|
|
||||||||
1 Program in Membrane Biology & Renal Unit, Massachusetts General Hospital, and Departments of 2 Medicine and 4 Pathology, Harvard Medical School, Boston, Massachusetts 02114; and 3 Division of Nephrology, University of Utah Health Sciences Center, Salt Lake City, Utah 84132
| |
ABSTRACT |
|---|
|
|
|---|
Aquaporin 2 (AQP2), the vasopressin-regulated water channel, was originally identified in renal collecting duct principal cells. However, our recent description of AQP2 in the vas deferens indicated that this water channel may have extra-renal functions, possibly related to sperm concentration in the male reproductive tract. In this study, we have examined the regulation and membrane insertion pathway of AQP2 in the vas deferens. The amino acid sequence of vas deferens AQP2 showed 100% identity to the renal protein. AQP2 was highly expressed in the distal portion (ampulla) of the vas deferens, but not in the proximal portion nearest the epididymis. It was concentrated on the apical plasma membrane of vas deferens principal cells, and very little was detected on intracellular vesicles. Protein expression levels and cellular localization patterns were similar in normal rats and vasopressin-deficient Brattleboro homozygous rats, and were not changed after 36 h of dehydration, or after 3 days of vasopressin infusion into Brattleboro rats. AQP2 was not found in apical endosomes (labeled with Texas Red-dextran) in vas deferens principal cells, indicating that it is not rapidly recycling in this tissue. Finally, vasopressin receptors were not detectable on vas deferens epithelial cell membranes using a [3H]vasopressin binding assay. These data indicate that AQP2 is a constitutive apical membrane protein in the vas deferens, and that it is not vasopressin-regulated in this tissue. Thus AQP2 contains targeting information that can be interpreted in a cell-type-specific fashion in vivo.
water channels; indirect immunofluorescence; cell polarity; endocytosis; male reproductive tract
| |
INTRODUCTION |
|---|
|
|
|---|
AQUAPORIN 2 (AQP2) is a member of a family of water channel proteins that are expressed in a wide variety of cells and tissues. Originally found in the collecting duct of the kidney (26), AQP2 is regulated by the antidiuretic hormone vasopressin (ADH), and its trafficking to the cell surface increases the transepithelial reabsorption of water by principal cells (20, 31, 47, 50). Inadequate cell surface expression of AQP2 results in nephrogenic diabetes insipidus (19, 45).
The urinary concentrating capacity of the collecting duct is regulated both acutely and chronically by vasopressin. Vasopressin binding to its receptor leads to an increase in intracellular cAMP, and AQP2 is then phosphorylated at serine 256 by protein kinase A. This phosphorylation event is critical for the rapid translocation of AQP2 from an intracellular vesicular storage site to the plasma membrane (25, 37). Thus AQP2 is delivered to the cell surface via a hormonally regulated exocytotic pathway in principal cells. Chronic AQP2 regulation occurs at the level of transcription and translation; the AQP2 gene promoter possesses a cAMP/cAMP-responsive element binding site that is activated at elevated intracellular cAMP concentrations (36, 43).
We have recently used a transgenic mouse approach to examine the cell-specific expression of AQP2 in vivo, using a 14-kb region of the human AQP2 promoter to drive expression of an epitope tag (CreTag) containing a nuclear localization sequence (46). Although the expected principal cell localization of the construct was observed in collecting ducts, it was also detected in principal cells of the vas deferens in the male reproductive tract. The vas deferens is derived from the Wolffian duct during embryogenesis and is part of the excurrent duct system responsible for the transport, storage, and maturation of sperm. During its passage through this system of tubules, the fluid composition of the lumen in which sperm reside is greatly modified, and the concentration of sperm in the lumen is increased significantly after production in the testes (32, 33). We have previously shown that another aquaporin, AQP1, is located in the efferent ducts where up to 90% of the seminiferous fluid can be absorbed after leaving the testis (15, 18, 34). In this respect, the efferent ducts resemble renal proximal tubules, which also absorb up to 80% of the glomerular ultrafiltrate (18). Several studies have shown that fluid reabsorption also occurs in other parts of the reproductive tract, notably the epididymis (35, 55, 56).
This study was designed to identify and characterize AQP2 in the vas deferens, and to determine whether its pattern of regulation and cell surface expression was similar to that previously described for this aquaporin in collecting duct principal cells. We found that bona fide AQP2 is expressed in the vas deferens, that this expression is variable in different segments of the vas deferens, and that the protein is constitutively expressed on the apical cell surface of principal cells.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
Two affinity-purified rabbit polyclonal antibodies against AQP2 peptides were used for Western blotting and immunocytochemistry in these studies. One was raised against the carboxy-terminal 16 amino acids of rat AQP2 (CVELHSPQSLPRGSKA), and the other against a 14-amino-acid segment from the second external loop of AQP2 (C-GDLAVNALHNNATA). Both antibodies have been previously characterized (28, 50). Antibodies were affinity purified with the SulfoLink Kit according to the manufacturer's instructions (Pierce, Rockford, IL). A polyclonal antibody was raised in chicken against the carboxy-terminal 14 amino acids of the 31-kDa subunit of the proton pump coupled to keyhole limpet hemocyanin, and was also affinity-purified as above. A monoclonal antibody against tubulin was purchased from Sigma (St. Louis, MO).Experimental Animals
Experiments were conducted using mature (300-350 g) male Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) or homozygous Brattleboro rats with central diabetes insipidus (Harlan Sprague-Dawley, Indianapolis, IN). As appropriate, rats were anesthetized using a pentobarbital sodium (50 mg/ml) injection of 0.15 ml/100 g body wt. Urine samples voided on Parafilm were taken from each rat before the anesthetization and the osmolality was measured with a Wescor 5500 Vapor Pressure Osmometer.Dehydration Experiments
Male Sprague-Dawley rats were divided into two groups of four. A constant supply of water was provided to one group, while the other group was thirsted for 12 or 36 h before anesthetization and removal of tissue. A sample of urine from each rat was taken and the urine osmolality tested.Vasopressin Infusion by Osmotic Minipump
Three homozygous Brattleboro rats were infused with vasopressin via Alzet Osmotic Mini Pumps (Alza, Palo Alto, CA) as described by Gellai et al. (27) while three served as controls for the experiment. Rats were lightly anesthetized by injection of 0.1 ml/100 g body wt pentobarbital sodium (50 mg/ml), and the osmotic minipumps were inserted subcutaneously between the shoulder blades. The pumps were loaded with ~90 µl of 0.125 µg/µl desamino-D-arginine vasopressin (dDAVP) in saline solution (0.9% NaCl). At a pumping rate of 0.96 µl/h, ~3 µg/day of vasopressin was delivered to the rats for 3 days. Urine samples were taken before implantation and just before anesthesia after 3 days of infusion.Colchicine Treatment
Four adult male Sprague-Dawley rats were injected with colchicine (0.5 ml/100 g body wt) in PBS (0.9% NaCl in 10 mM sodium phosphate buffer, pH 7.4) as previously described (29). Rats were anesthetized 12 h after colchicine treatment, and the kidneys and reproductive organs were perfusion-fixed for immunofluorescence as described below.Tissue Fixation
Sprague-Dawley and homozygous Brattleboro rats were anesthetized as described above. The kidney and male reproductive organs were fixed by cardiac perfusion via the left ventricle with Hanks' balanced salt solution for 1 min followed by paraformaldehyde lysine periodate (PLP) fixation. The original PLP recipe (44) was modified to increase the paraformaldehyde concentration from 2 to 4%. The kidney and reproductive organs, specifically the epididymis, vas deferens, and testis, were removed after 5 min of perfusion with PLP and placed in the same fixative at room temperature for 4-6 h. Tissue was washed three times in PBS and kept at 4°C before use.Enrichment of Epithelial Tissue from Vas Deferens: the Epithelial Sock Preparation
Because the bulk of the vas deferens consists of smooth muscle and connective tissue, it was necessary to enrich the preparation in epithelial tissue for more accurate and sensitive detection of AQP2 by Western blotting and mRNA analysis. We found that by gripping the epithelial layer at the cut end of the distal portion of the vas deferens with fine tweezers, and gently pulling, the entire internal distal epithelial layer could be removed from the surrounding connective tissue. Because of the shape of this tube, we have named this the epithelial sock preparation (Fig. 1A). This preparation consists mainly of epithelial cells on a basement membrane, plus a thin layer of surrounding connective tissue (Fig. 1B). However, we cannot exclude the possibility that a variable number of smooth muscle cells remained associated with the epithelial sock after dissection.
|
Western Blotting and mRNA Extraction
Several rats were anesthetized as above and the vas deferens and kidneys were removed. The papilla was dissected from each kidney; one was taken for protein extraction and the other for mRNA preparation. The epithelial tissue was separated from the distal portion of each vas deferens (see above), taking one epithelial sock for protein analysis and the other for mRNA extraction. All tissue was snap-frozen in liquid nitrogen before storing at
80°C until use.
Immunofluorescence
The PLP-fixed vas deferens were cryoprotected in a solution of 30% sucrose in PBS for ~2 h at room temperature. The distal portion was cut into 3- to 4-mm lengths and embedded in OTC Compound 4583 (Tissue-Tek, Sakura Finetechnical, Tokyo, Japan) on a cryostat cutting block. After rapidly freezing in liquid nitrogen, the tissue was cut on a Reichert Frigocut cryomicrotome and sections were placed on Fisher Superfrost Plus microscope slides (Fisher Scientific, Pittsburgh, PA) as previously described (10). Slides were placed in PBS for 10 min followed by preincubation in 1% BSA in PBS/0.02% sodium azide for 15 min. Sections were incubated in primary anti-AQP2 antibodies, diluted 1:100 in PBS/0.02% sodium azide, for 90 min at room temperature. Sections were washed twice for 5 min in high-salt PBS (containing 2.7% NaCl instead of 0.9%) to reduce nonspecific staining, and once in normal PBS. Sections were then incubated for 1 h with secondary antibody, goat anti-rabbit IgG coupled to fluorescein isothiocyanate (FITC; Jackson ImmunoResearch, West Grove, PA). The sections were again washed as described above. Double labeling was performed by subsequent incubation of some sections with a polyclonal chicken anti-H+-ATPase antibody and goat anti-chicken CY3. The slides were coverslipped, mounted in Vectashield (Vector Labs, Burlingame, CA) diluted 1:1 with Tris buffer, pH 8.5, and examined with a Nikon FXA epifluorescence microscope. Controls included incubation of sections with no primary antibody, with preimmune serum, or with affinity-purified antibody that had been preincubated with the peptide antigen used for immunization for 1 h at room temperature. Black and white photographs were taken using Kodak T-Max 400 film pushed to ASA 1600. Double-stained sections were digitally imaged using an Optronix 3-bit color CCD camera and IP Lab Spectrum software (Scanalytic, Vienna, VA). Final images were imported into and printed from Adobe Photoshop.Immunogold Staining for Electron Microscopy
The ampulla of the vas deferens was fixed by perfusion and then immersion in PLP (containing 4% paraformaldehyde). The tissue was left overnight, washed with PBS, and stored at 4°C in PBS containing 0.02% sodium azide until use. For immunogold labeling, segments of vas deferens fixed as above were embedded in Lowicryl K4M resin using a Leica AFS freeze-substitution apparatus (Leica, Deerfield, IL). After polymerization of the resin by ultraviolet (UV) light, thin sections were cut and incubated with affinity-purified anti-AQP2 external domain antibody (1:100) overnight at 4°C, rinsed, and incubated for 1 h at room temperature with goat anti-rabbit IgG coupled to 10 nm colloidal gold as described previously (11).Immunoblotting (SDS-PAGE and Western Blotting)
Frozen samples of vas deferens and papilla (three of each) were pooled and placed in 1 ml of lysis buffer [10 mM Tris, pH 7.4, 160 mM NaCl, 0.05% IGEPAL CA-630, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, complete protease inhibitor (Boehringer Mannheim, Mannheim, Germany), 0.2 mM phenylmethylsulfonyl fluoride (PMSF)]. The samples were homogenized using a 1-ml Dounce tissue grinder followed by shearing with a 27.5-gauge needle and 1-ml syringe. Samples were centrifuged at 12,000 g, and the protein concentration of the supernatant was determined using the Bradford assay (Bio-Rad, Hercules, CA). Protein was added 1:1 to Laemmli sample buffer [1% SDS, 30 mM Tris · HCl, pH 6.8, 5% 2-
-mercaptoethanol, 12% (vol/vol) glycerol]. Proteins were added at 10 µg/lane for vas deferens and 20 µg for papilla preparations, separated by SDS-PAGE, and transferred to Immobilon membranes as previously described (28,
50). Membranes were incubated for 90 min with affinity-purified AQP2
antibody (1:1,000 dilution), made against the external domain. Goat
anti-rabbit IgG conjugated to horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA) was applied to membranes, and they were
incubated for 1 h at room temperature. Proteins were detected using
Renaissance Western Blot Chemiluminescence Reagent (New England
Nuclear, Boston, MA).
mRNA Isolation
mRNA was isolated using the MicroPoly(A) Pure Kit (Ambion, Austin, TX) according to the protocol provided. Approximately three vas deferens epithelial socks or three kidney papillae were homogenized in 1 ml of lysis buffer and used for mRNA isolation. To concentrate the mRNA, it was precipitated using ammonium acetate and ethanol as directed.Northern Blot Analysis
Northern Blotting was performed with a NorthernMax Complete Northern Blotting Kit (Ambion) according to the manufacturer's instructions. Equal amounts of mRNA samples (1.5 µg) were combined with denaturing buffer (1:3 ratio, vol/vol) and heated at 70°C for 15 min. Samples were loaded on a 1% agarose denaturing gel and run at 80 V for 2.5 h. mRNA was transferred to BrightStar-Plus nylon membranes (Ambion), then fixed at 80°C for 15 min. An RNA probe for the AQP2 gene was transcribed that was complementary to the final 575 bp of the rat AQP2 gene using a MAXIscript In Vitro Transcription Kit (Ambion). The probe was labeled using a BrightStar Psoralen Biotin Non-Isotopic Probe Labeling Kit (Ambion). The RNA probe at a concentration of 50 ng/µl in TE buffer was labeled using Psoralin-Biotin under 354-nm UV light as instructed by the manufacturer. The membrane was hybridized with a 0.2 nM labeled probe overnight at 65°C. The incubated membrane was washed twice at low stringency followed by two high-stringency washes in preheated 65°C wash solution for 15 min each.Sequencing
mRNA (0.3 µg) obtained from the vas deferens epithelium was reverse transcribed using oligo(dT)12-18 and Superscript II as directed by the manufacturer (GIBCO-BRL, Gaithersburg, MD). Oligos were designed to flank the ends of the AQP2 mRNA sequence and add BamH I and EcoR I restriction endonuclease sites for cloning: AQP2-F, CGGGATCCATATGTGGGAACTCAGATCCAT; AQP2-R, CGGAATTCTCAGGCCTTGCTGCCGCGAGGC. The PCR-amplified DNA was purified from the agarose gel with the use of Wizard PCR Prep (Promega), digested with EcoR I and BamH I, and cloned into pcDNA3. A clone was chosen and the sequence was determined three times with the use of the Massachusetts General Hospital fluorescent ABI Prism core facility.Texas Red-Dextran Endocytosis
Endocytosis by the ampulla portion of the vas deferens was evaluated using Texas Red-dextran. The excised vas deferens was cut open longitudinally to expose the epithelium, and the tissue was incubated at room temperature in PBS containing 5 mg/ml Texas Red-dextran (Mr 10,000; Molecular Probes, Eugene, OR) for 15 min followed by rapid washing and fixation with PLP containing 4% paraformaldehyde and 5% sucrose as previously described for kidney tissue (39). To determine whether AQP2 was localized in endocytosed vesicles, cryostat sections of Texas Red-dextran-treated tissue were stained for AQP2 followed by FITC-conjugated secondary antibody, as described above.Vasopressin Binding in the Vas Deferens
A vasopressin binding assay was performed on membranes prepared from the vas deferens and the renal papilla (as a positive control). For each preparation, three to six vas deferens socks or papilla pieces were removed from normal rats and frozen in liquid nitrogen until use. After thawing in ice-cold hypotonic buffer (5 mM Tris · HCl, pH 7.4, 3 mM MgCl2, 1 mM EDTA) containing protease inhibitors (Complete, Boehringer-Mannheim), the tissues were minced and homogenized 3 × 10 s with a Polytron homogenizer at speed 3. The homogenate was centrifuged at 35,000 g for 20 min, and pellets were resuspended in hypotonic buffer to a final concentration of 2 mg/ml protein. Binding assays were performed as previously described (16). Two different concentrations (100 and 200 µg) of each membrane preparation were incubated for 15 min at 30°C in 250 µl of medium containing 50 mM Tris · HCl, pH 7.4, 0.75 mM MgCl2, 0.25 mM EDTA, 1 mg/ml BSA, and 9.5 nM [3H]vasopressin ([3H]AVP, 68.5 Ci/mmol; New England Nuclear). Nonspecific binding was determined in the presence of 10 µM unlabeled vasopressin (AVP; Sigma). The incubation was followed immediately by centrifugation at 10,000 g for 20 min at 4°C. The pellet was rinsed with 200 µl of cold assay buffer and solubilized in 100 µl of 0.1 N NaOH. Receptor-bound radioactivity was measured by liquid scintillation spectrometry. All assays were performed on triplicate samples.| |
RESULTS |
|---|
|
|
|---|
Immunocytochemistry
AQP2 staining was variable in different regions of the vas deferens. By immunofluorescence staining with two different antibodies against distinct AQP2 peptides, AQP2 was undetectable in the proximal vas deferens (Fig. 2A), and was localized predominantly in the distal portion of the vas deferens (the ampulla) at the apical pole of all principal cells (Fig. 2C). The apical stereocilia were strongly stained, but little or no cytoplasmic vesicular staining was detectable. In the middle portion, scattered positive principal cells were found among negative cells (Fig. 2B). Double staining with antibodies against the 31-kDa subunit of the H+-ATPase revealed that some of the negative cells were proton pump-rich cells, as previously described by Breton et al. (9). Other AQP2-negative cells were also unstained with the anti-H+-ATPase antibody, indicating a previously unsuspected heterogeneity among principal cells in this intermediate segment of the vas deferens. In the proximal region, closest to the epididymis, no AQP2-positive cells were detectable, but H+-ATPase-labeled cells were frequently found (Fig. 2A). Thus there was both cellular and regional heterogeneity in AQP2 staining along the vas deferens.
|
By electron microscopy, immunogold staining showed AQP2 labeling of the
apical plasma membrane and stereocilia of principal cells, and little
or no basolateral membrane staining. A few small subapical vesicles
were weakly labeled, but most were unlabeled (Fig.
3).
|
For both immunofluorescence and immunogold labeling, the positive staining was completely abolished by preabsorption of the antibodies with the corresponding immunizing peptides (see Fig. 7, C and D). No staining was seen when preimmune serum was substituted for immune serum in any of the incubations.
Western Blotting
For Western blotting, the vas deferens was divided into the three regions previously examined by immunofluorescence microscopy: proximal, middle, and distal (ampulla). The intensity of staining of the AQP2 bands correlated with the respective immunofluorescence staining of these regions, with the highest signal in the ampulla, little or no signal in the proximal region, and a weaker but variable signal in the intermediate zone, presumably resulting from our inability to identify the intermediate zone with precision during the dissection. In the ampulla, there was a large positive band at the expected molecular mass of ~29 kDa, and a smaller band at ~40 kDa (Fig. 4). This larger-molecular-mass band represents glycosylated AQP2, and is detectable in the distal vas deferens only after prolonged exposure of the film. In Fig. 4, overexposure was performed to confirm the absence of AQP2 from the proximal vas deferens. There is a smaller amount of the glycosylated product in the vas deferens compared with the kidney (see also Figs. 6 and 7). Antibodies against the cytoplasmic carboxy terminus and against an external domain of AQP2 gave similar results. The detection of positive bands by both antibodies was inhibited by preincubation of the antibodies with the immunizing peptide before incubation of the Immobilon transfers, and no staining was detected when preimmune serum was used in the incubations.
|
Sequencing of AQP2 from the Vas Deferens
To determine whether the protein detected by antibody staining and by Western blotting was bona fide AQP2, and not a related aquaporin that fortuitously contained peptide sequences recognized by the two different antibodies, we obtained the full-length sequence of vas deferens AQP2. In our previous report, less than 70% of the reproductive tract AQP2 sequence was determined (46). PCR was performed using primers that flank the end of the collecting duct AQP2 sequence while adding restriction sites for cloning. The full sequence for the water channel in the vas deferens was obtained in the present study, and the AQP2 sequence shows complete homology to that originally isolated from rat renal papilla (26; and data not shown).AQP2 Expression After Dehydration
In the collecting duct, an increase of transcription of AQP2 mRNA as well as an increase in AQP2 protein expression as a result of dehydration has been documented by several groups (48, 52). To determine whether AQP2 expression in the vas deferens is also regulated by vasopressin and/or by dehydration, tissue from groups of four rats dehydrated for 12 and 36 h was evaluated for AQP2 at the transcriptional level (mRNA) using Northern blot analysis, and at the protein level using immunofluorescence and Western blotting. Urine osmolalities rose from a mean of 1,319 ± 276 to 2,285 ± 189 (n = 4) after 36 h of dehydration.Northern blotting.
Northern blots comparing 1.5 µg of mRNA from the vas deferens of
control rats with those subjected to 12 and 36 h of thirsting showed a
marked increase in AQP2 transcription after dehydration (Fig.
5, lanes 1-3). As expected,
mRNA levels in the papilla were also increased by dehydration (Fig. 5,
lanes 4 and 5).
|
Western blotting.
Western blotting to compare the amount of AQP2 protein in 36-h
dehydrated and control vas deferens showed no consistent difference between the two groups (Fig. 6, lanes
1 and 2). However, as expected, a marked increase of AQP2
protein was detected in the dehydrated papilla compared with that of
the control papilla (Fig. 6, lanes 3 and 4). It is
interesting that the higher molecular weight band representing
glycosylated AQP2 in the papilla (Fig. 6, arrowhead) was often
undetectable in the vas deferens, but could be visualized when blots
were developed for longer periods of time (see Fig. 4 for example).
|
Immunofluorescence. Vas deferens from control and dehydrated rats were immunostained with anti-AQP2 antibodies. A strong apical labeling, as seen in Fig. 2C, was present in both the control and dehydrated tissues, with no detectable change in the distribution of AQP2 or apparent staining intensity between the two groups (data not shown).
AQP2 Localization in Vasopressin-Deficient Brattleboro Rats
To evaluate whether vasopressin is required for the membrane expression of AQP2 in the vas deferens, AQP2 distribution was examined by immunofluorescence microscopy in homozygous Brattleboro rats before and after treatment with dDAVP. Urine osmolalities were taken before (203 and 211 mosmol/kgH2O) and after (1,893 and 1,578 mosmol/kgH2O) implantation of vasopressin Alzet osmotic minipumps containing dDAVP.Immunofluorescence.
Tissue from control Brattleboro rats showed strong apical staining for
AQP2 with very little intracellular staining (Fig. 7A), and cells from
the ampulla of the vasopressin-treated animals exhibited no apparent
alteration in the AQP2 staining pattern compared with that of the
untreated Brattleboro tissue (data not shown).
|
Western blotting. Western blotting of equal quantities of ampulla epithelial protein from control and treated Brattleboro rats indicated no detectable change in AQP2 levels after 3 days of vasopressin treatment. In contrast, an increase in AQP2 protein was found, as expected, in the papilla of vasopressin-treated animals, although this increase was not as marked as that reported in some previous studies (Fig. 7B).
Figure 7 shows the specificity of AQP2 staining in the ampulla of the vas deferens. The strong apical staining (Fig. 7C) is completely abolished by preincubating the affinity-purified antibody with the immunizing peptide (Fig. 7D).AQP2 Distribution After Colchicine-Induced Microtubule Disruption
Microtubule disruption by colchicine in vivo disrupts the trafficking and targeting of several recycling membrane proteins, including AQP2 in principal cells (14, 50). After 12 h of in vivo treatment with colchicine, the microtubule network of vas deferens principal cells was grossly modified, indicating that depolymerization had occurred (data not shown). A narrow apical band of tubulin staining was still detectable, however, reminiscent of the pattern of residual tubulin staining in renal epithelial cells after in vivo colchicine delivery (1). Despite extensive microtubule disruption, a considerable amount of AQP2 staining was still present on the apical membrane of these cells, similar to the distribution in nontreated cells (Fig. 8). Very little intracellular vesicular staining was seen, indicating that the apical membrane protein is not actively recycling. Unexpectedly, a significant amount of basolateral membrane staining was also present in colchicine-treated cells (Fig. 8B).
|
AQP2 is not Concentrated in Apical Endosomes: Texas Red-Dextran Endocytosis
To investigate whether AQP2 is actively internalized by endocytic vesicles in the vas deferens, Texas Red-dextran was used as a marker of fluid-phase endocytosis. The vas deferens was cut open and bathed in Texas Red-dextran (5 mg/ml) for 15 min, followed by rapid washing and fixation with PLP. The tissue was then sectioned and stained for AQP2 through the use of a secondary FITC-labeled anti-rabbit IgG. Although many apical endosomes were labeled with Texas Red, indicating extensive endocytotic activity in these cells, these endosomes showed very little if any green labeling for AQP2 (Fig. 9). Any overlap would have been detectable as a yellow endosomal staining. Thus AQP2 is not part of an active apical endocytotic pathway in principal cells of the vas deferens.
|
Vasopressin-Receptor Binding Assay
Membranes from vas deferens socks and from the renal papilla were assayed for the presence of vasopressin V1 and V2 receptors by a radiolabeled vasopressin binding assay. Little or no specific vasopressin binding to vas deferens membranes was detectable, even when the amount of membrane added to the assay was doubled from 100 to 200 µg. Under identical assay conditions, considerable binding was found in membranes from the renal papilla, as expected (Fig. 10).
|
| |
DISCUSSION |
|---|
|
|
|---|
AQP2 was originally identified in the kidney collecting duct (26). Several groups have provided evidence that it functions as the vasopressin-sensitive water channel in principal cells of this segment of the urinary tubule (19, 20, 31, 47, 50). Unexpectedly, we recently found that AQP2 is also present in the vas deferens of the male reproductive tract, where it is located on the apical plasma membrane of epithelial cells (46). In the present study, we now show that reproductive tract AQP2 is identical in nucleotide and amino acid sequence to renal AQP2, that it is delivered to the cell surface in a constitutive exocytotic pathway, and that it is not regulated by vasopressin either acutely or chronically in this tissue. This is in contrast to renal AQP2, which is targeted to the cell surface in a hormonally regulated exocytotic pathway (3). Thus the sorting information present within the AQP2 protein is differentially interpreted by these two cell types. Furthermore, vasopressin receptors were not detectable by hormone binding assays in the vas deferens, indicating that AQP2 cannot be regulated by antidiuretic hormone in these cells. Such cellular specificity of targeting pathways is not restricted to AQP2. It has been reported that AQP1 follows a cAMP-regulated pathway of membrane insertion in cholangiocytes (41), whereas it is constitutively inserted in most other cells (3). These findings complicate the search for specific targeting signals on aquaporins, and show that such signals can be interpreted differently in a cell type-dependent manner.
The function of AQP2 in the vas deferens is probably related to the maintenance of an appropriate luminal environment in which sperm can continue their maturation. Sperm concentration by fluid extraction from the lumen begins in the efferent ducts distal to the seminiferous tubules, where another water channel, AQP1, is abundant (15, 24). So far, aquaporins have not been identified in the epididymis, but AQP1 is found in the vas deferens, where it is most concentrated on the basolateral membrane (15). Thus, as in the kidney collecting duct, vas deferens epithelial cells engage in transepithelial fluid transport by inserting different aquaporins into distinct plasma membrane domains. Because short-term regulation of aquaporin membrane insertion does not seem to occur in the vas deferens, the reason for the presence of both AQP1 and AQP2 in the same cells is unclear. The proximal tubule, for example, achieves a similar function by inserting the same water channel into both apical and basolateral plasma membrane domains (49, 51). However, it has recently been shown that proximal tubule S3 segments in mouse kidney express AQP4 on their basolateral membrane (54), providing another example of the insertion of different aquaporins into the same membrane domain.
The distribution of AQP2 is heterogeneous along the length of the vas deferens. We have previously shown that the initial portion of the vas deferens, immediately distal to the epididymis, contains H+-ATPase-rich, proton-secreting cells, in addition to so-called principal cells (9). However, the principal cells in this early segment do not contain AQP2 or any other known aquaporin (data not shown). In the intermediate portion of the vas deferens, AQP2-positive cells begin to appear among the other epithelial cells, and in the ampulla of the vas deferens, all epithelial cells contain apical AQP2. This result indicates that the vas deferens has not only regional, but also cellular heterogeneity. This supports the idea that the vas deferens is not simply a conduit for the transit of spermatozoa, but that it can actively modify its luminal environment in ways that have as yet unknown consequences for reproductive function (33). It is interesting that only the ampulla of the vas deferens contains detectable AQP2. This region also contains the highest levels of AQP1 (15). The initial segment of the vas deferens adjacent to the epididymis, which has a much thinner muscular and connective tissue wall, may be less water permeable. The considerably thicker wall of the ampulla may, in addition to other functions, also serve as a barrier that protects this water-permeable segment from acute variations in whole-body fluid and electrolyte balance. It would presumably be detrimental to fertility if, during episodes of dehydration, fluid were extracted from the vas deferens, resulting in a more viscous and possibly immotile luminal content.
In the collecting duct, AQP2 is rapidly recycled between the plasma
membrane and intracellular vesicles (3). This trafficking process can
be disrupted by microtubule depolymerization, which results in the
scattering of AQP2-containing vesicles throughout the cytoplasm of
principal cells (50). Other rapidly recycling membrane proteins,
including megalin/gp330 in proximal tubules (29) and proton pumps
(H+-ATPase) in intercalated cells and proximal tubules (13)
are also disrupted in a similar manner by microtubule depolymerization. In contrast, proteins that follow a constitutive exocytotic pathway and
that are not rapidly recycled, including carbonic anhydrase type IV and
dipeptidyl peptidase IV in the proximal tubule, and basolateral
facilitated glucose transporters and the
Cl
/HCO
3 exchanger
AE1 in intercalated cells, do not show any detectable redistribution
into cytoplasmic vesicles even several hours after microtubule
disruption (12, 14). The continued abundance of apical AQP2 in the vas
deferens after colchicine treatment indicates, therefore, that this
protein does not enter a rapid recycling pathway in this cell type, and
that its membrane half-life is considerably longer than that of AQP2 in
collecting duct principal cells. This is supported by the
immunocytochemical data showing a relative paucity of AQP2-containing
vesicles in the cytoplasm of vas deferens epithelial cells. The absence
of AQP2 from apical endosomes that contain the fluid-phase marker Texas
Red-dextran in these cells also indicates that AQP2 is excluded from
segments of the membrane that are destined for internalization. Electron microscopy showed that AQP2 is not concentrated in apical clathrin-coated pits in these cells, consistent with its absence from
apical endosomes, although non-clathrin-mediated mechanisms of
endocytosis, involving caveolae and H+-ATPase-coated
vesicles for example, may be operational in some cell types (8, 12,
53).
An unexpected finding, however, was that AQP2 in the vas deferens was clearly detectable on the basolateral plasma membrane of epithelial cells after microtubule disruption. This is similar to the reported appearance of alkaline phosphatase, normally an exclusively apical protein, on the basolateral surface of intestinal enterocytes after in vivo treatment of rats with colchicine (2, 30). Although this result was interpreted as reflecting the redistribution of apical protein to the basolateral cell surface of the enterocyte, there is an alternative explanation. It is possible that proteins that show this behavior after microtubule disruption are first delivered to the basolateral plasma membrane after synthesis, from where they are relocated to the apical membrane by transcytosis. These proteins, therefore, may follow an indirect route of targeting to their final destination. Although the biological advantage of such an indirect targeting pathway is generally unknown, it has been reported for several proteins in a variety of cell types, including hepatocytes (4) and intestinal absorptive cells (17). In the case of AQP2 in the vas deferens, further studies to distinguish the intracellular fate of preexisting vs. newly synthesized AQP2 after microtubule disruption will be necessary. It is interesting to note that basolateral AQP2 has also been detected in collecting duct principal cells under some conditions, including exposure of tubules to low temperature (7).
The regulation of AQP2 expression in the vas deferens is distinct from that in the collecting duct, but there are also some similarities. Our initial studies showed that a 14-kb region of the aquaporin gene promoter region was able to drive expression of a CRE recombinase reporter construct in these cells in transgenic mice (46), suggesting that some aspects of the transcriptional regulation of the AQP2 gene may be common to the kidney and the vas deferens. Indeed, in the present study, dehydration of rats resulted in a large increase in AQP2 mRNA in both vas deferens and renal papilla, but an increase in AQP2 protein was detectable only in the papilla. The explanation for this finding is unknown, but could include message instability, rapid protein degradation, or some other undetermined disconnect between mRNA levels and mRNA translation. However, it is important to note that no consistent differences in protein content and intracellular location were detectable between normal rats and vasopressin-deficient Brattleboro homozygous rats. Thus transcription of the AQP2 gene does not appear to depend on the interaction of vasopressin with the V2 receptor, as is the case in renal principal cells. This suggestion was confirmed by our inability to detect vasopressin receptors by radiolabeled vasopressin binding assays in vas deferens epithelial cell membranes. Thus the mRNA increase seen in the vas deferens after dehydration is the result of an as yet unknown physiological or hormonal stimulus.
One clear difference between AQP2 from the collecting duct and the vas deferens is the extent of glycosylation, as determined from the relative density of the higher molecular weight band detected with anti-AQP2 antibodies. Although extensive glycosylated AQP2 was detectable in the papillary tissue, the glycosylated band was detectable in the vas deferens only when blots were developed for longer periods of time. Gel densitometry revealed that between 38 and 59% of the AQP2 in kidney was glycosylated, whereas in the vas deferens this value was between 0 and 5% in blots that were not overexposed. It is possible that the glycosylation state of AQP2 could modify its intracellular targeting and trafficking, although it has been shown that unglycosylated AQP2 is targeted normally in transfected Madin-Darby canine kidney (MDCK) cells, and that it functions as a water channel (5). Although the general role of glycosylation of proteins is poorly understood, glycosylation has in some cases been shown to be necessary for the correct intracellular targeting, processing, and folding of some transmembrane and secreted proteins (6, 21-23, 42). However, an absence of correct glycosylation often results in defective delivery of membrane proteins to the cell surface (38, 40), not to an increased delivery as observed for AQP2 in the vas deferens. Nevertheless, the possibility that differences in AQP2 glycosylation are involved in AQP2 targeting in vivo is intriguing, and further work will be required to address this issue.
In summary, AQP2 is located in the apical plasma membrane of epithelial cells in the ampulla of the vas deferens. In these cells, it is a constitutive membrane protein, and is not regulated by vasopressin, either acutely or chronically. The epididymis and vas deferens of the male reproductive tract are, like the kidney collecting duct, derived from the Wolffian duct during development, and the presence of AQP2 in these tissues may reflect this common embryological origin.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Mary McKee for help with the immunoelectron microscopy.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-38452 (D. Brown, S. Breton), K0-8 DK-02132-06 (R. D. Nelson), and DK-52043 (D. E. Kohan), by a fellowship from the Heart and Stroke Foundation of Canada (R. Bouley), and by a Claflin Distinguished Investigator award from the Massachusetts General Hospital (S. Breton).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: D. Brown, Renal Unit, MGH-East, 149 13th St., Charlestown, MA 02129 (E-mail: brown{at}receptor.mgh.harvard.edu).
Received 31 August 1999; accepted in final form 29 October 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abbate, M,
Bonventre JV,
and
Brown D.
The microtubule network of renal epithelial cells is disrupted by ischemia and reperfusion.
Am J Physiol Renal Fluid Electrolyte Physiol
267:
F971-F978,
1994
2.
Achler, C,
Filmer D,
Merte C,
and
Drenckhahn D.
Role of microtubules in polarized delivery of apical membrane proteins to the brush border of the intestinal epithelium.
J Cell Biol
109:
179-189,
1989
3.
Agre, P,
Brown D,
and
Nielsen S.
Aquaporin water channels: unanswered questions and unresolved controversies.
Curr Opin Cell Biol
7:
472-483,
1995[Web of Science][Medline].
4.
Bartles, JR,
and
Hubbard AL.
Biogenesis of the rat hepatocyte plasma membrane.
Meth Enzymol
191:
825-841,
1990[Medline].
5.
Baumgarten, R,
Van De Pol MH,
Wetzels JF,
Van Os CH,
and
Deen PM.
Glycosylation is not essential for vasopressin-dependent routing of aquaporin-2 in transfected Madin-Darby canine kidney cells.
J Am Soc Nephrol
9:
1553-1559,
1998[Abstract].
6.
Benting, JH,
Rietveld AG,
and
Simons K.
N-Glycans mediate the apical sorting of a GPI-anchored, raft-associated protein in Madin-Darby canine kidney cells.
J Cell Biol
146:
313-320,
1999
7.
Breton, S,
and
Brown D.
Cold-induced microtubule disruption and relocalization of membrane proteins in kidney epithelial cells.
J Am Soc Nephrol
9:
155-166,
1998[Abstract].
8.
Breton, S,
Lisanti MP,
Tyszkowski R,
McLaughlin M,
and
Brown D.
Basolateral distribution of caveolin-1 in the kidney: Absence from H+-ATPase-coated endocytic vesicles in intercalated cells.
J Histochem Cytochem
46:
205-214,
1998
9.
Breton, S,
Smith PJ,
Lui B,
and
Brown D.
Acidification of the male reproductive tract by a proton pumping H+-ATPase.
Nat Med
2:
470-472,
1996[Web of Science][Medline].
10.
Breton, S,
Tyszkowski R,
Sabolic I,
and
Brown D.
Postnatal development of H+-ATPase (proton-pump)-rich cells in rat epididymis.
Histochem Cell Biol
111:
97-105,
1999[Web of Science][Medline].
11.
Brown, D,
Hirsch S,
and
Gluck S.
Localization of a proton-pumping ATPase in rat kidney.
J Clin Invest
82:
2114-2126,
1988.
12.
Brown, D,
and
Sabolic I.
Endosomal pathways for water channel and proton pump recycling in kidney epithelial cells.
J Cell Sci (Suppl)
17:
49-59,
1993[Medline].
13.
Brown, D,
Sabolic I,
and
Gluck S.
Colchicine-induced redistribution of proton pumps in kidney epithelial cells.
Kidney Int
40, Suppl 33:
S79-S83,
1991.
14.
Brown, D,
and
Stow JL.
Protein trafficking and polarity in kidney epithelium: from cell biology to physiology.
Physiol Rev
76:
245-297,
1996
15.
Brown, D,
Verbavatz JM,
Valenti G,
Lui B,
and
Sabolic I.
Localization of the CHIP28 water channel in reabsorptive segments of the rat male reproductive tract.
Eur J Cell Biol
61:
264-273,
1993[Web of Science][Medline].
16.
Butlen, D,
Guillon G,
Rajerison RM,
Jard S,
Sawyer WH,
and
Manning M.
Structural requirements for activation of vasopressin-sensitive adenylate cyclase, hormone binding, and antidiuretic actions: effects of highly potent analogs and competitive inhibitors.
Mol Pharmacol
14:
1006-1017,
1978
17.
Casanova, JE,
Breitfeld PP,
Ross SA,
and
Mostov KE.
Phosphorylation of the polymeric immunoglobulin receptor required for its efficient transcytosis.
Science
248:
742-745,
1990
18.
Clulow, J,
Jones RC,
and
Hansen LA.
Micropuncture and cannulation studies of fluid composition and transport in the ductuli efferentes testis of the rat: comparison with the homologous metanephric proximal tubule.
Exp Physiol
79:
915-928,
1994[Abstract].
19.
Deen, PM,
Verdijk MA,
Knoers NV,
Wieringa B,
Monnens LA,
van Os CH,
and
van Oost BA.
Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine.
Science
264:
92-95,
1994
20.
DiGiovanni, SR,
Nielsen S,
Christensen EI,
and
Knepper MA.
Regulation of collecting duct water channel expression by vasopressin in Brattleboro rat.
Proc Natl Acad Sci USA
91:
8984-8988,
1994
21.
Dwek, RA.
Biological importance of glycosylation.
Dev Biol Stand
96:
43-47,
1998[Web of Science][Medline].
22.
Fan, H,
Meng W,
Kilian C,
Grams S,
and
Reutter W.
Domain-specific N-glycosylation of the membrane glycoprotein dipeptidylpeptidase IV (CD26) influences its subcellular trafficking, biological stability, enzyme activity and protein folding.
Eur J Biochem
246:
243-251,
1997[Web of Science][Medline].
23.
Fayadat, L,
Niccoli-Sire P,
Lanet J,
and
Franc JL.
Human thyroperoxidase is largely retained and rapidly degraded in the endoplasmic reticulum. Its N-glycans are required for folding and intracellular trafficking.
Endocrinology
139:
4277-4285,
1998
24.
Fisher, JS,
Turner KJ,
Fraser HM,
Saunders PT,
Brown D,
and
Sharpe RM.
Immunoexpression of aquaporin-1 in the efferent ducts of the rat and marmoset monkey kidney during development, its modulation by estrogens, and its possible role in fluid resorption.
Endocrinology
139:
3935-3945,
1998
25.
Fushimi, K,
Sasaki S,
and
Marumo F.
Phosphorylation of serine 256 is required for cAMP-dependent regulatory exocytosis of the aquaporin-2 water channel.
J Biol Chem
272:
14800-14804,
1997
26.
Fushimi, K,
Uchida S,
Hara Y,
Hirata Y,
Marumo F,
and
Sasaki S.
Cloning and expression of apical membrane water channel of rat kidney collecting tubule.
Nature
361:
549-552,
1993[Medline].
27.
Gellai, M,
Silverstein JH,
Hwang JC,
LaRochelle FT, Jr,
and
Valtin H.
Influence of vasopressin on renal hemodynamics in conscious Brattleboro rats.
Am J Physiol Renal Fluid Electrolyte Physiol
246:
F819-F827,
1984
28.
Gustafson, CE,
Levine S,
Katsura T,
McLaughlin M,
Aleixo MD,
Tamarappoo BK,
Verkman AS,
and
Brown D.
Vasopressin regulated trafficking of a green fluorescent protein-aquaporin 2 chimera in LLC-PK1 cells.
Histochem Cell Biol
110:
377-386,
1998[Web of Science][Medline].
29.
Gutmann, EJ,
Niles JL,
McCluskey RT,
and
Brown D.
Colchicine-induced redistribution of an endogenous apical membrane glycoprotein (gp 330) in kidney proximal tubule epithelium.
Am J Physiol Cell Physiol
257:
C397-C407,
1989
30.
Hasegawa, H,
Watanabe K,
Nakamura T,
and
Nagura H.
Immunocytochemical localization of alkaline phosphatase in absorptive cells of rat small intestine after colchicine treatment.
Cell Tissue Res
250:
521-529,
1987[Web of Science][Medline].
31.
Hayashi, M,
Sasaki S,
Tsuganezawa H,
Monkawa T,
Kitajima W,
Konishi K,
Fushimi K,
Marumo F,
and
Saruta T.
Expression and distribution of aquaporin of collecting duct are regulated by vasopressin V2 receptor in rat kidney.
J Clin Invest
94:
1778-1783,
1994.
32.
Hinton, BT.
The testicular and epididymal luminal amino acid microenvironment in the rat.
J Androl
11:
498-505,
1990
33.
Hinton, BT,
Palladino MA,
Rudolph D,
Lan ZJ,
and
Labus JC.
The role of the epididymis in the protection of spermatozoa.
Curr Top Dev Biol
33:
61-102,
1996[Web of Science][Medline].
34.
Hohlbrugger, G.
A micropuncture study of transepithelial water reabsorption in rat ductuli efferentes.
Fertil Steril
34:
50-54,
1980[Web of Science][Medline].
35.
Hohlbrugger, G,
and
Pfaller K.
Post-vasectomy impairment of transepithelial water reabsorption in the initial segment of the epididymis.
Arch Androl
11:
265-270,
1983[Web of Science][Medline].
36.
Hozawa, S,
Holtzman EJ,
and
Ausiello DA.
cAMP motifs regulating transcription in the aquaporin 2 gene.
Am J Physiol Cell Physiol
270:
C1695-C1702,
1996
37.
Katsura, T,
Gustafson CE,
Ausiello DA,
and
Brown D.
Protein kinase A phosphorylation is involved in regulated exocytosis of aquaporin-2 in transfected LLC-PK1 cells.
Am J Physiol Renal Physiol
272:
F817-F822,
1997[Abstract].
38.
Lanctot, PM,
Leclerc PC,
Escher E,
Leduc R,
and
Guillemette G.
Role of N-glycosylation in the expression and functional properties of human AT1 receptor.
Biochemistry
38:
8621-8627,
1999[Medline].
39.
Lencer, WI,
Weyer P,
Verkman AS,
Ausiello DA,
and
Brown D.
FITC-dextran as a probe for endosome function and localization in kidney.
Am J Physiol Cell Physiol
258:
C309-C317,
1990
40.
Lu, X,
Mehta A,
Dadmarz M,
Dwek R,
Blumberg BS,
and
Block TM.
Aberrant trafficking of hepatitis B virus glycoproteins in cells in which N-glycan processing is inhibited.
Proc Natl Acad Sci USA
94:
2380-2385,
1997
41.
Marinelli, RA,
Tietz PS,
Pham LD,
Rueckert L,
Agre P,
and
LaRusso NF.
Secretin induces the apical insertion of aquaporin-1 water channels in rat cholangiocytes.
Am J Physiol Gastrointest Liver Physiol
276:
G280-G286,
1999
42.
Martina, JA,
Daniotti JL,
and
Maccioni HJ.
Influence of N-glycosylation and N-glycan trimming on the activity and intracellular traffic of GD3 synthase.
J Biol Chem
273:
3725-3731,
1998
43.
Matsumura, Y,
Uchida S,
Rai T,
Sasaki S,
and
Marumo F.
Transcriptional regulation of aquaporin-2 water channel gene by cAMP.
J Am Soc Nephrol
8:
861-867,
1997[Abstract].
44.
McLean, IW,
and
Nakane PK.
Periodate-lysine-paraformaldehyde fixative. A new fixation for immunoelectron microscopy.
J Histochem Cytochem
22:
1077-1083,
1974[Abstract].
45.
Mulders, SM,
Van Lieburg AF,
Monnens LA,
Knoers NV,
Deen PM,
and
Van Os C.
Physiology and pathophysiology of aquaporins.
Eur J Clin Invest
26:
1041-1050,
1996[Web of Science][Medline].
46.
Nelson, RD,
Stricklett P,
Gustafson C,
Stevens A,
Ausiello D,
Brown D,
and
Kohan DE.
Expression of an AQP2 Cre recombinase transgene in kidney and male reproductive system of transgenic mice.
Am J Physiol Cell Physiol
275:
C216-C226,
1998
47.
Nielsen, S,
Chou CL,
Marples D,
Christensen EI,
Kishore BK,
and
Knepper MA.
Vasopressin increases water permeability of kidney collecting duct by inducing translocation of aquaporin-CD water channels to plasma membrane.
Proc Natl Acad Sci USA
92:
1013-1017,
1995
48.
Nielsen, S,
Marples D,
Frokiaer J,
Knepper M,
and
Agre P.
The aquaporin family of water channels in kidney: an update on physiology and pathophysiology of aquaporin-2.
Kidney Int
49:
1718-1723,
1996[Web of Science][Medline].
49.
Nielsen, S,
Smith BL,
Christensen EI,
Knepper MA,
and
Agre P.
CHIP28 water channels are localized in constitutively water-permeable segments of the nephron.
J Cell Biol
120:
371-383,
1993
50.
Sabolic, I,
Katsura T,
Verbavatz JM,
and
Brown D.
The AQP2 water channel: effect of vasopressin treatment, microtubule disruption, and distribution in neonatal rats.
J Membr Biol
143:
165-175,
1995[Web of Science][Medline].
51.
Sabolic, I,
Valenti G,
Verbavatz J-M,
Van Hoek AN,
Verkman AS,
Ausiello DA,
and
Brown D.
Localization of the CHIP28 water channel in rat kidney.
Am J Physiol Cell Physiol
263:
C1225-C1233,
1992
52.
Sasaki, S,
Fushimi K,
Ishibashi K,
and
Marumo F.
Water channels in the kidney collecting duct.
Kidney Int
48:
1082-1087,
1995[Web of Science][Medline].
53.
Van Deurs, B,
Holm PK,
Sandvig K,
and
Hansen SH.
Are caveolae involved in clathrin-independent endocytosis?
Trends Cell Biol
3:
249-251,
1993.
54.
Van Hoek, AN,
Ma T,
Yang B,
Verkman AS,
and
Brown D.
Aquaporin 4 is expressed in basolateral membranes of proximal tubule S3 segments in mouse kidney.
Am J Physiol Renal Physiol
277:
F310-F316,
2000.
55.
Wong, PY,
and
Yeung CH.
Absorptive and secretory functions of the perfused rat cauda epididymis.
J Physiol (Lond)
275:
13-26,
1978
56.
Wong, YC,
Wong PY,
and
Yeung CH.
Ultrastructural correlation of water reabsorption in isolated rat cauda epididymidis.
Experientia
34:
485-487,
1978[Web of Science][Medline].
This article has been cited by other articles:
![]() |
M. T. Skowronski, A. Leska, A. Robak, and S. Nielsen Immunolocalization of Aquaporin-1, -5, and -7 in the Avian Testis and Vas Deferens J. Histochem. Cytochem., October 1, 2009; 57(10): 915 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hasler Controlled aquaporin-2 expression in the hypertonic environment Am J Physiol Cell Physiol, April 1, 2009; 296(4): C641 - C653. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Pastor-Soler, K. R. Hallows, C. Smolak, F. Gong, D. Brown, and S. Breton Alkaline pH- and cAMP-induced V-ATPase membrane accumulation is mediated by protein kinase A in epididymal clear cells Am J Physiol Cell Physiol, February 1, 2008; 294(2): C488 - C494. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M Hagedorn, R. W Carlin, and B. D Schultz Oxytocin and Vasopressin Stimulate Anion Secretion by Human and Porcine Vas Deferens Epithelia Biol Reprod, September 1, 2007; 77(3): 416 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lodewyck, B. Menco, and K. Fisher Immunolocalization of Aquaporins in Vocal Fold Epithelia Arch Otolaryngol Head Neck Surg, June 1, 2007; 133(6): 557 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yi, R. Bouley, H. Y. Lin, S. Bechoua, T.-x. Sun, E. del Re, T. Shioda, M. K. Raychowdhury, H. A. J. Lu, A. B. Abou-Samra, et al. Alix (AIP1) is a vasopressin receptor (V2R)-interacting protein that increases lysosomal degradation of the V2R Am J Physiol Renal Physiol, May 1, 2007; 292(5): F1303 - F1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-F. Huang, R.-H. He, C.-C. Sun, Y. Zhang, Q.-X. Meng, and Y.-Y. Ma Function of aquaporins in female and male reproductive systems Hum. Reprod. Update, November 1, 2006; 12(6): 785 - 795. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Yang, D. Zhao, L. Qian, and A. S. Verkman Mouse model of inducible nephrogenic diabetes insipidus produced by floxed aquaporin-2 gene deletion Am J Physiol Renal Physiol, August 1, 2006; 291(2): F465 - F472. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Carlin, R. L. Sedlacek, R. R. Quesnell, F. Pierucci-Alves, D. M. Grieger, and B. D. Schultz PVD9902, a porcine vas deferens epithelial cell line that exhibits neurotransmitter-stimulated anion secretion and expresses numerous HCO3- transporters Am J Physiol Cell Physiol, June 1, 2006; 290(6): C1560 - C1571. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Da Silva, C. Silberstein, V. Beaulieu, C. Pietrement, A. N. Van Hoek, D. Brown, and S. Breton Postnatal Expression of Aquaporins in Epithelial Cells of the Rat Epididymis Biol Reprod, February 1, 2006; 74(2): 427 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Fenton, A. Shodeinde, and M. A. Knepper UT-A urea transporter promoter, UT-A{alpha}, targets principal cells of the renal inner medullary collecting duct Am J Physiol Renal Physiol, January 1, 2006; 290(1): F188 - F195. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Dumont, E. C. Nemergut II, J. A. Jane Jr, and E. R. Laws Jr Postoperative Care Following Pituitary Surgery J Intensive Care Med, May 1, 2005; 20(3): 127 - 140. [Abstract] [PDF] |
||||
![]() |
M. C. Branes, B. Morales, M. Rios, and M. J. Villalon Regulation of the immunoexpression of aquaporin 9 by ovarian hormones in the rat oviductal epithelium Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1048 - C1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Miller, P. Zhang, M. Smith, V. Beaulieu, T. G. Paunescu, D. Brown, S. Breton, and R. D. Nelson V-ATPase B1-subunit promoter drives expression of EGFP in intercalated cells of kidney, clear cells of epididymis and airway cells of lung in transgenic mice Am J Physiol Cell Physiol, May 1, 2005; 288(5): C1134 - C1144. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Bertrand and R. A. Frizzell The role of regulated CFTR trafficking in epithelial secretion Am J Physiol Cell Physiol, July 1, 2003; 285(1): C1 - C18. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Brown The ins and outs of aquaporin-2 trafficking Am J Physiol Renal Physiol, May 1, 2003; 284(5): F893 - F901. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zharkikh, X. Zhu, P. K. Stricklett, D. E. Kohan, G. Chipman, S. Breton, D. Brown, and R. D. Nelson Renal principal cell-specific expression of green fluorescent protein in transgenic mice Am J Physiol Renal Physiol, December 1, 2002; 283(6): F1351 - F1364. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pastor-Soler, C. Isnard-Bagnis, C. Herak-Kramberger, I. Sabolic, A. Van Hoek, D. Brown, and S. Breton Expression of Aquaporin 9 in the Adult Rat Epididymal Epithelium Is Modulated by Androgens Biol Reprod, June 1, 2002; 66(6): 1716 - 1722. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pastor-Soler, C. Bagnis, I. Sabolic, R. Tyszkowski, M. McKee, A. Van Hoek, S. Breton, and D. Brown Aquaporin 9 Expression along the Male Reproductive Tract Biol Reprod, August 1, 2001; 65(2): 384 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Spector, J. B. Wade, R. Dillow, D. A. Steplock, and E. J. Weinman Expression, localization, and regulation of aquaporin-1 to -3 in rat urothelia Am J Physiol Renal Physiol, June 1, 2002; 282(6): F1034 - F1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-X. Sun, A. Van Hoek, Y. Huang, R. Bouley, M. McLaughlin, and D. Brown Aquaporin-2 localization in clathrin-coated pits: inhibition of endocytosis by dominant-negative dynamin Am J Physiol Renal Physiol, June 1, 2002; 282(6): F998 - F1011. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |