991.

14.   Brown, D, and Stow JL. Protein trafficking and polarity in kidney epithelium: from cell biology to physiology. Physiol Rev 76: 245-297, 1996[Abstract/Free Full Text].

15.   Brown, D, Verbavatz JM, Valenti G, Lui B, and Sabolic I. Localization of the CHIP28 water channel in reabsorptive segments of the rat male reproductive tract. Eur J Cell Biol 61: 264-273, 1993[Web of Science][Medline].

16.   Butlen, D, Guillon G, Rajerison RM, Jard S, Sawyer WH, and Manning M. Structural requirements for activation of vasopressin-sensitive adenylate cyclase, hormone binding, and antidiuretic actions: effects of highly potent analogs and competitive inhibitors. Mol Pharmacol 14: 1006-1017, 1978[Abstract/Free Full Text].

17.   Casanova, JE, Breitfeld PP, Ross SA, and Mostov KE. Phosphorylation of the polymeric immunoglobulin receptor required for its efficient transcytosis. Science 248: 742-745, 1990[Abstract/Free Full Text].

18.   Clulow, J, Jones RC, and Hansen LA. Micropuncture and cannulation studies of fluid composition and transport in the ductuli efferentes testis of the rat: comparison with the homologous metanephric proximal tubule. Exp Physiol 79: 915-928, 1994[Abstract].

19.   Deen, PM, Verdijk MA, Knoers NV, Wieringa B, Monnens LA, van Os CH, and van Oost BA. Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine. Science 264: 92-95, 1994[Abstract/Free Full Text].

20.   DiGiovanni, SR, Nielsen S, Christensen EI, and Knepper MA. Regulation of collecting duct water channel expression by vasopressin in Brattleboro rat. Proc Natl Acad Sci USA 91: 8984-8988, 1994[Abstract/Free Full Text].

21.   Dwek, RA. Biological importance of glycosylation. Dev Biol Stand 96: 43-47, 1998[Web of Science][Medline].

22.   Fan, H, Meng W, Kilian C, Grams S, and Reutter W. Domain-specific N-glycosylation of the membrane glycoprotein dipeptidylpeptidase IV (CD26) influences its subcellular trafficking, biological stability, enzyme activity and protein folding. Eur J Biochem 246: 243-251, 1997[Web of Science][Medline].

23.   Fayadat, L, Niccoli-Sire P, Lanet J, and Franc JL. Human thyroperoxidase is largely retained and rapidly degraded in the endoplasmic reticulum. Its N-glycans are required for folding and intracellular trafficking. Endocrinology 139: 4277-4285, 1998[Abstract/Free Full Text].

24.   Fisher, JS, Turner KJ, Fraser HM, Saunders PT, Brown D, and Sharpe RM. Immunoexpression of aquaporin-1 in the efferent ducts of the rat and marmoset monkey kidney during development, its modulation by estrogens, and its possible role in fluid resorption. Endocrinology 139: 3935-3945, 1998[Abstract/Free Full Text].

25.   Fushimi, K, Sasaki S, and Marumo F. Phosphorylation of serine 256 is required for cAMP-dependent regulatory exocytosis of the aquaporin-2 water channel. J Biol Chem 272: 14800-14804, 1997[Abstract/Free Full Text].

26.   Fushimi, K, Uchida S, Hara Y, Hirata Y, Marumo F, and Sasaki S. Cloning and expression of apical membrane water channel of rat kidney collecting tubule. Nature 361: 549-552, 1993[Medline].

27.   Gellai, M, Silverstein JH, Hwang JC, LaRochelle FT, Jr, and Valtin H. Influence of vasopressin on renal hemodynamics in conscious Brattleboro rats. Am J Physiol Renal Fluid Electrolyte Physiol 246: F819-F827, 1984[Abstract/Free Full Text].

28.   Gustafson, CE, Levine S, Katsura T, McLaughlin M, Aleixo MD, Tamarappoo BK, Verkman AS, and Brown D. Vasopressin regulated trafficking of a green fluorescent protein-aquaporin 2 chimera in LLC-PK1 cells. Histochem Cell Biol 110: 377-386, 1998[Web of Science][Medline].

29.   Gutmann, EJ, Niles JL, McCluskey RT, and Brown D. Colchicine-induced redistribution of an endogenous apical membrane glycoprotein (gp 330) in kidney proximal tubule epithelium. Am J Physiol Cell Physiol 257: C397-C407, 1989[Abstract/Free Full Text].

30.   Hasegawa, H, Watanabe K, Nakamura T, and Nagura H. Immunocytochemical localization of alkaline phosphatase in absorptive cells of rat small intestine after colchicine treatment. Cell Tissue Res 250: 521-529, 1987[Web of Science][Medline].

31.   Hayashi, M, Sasaki S, Tsuganezawa H, Monkawa T, Kitajima W, Konishi K, Fushimi K, Marumo F, and Saruta T. Expression and distribution of aquaporin of collecting duct are regulated by vasopressin V2 receptor in rat kidney. J Clin Invest 94: 1778-1783, 1994.

32.   Hinton, BT. The testicular and epididymal luminal amino acid microenvironment in the rat. J Androl 11: 498-505, 1990[Abstract/Free Full Text].

33.   Hinton, BT, Palladino MA, Rudolph D, Lan ZJ, and Labus JC. The role of the epididymis in the protection of spermatozoa. Curr Top Dev Biol 33: 61-102, 1996[Web of Science][Medline].

34.   Hohlbrugger, G. A micropuncture study of transepithelial water reabsorption in rat ductuli efferentes. Fertil Steril 34: 50-54, 1980[Web of Science][Medline].

35.   Hohlbrugger, G, and Pfaller K. Post-vasectomy impairment of transepithelial water reabsorption in the initial segment of the epididymis. Arch Androl 11: 265-270, 1983[Web of Science][Medline].

36.   Hozawa, S, Holtzman EJ, and Ausiello DA. cAMP motifs regulating transcription in the aquaporin 2 gene. Am J Physiol Cell Physiol 270: C1695-C1702, 1996[Abstract/Free Full Text].

37.   Katsura, T, Gustafson CE, Ausiello DA, and Brown D. Protein kinase A phosphorylation is involved in regulated exocytosis of aquaporin-2 in transfected LLC-PK1 cells. Am J Physiol Renal Physiol 272: F817-F822, 1997[Abstract].

38.   Lanctot, PM, Leclerc PC, Escher E, Leduc R, and Guillemette G. Role of N-glycosylation in the expression and functional properties of human AT1 receptor. Biochemistry 38: 8621-8627, 1999[Medline].

39.   Lencer, WI, Weyer P, Verkman AS, Ausiello DA, and Brown D. FITC-dextran as a probe for endosome function and localization in kidney. Am J Physiol Cell Physiol 258: C309-C317, 1990[Abstract/Free Full Text].

40.   Lu, X, Mehta A, Dadmarz M, Dwek R, Blumberg BS, and Block TM. Aberrant trafficking of hepatitis B virus glycoproteins in cells in which N-glycan processing is inhibited. Proc Natl Acad Sci USA 94: 2380-2385, 1997[Abstract/Free Full Text].

41.   Marinelli, RA, Tietz PS, Pham LD, Rueckert L, Agre P, and LaRusso NF. Secretin induces the apical insertion of aquaporin-1 water channels in rat cholangiocytes. Am J Physiol Gastrointest Liver Physiol 276: G280-G286, 1999[Abstract/Free Full Text].

42.   Martina, JA, Daniotti JL, and Maccioni HJ. Influence of N-glycosylation and N-glycan trimming on the activity and intracellular traffic of GD3 synthase. J Biol Chem 273: 3725-3731, 1998[Abstract/Free Full Text].

43.   Matsumura, Y, Uchida S, Rai T, Sasaki S, and Marumo F. Transcriptional regulation of aquaporin-2 water channel gene by cAMP. J Am Soc Nephrol 8: 861-867, 1997[Abstract].

44.   McLean, IW, and Nakane PK. Periodate-lysine-paraformaldehyde fixative. A new fixation for immunoelectron microscopy. J Histochem Cytochem 22: 1077-1083, 1974[Abstract].

45.   Mulders, SM, Van Lieburg AF, Monnens LA, Knoers NV, Deen PM, and Van Os C. Physiology and pathophysiology of aquaporins. Eur J Clin Invest 26: 1041-1050, 1996[Web of Science][Medline].

46.   Nelson, RD, Stricklett P, Gustafson C, Stevens A, Ausiello D, Brown D, and Kohan DE. Expression of an AQP2 Cre recombinase transgene in kidney and male reproductive system of transgenic mice. Am J Physiol Cell Physiol 275: C216-C226, 1998[Abstract/Free Full Text].

47.   Nielsen, S, Chou CL, Marples D, Christensen EI, Kishore BK, and Knepper MA. Vasopressin increases water permeability of kidney collecting duct by inducing translocation of aquaporin-CD water channels to plasma membrane. Proc Natl Acad Sci USA 92: 1013-1017, 1995[Abstract/Free Full Text].

48.   Nielsen, S, Marples D, Frokiaer J, Knepper M, and Agre P. The aquaporin family of water channels in kidney: an update on physiology and pathophysiology of aquaporin-2. Kidney Int 49: 1718-1723, 1996[Web of Science][Medline].

49.   Nielsen, S, Smith BL, Christensen EI, Knepper MA, and Agre P. CHIP28 water channels are localized in constitutively water-permeable segments of the nephron. J Cell Biol 120: 371-383, 1993[Abstract/Free Full Text].

50.   Sabolic, I, Katsura T, Verbavatz JM, and Brown D. The AQP2 water channel: effect of vasopressin treatment, microtubule disruption, and distribution in neonatal rats. J Membr Biol 143: 165-175, 1995[Web of Science][Medline].

51.   Sabolic, I, Valenti G, Verbavatz J-M, Van Hoek AN, Verkman AS, Ausiello DA, and Brown D. Localization of the CHIP28 water channel in rat kidney. Am J Physiol Cell Physiol 263: C1225-C1233, 1992[Abstract/Free Full Text].

52.   Sasaki, S, Fushimi K, Ishibashi K, and Marumo F. Water channels in the kidney collecting duct. Kidney Int 48: 1082-1087, 1995[Web of Science][Medline].

53.   Van Deurs, B, Holm PK, Sandvig K, and Hansen SH. Are caveolae involved in clathrin-independent endocytosis? Trends Cell Biol 3: 249-251, 1993.

54.   Van Hoek, AN, Ma T, Yang B, Verkman AS, and Brown D. Aquaporin 4 is expressed in basolateral membranes of proximal tubule S3 segments in mouse kidney. Am J Physiol Renal Physiol 277: F310-F316, 2000.

55.   Wong, PY, and Yeung CH. Absorptive and secretory functions of the perfused rat cauda epididymis. J Physiol (Lond) 275: 13-26, 1978[Abstract/Free Full Text].

56.   Wong, YC, Wong PY, and Yeung CH. Ultrastructural correlation of water reabsorption in isolated rat cauda epididymidis. Experientia 34: 485-487, 1978[Web of Science][Medline].


Am J Physiol Cell Physiol 278(4):C791-C802
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
M. T. Skowronski, A. Leska, A. Robak, and S. Nielsen
Immunolocalization of Aquaporin-1, -5, and -7 in the Avian Testis and Vas Deferens
J. Histochem. Cytochem., October 1, 2009; 57(10): 915 - 922.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
U. Hasler
Controlled aquaporin-2 expression in the hypertonic environment
Am J Physiol Cell Physiol, April 1, 2009; 296(4): C641 - C653.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. M. Pastor-Soler, K. R. Hallows, C. Smolak, F. Gong, D. Brown, and S. Breton
Alkaline pH- and cAMP-induced V-ATPase membrane accumulation is mediated by protein kinase A in epididymal clear cells
Am J Physiol Cell Physiol, February 1, 2008; 294(2): C488 - C494.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. M Hagedorn, R. W Carlin, and B. D Schultz
Oxytocin and Vasopressin Stimulate Anion Secretion by Human and Porcine Vas Deferens Epithelia
Biol Reprod, September 1, 2007; 77(3): 416 - 424.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
D. Lodewyck, B. Menco, and K. Fisher
Immunolocalization of Aquaporins in Vocal Fold Epithelia
Arch Otolaryngol Head Neck Surg, June 1, 2007; 133(6): 557 - 563.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
X. Yi, R. Bouley, H. Y. Lin, S. Bechoua, T.-x. Sun, E. del Re, T. Shioda, M. K. Raychowdhury, H. A. J. Lu, A. B. Abou-Samra, et al.
Alix (AIP1) is a vasopressin receptor (V2R)-interacting protein that increases lysosomal degradation of the V2R
Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1303 - F1313.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
H.-F. Huang, R.-H. He, C.-C. Sun, Y. Zhang, Q.-X. Meng, and Y.-Y. Ma
Function of aquaporins in female and male reproductive systems
Hum. Reprod. Update, November 1, 2006; 12(6): 785 - 795.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
B. Yang, D. Zhao, L. Qian, and A. S. Verkman
Mouse model of inducible nephrogenic diabetes insipidus produced by floxed aquaporin-2 gene deletion
Am J Physiol Renal Physiol, August 1, 2006; 291(2): F465 - F472.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. W. Carlin, R. L. Sedlacek, R. R. Quesnell, F. Pierucci-Alves, D. M. Grieger, and B. D. Schultz
PVD9902, a porcine vas deferens epithelial cell line that exhibits neurotransmitter-stimulated anion secretion and expresses numerous HCO3- transporters
Am J Physiol Cell Physiol, June 1, 2006; 290(6): C1560 - C1571.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. Da Silva, C. Silberstein, V. Beaulieu, C. Pietrement, A. N. Van Hoek, D. Brown, and S. Breton
Postnatal Expression of Aquaporins in Epithelial Cells of the Rat Epididymis
Biol Reprod, February 1, 2006; 74(2): 427 - 438.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. A. Fenton, A. Shodeinde, and M. A. Knepper
UT-A urea transporter promoter, UT-A{alpha}, targets principal cells of the renal inner medullary collecting duct
Am J Physiol Renal Physiol, January 1, 2006; 290(1): F188 - F195.
[Abstract] [Full Text] [PDF]


Home page
J Intensive Care MedHome page
A. S. Dumont, E. C. Nemergut II, J. A. Jane Jr, and E. R. Laws Jr
Postoperative Care Following Pituitary Surgery
J Intensive Care Med, May 1, 2005; 20(3): 127 - 140.
[Abstract] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. C. Branes, B. Morales, M. Rios, and M. J. Villalon
Regulation of the immunoexpression of aquaporin 9 by ovarian hormones in the rat oviductal epithelium
Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1048 - C1057.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. L. Miller, P. Zhang, M. Smith, V. Beaulieu, T. G. Paunescu, D. Brown, S. Breton, and R. D. Nelson
V-ATPase B1-subunit promoter drives expression of EGFP in intercalated cells of kidney, clear cells of epididymis and airway cells of lung in transgenic mice
Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1134 - C1144.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. A. Bertrand and R. A. Frizzell
The role of regulated CFTR trafficking in epithelial secretion
Am J Physiol Cell Physiol, July 1, 2003; 285(1): C1 - C18.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Brown
The ins and outs of aquaporin-2 trafficking
Am J Physiol Renal Physiol, May 1, 2003; 284(5): F893 - F901.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Zharkikh, X. Zhu, P. K. Stricklett, D. E. Kohan, G. Chipman, S. Breton, D. Brown, and R. D. Nelson
Renal principal cell-specific expression of green fluorescent protein in transgenic mice
Am J Physiol Renal Physiol, December 1, 2002; 283(6): F1351 - F1364.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. Pastor-Soler, C. Isnard-Bagnis, C. Herak-Kramberger, I. Sabolic, A. Van Hoek, D. Brown, and S. Breton
Expression of Aquaporin 9 in the Adult Rat Epididymal Epithelium Is Modulated by Androgens
Biol Reprod, June 1, 2002; 66(6): 1716 - 1722.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
N. Pastor-Soler, C. Bagnis, I. Sabolic, R. Tyszkowski, M. McKee, A. Van Hoek, S. Breton, and D. Brown
Aquaporin 9 Expression along the Male Reproductive Tract
Biol Reprod, August 1, 2001; 65(2): 384 - 393.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. A. Spector, J. B. Wade, R. Dillow, D. A. Steplock, and E. J. Weinman
Expression, localization, and regulation of aquaporin-1 to -3 in rat urothelia
Am J Physiol Renal Physiol, June 1, 2002; 282(6): F1034 - F1042.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
T.-X. Sun, A. Van Hoek, Y. Huang, R. Bouley, M. McLaughlin, and D. Brown
Aquaporin-2 localization in clathrin-coated pits: inhibition of endocytosis by dominant-negative dynamin
Am J Physiol Renal Physiol, June 1, 2002; 282(6): F998 - F1011.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (33)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stevens, A. L.
Right arrow Articles by Brown, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stevens, A. L.
Right arrow Articles by Brown, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online