|
|
||||||||
Department of Microbiology and Molecular Genetics, University of California, Irvine, California 92697-4025
| |
ABSTRACT |
|---|
|
|
|---|
Functional modulation of voltage-gated sodium channels
affects the electrical excitability of neurons. Protein kinase A (PKA) can decrease sodium currents by phosphorylation at consensus sites in
the cytoplasmic I-II linker. Once the sites are phosphorylated, however, additional PKA activity can increase sodium currents by an
unknown mechanism. When the PKA sites were eliminated by substitutions
of alanine for serine, peak sodium current amplitudes were increased by
20-80% when PKA was activated in Xenopus oocytes either
by stimulation of a coexpressed
2-adrenergic receptor or
by perfusion with reagents that increase cAMP. Potentiation required
the I-II linker of the brain channel, in that a chimeric channel in
which the brain linker was replaced with the comparable linker from the
skeletal muscle channel did not demonstrate potentiation. Using a
series of chimeric and deleted channels, we demonstrate that
potentiation is not dependent on any single region of the linker and
that the extent of potentiation varies depending on the total length
and the residues throughout the linker. These data are consistent with
the hypothesis that potentiation by PKA is an indirect process
involving phosphorylation of an accessory protein that interacts with
the I-II linker of the sodium channel.
modulation; ion channel; phosphorylation; protein kinase A; site-directed mutagenesis
| |
INTRODUCTION |
|---|
|
|
|---|
VOLTAGE-GATED SODIUM channels in electrically excitable cells initiate and propagate action potentials in response to depolarizing inputs that achieve threshold level. Therefore, modulation of the functional properties of sodium channels can significantly affect the likelihood that an action potential is initiated. The rat brain IIA sodium channel is functionally modulated by protein kinase A (PKA) activity in two distinct ways, resulting in either a decrease or an increase in sodium current amplitudes (6, 8, 9, 16, 19, 20). The brain sodium channel contains five PKA consensus sites located within the cytoplasmic linker that connects domains I and II of the channel, and the channel is phosphorylated by PKA at four of these sites (11, 14, 15). PKA-mediated attenuation of current amplitude involves phosphorylation at specific consensus site(s) within the I-II linker, with the serine at position 573 being the most important (2, 20, 21). When the I-II linker PKA sites were collectively mutated or deleted or when the serine at position 573 was selectively replaced with alanine, sodium currents were increased rather than decreased by activation of PKA activity (20, 21).
In contrast to the brain sodium channel, currents through the rat skeletal muscle sodium channel (SkM1) are not affected by PKA activation. The I-II linker in the muscle channel is substantially shorter than the linker in the brain channel. We previously reported that substitution of the entire brain I-II linker with the linker from the muscle channel resulted in a chimeric channel that did not show either current attenuation or current potentiation (20). These results demonstrated that the I-II linker of the brain channel was required for potentiation of current amplitudes by PKA activation. However, the fact that currents through brain sodium channel mutants that lacked the PKA sites in the I-II linker were still increased by PKA activation indicates that potentiation does not involve phosphorylation at any of the consensus PKA sites in the linker. Sodium currents through the rat cardiac sodium channel (SkM2) are similarly potentiated by PKA activation (17). Eight PKA consensus sites in that channel were eliminated by site-directed mutagenesis in an effort to correlate current potentiation with phosphorylation of particular site(s), but none of the mutations eliminated the potentiation by PKA (4). By constructing a series of chimeric channels between the cardiac and muscle sodium channels, it was shown that the I-II linker region of the cardiac channel was required for potentiation (4).
To investigate the importance of specific regions of the brain sodium
channel I-II linker, we constructed a series of chimeric channels in
which brain channel sequences were replaced by sequences from
comparable regions of the skeletal muscle channel. In parallel experiments, we constructed deletions within the I-II linker to determine whether those regions are required for current potentiation. To examine the effects of PKA activation in Xenopus oocytes,
PKA was activated either by stimulating an exogenous
2-adrenergic receptor (
2-AR) with
isoproterenol or by perfusion with a cocktail that contained forskolin,
cAMP analogs, and IBMX. These results demonstrate that potentiation of
sodium current amplitudes by PKA does not require any one specific
region of the I-II linker but rather depends on the total length and
residues throughout the linker.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of deletion mutants and chimeric sodium channels.
The
PKA mutant was constructed by subcloning a portion of the sodium
channel containing the I-II linker into M13 and looping out of a region
that encodes the PKA consensus sites as previously described (20).
Other deletion mutants were made by PCR mutagenesis. The following
anti-sense oligonucleotides were used to loop out targeted regions:
;PKA,
[CAAGTCCATAGAGACGTGGTA]-[CTCGTAGGTCAATCTACTTCC];
PKABIG,
[CCAGCAGGGT- GGGCA]-[CTCCTGCTGCTTCTTCAGTTGC];
PKA-L, [AG- CGGCAAATCTCTT]-[GCCTGCCCCGCTGAA];
PKA-R,
[CCAGCAGGGTGGGCA]-[CAACAAGTCCATAGAGAC]. Nucleotide sequences that flank the regions looped out are indicated in
brackets. PCR mutagenesis was done by amplifying two overlapping fragments that together spanned the region between two unique restriction sites. The fragments were gel purified, joined together, and amplified as one large fragment by PCR. Primers upstream and downstream of unique restriction sites on either side of the deletion were used, in addition to a primer that was complementary to the mutagenic oligonucleotide. PCR amplification was done with 2.5 units of
Pfu DNA polymerase (Stratagene) in a reaction mixture that
contained 20 µM dNTPs, and 2 µM primers. Thermal cycling was done
by denaturing at 95°C for 30 s, annealing at 5°C below the
melting temperatures for oligonucleotide pairs for 1 min, and extending
at 72°C for 4 min for 30 cycles.
The BMB chimera was constructed as described previously (20). BMB-Left
and BMB-Right chimeras were constructed to contain muscle sodium
channel sequence either upstream or downstream of mutated PKA
sites, respectively. This was done by merging the first
portion of the linker from the BMB chimera with the PKACOMP-A mutant or
by merging the downstream region of the BMB chimera with the
PKACOMP-A mutant, as diagrammed in Fig.
1. To merge these regions together, PCR
mutagenesis was done with overlapping fragments amplified from the BMB
chimera and PKACOMP-A in a manner similar to the way in which the
deletion mutations were made. The following oligonucleotide primers
containing muscle and brain sodium channel sequence just upstream or
downstream of the mutant PKA sites were used: BMB-Left
(antisense, brain muscle),
[GCGGAGCGGCAAATCTCTT]-[GTCCCCATCTGCCTCCTCTCC]; BMB-Right (sense, brain muscle),
[GTCTCTATGGACTTGTTG]-[GAGAAGGGGCCCCCAAGGCC].
|
Transcription of RNA and expression in Xenopus oocytes. Sodium
channel RNA transcripts were synthesized from Not I linearized DNA templates using a T7 RNA polymerase transcription kit (Ambion, Austin, TX). BamH I was used to linearize the pBART plasmid
containing the
2-AR coding region downstream from an SP6
polymerase promoter (23), which was generously provided by Dr. Mike
White (Allegheny Univ. of Health Sciences). Stage V oocytes were
removed from adult female Xenopus laevis frogs and prepared as
previously described (7), and incubated in ND-96 medium (96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, and 5 mM
HEPES, pH 7.5) supplemented with 0.1 mg/ml gentamicin, 0.55 mg/ml
pyruvate, and 0.5 mM theophylline. Sodium channel RNA was injected at
~100 pg/oocyte and
2-AR RNA was injected at 50 pg/oocyte. After a 40-h incubation at 20°C in ND-96, sodium
currents were recorded using a two-electrode voltage clamp at room
temperature as previously described (12).
Activation of PKA in oocytes. The bath solution consisted of
ND-96 for all electrophysiological recordings. PKA was activated by two
different methods. The first method involved perfusing oocytes that had
been coinjected with
2-AR RNA with 4 µM isoproterenol in bath solution for 10 min. The second method involved perfusing oocytes with a cocktail consisting of 25 µM forskolin, 10 µM
chlorophenylthio-cAMP (CPT-cAMP), 10 µM dibutyryl-cAMP (DBcAMP), and
10 µM IBMX for 10 min (21). Each of these reagents increases
cytoplasmic cAMP levels and therefore activates PKA. Forskolin
activates adenylyl cyclase (3), CPT-cAMP and DBcAMP are membrane
permeable, stable analogs of cAMP (10, 13), and IBMX is an inhibitor of
phosphodiesterases that convert cAMP to AMP (1). Forskolin was prepared
at a stock concentration of 50 mM in DMSO, CPT-cAMP and DBcAMP were
prepared at stock concentrations of 10 mM in water, and IBMX was
prepared at a stock concentration of 10 mM in ethanol. All of these
reagents were obtained from Sigma (St. Louis, MO). Stock solutions were stored at
20°C. Stock solutions of isoproterenol (Sigma)
were made at a concentration of 100 mM in water and stored at
20°C. The rate of perfusion with bath solution was carefully
adjusted to 0.1 drop per second to minimize fluctuations in current
amplitude resulting from changes in flow rate.
Data analysis. Sequence comparison of the RIIA and SkM1 I-II linker sequences were made using Clustal V multiple sequence alignment software. Electrophysiological data were recorded and analyzed using pCLAMP software (Axon Instruments; Foster City, CA) and further analysis utilized Excel (Microsoft; Redmond, WA) and SigmaPlot and SigmaStat (Jandel; San Rafael, CA). In some cases drift in the peak current amplitude was observed even after allowing for recovery from slow inactivation. In those cases the peak current measurements were adjusted by subtracting out a linear relationship that was fit to data acquired during the first 10 min before PKA stimulation as previously described (21). The maximum subtraction represented a change of less than 25% over the entire 50-min-recording interval.
| |
RESULTS |
|---|
|
|
|---|
Sodium channel deletion mutants and chimeras. To test the involvement of specific regions of the I-II linker in potentiation of sodium current amplitudes, we constructed a series of deletions within the I-II linker of the brain sodium channel and we created chimeric channels by substituting regions of the muscle I-II linker into the brain sodium channel. The I-II linkers of these mutant channels are shown schematically in Fig. 1A, in which the presence of each of five consensus PKA sites is indicated by the letter "S," and the presence of a mutation in which the consensus serine is substituted with an alanine is indicated by the letter "A." The complete sequence of the linker regions, indicating the specific regions that are deleted or substituted in the chimeras, is shown in Fig. 1B. These wild-type and mutant sodium channels were used to test the role of the I-II linker in PKA-mediated potentiation of sodium current.
Sodium current potentiation by PKA activation. The functional
impact of sodium channel phosphorylation was tested by expression of
each of the channels in Xenopus oocytes, followed by activation of PKA activity by two independent means. The first method involved stimulation of a coexpressed
2-AR for 10 min with
isoproterenol. The
2-AR is coupled to adenylyl cyclase
through G
s, so that stimulation of the receptor with
isoproterenol activates PKA by triggering a transient increase in
cytoplasmic cAMP. For the wild-type rat brain sodium channel, the peak
sodium current amplitude was reduced by 20% 10 min after PKA
activation (Fig. 2A, thick line with asterisk). The second method of inducing PKA involved perfusion with a cocktail containing forskolin, DBcAMP, CPT-cAMP, and IBMX, all
of which activate PKA by increasing cytoplasmic cAMP levels (20). After
cocktail perfusion for 10 min, the sodium current amplitude was reduced
by 10% (Fig. 2B, thick line with asterisk). The reduction of
peak sodium current amplitude by either of these manipulations is
consistent with previous reports for the effects of PKA on the
wild-type rat brain sodium channel (8, 20, 21).
|
We previously showed that sodium current attenuation by PKA requires
phosphorylation at PKA consensus site(s) located in the linker between
domains I and II of the sodium channel (20, 21). Mutants in which the
five PKA sites were collectively mutated by replacing serine residues
with alanines (PKACOMP-A, Fig. 1) or in which the central portion of
the I-II linker containing the five PKA sites was deleted (
PKA, Fig.
1) did not show current reduction. Instead, the sodium current
amplitude was potentiated by PKA activation for these mutant sodium
channels. When PKA was activated by isoproterenol stimulation
of the
2-AR, peak sodium current amplitude
through the
PKA channel was increased by 50% and currents through
the PKACOMP-A channel were increased by ~20% (Fig.
2A, thick lines with asterisks). When PKA was alternatively activated by perfusion with the PKA activation cocktail, current amplitudes were similarly increased by ~20% for both
PKA and PKACOMP-A (Fig. 2B, thick lines with asterisks). Therefore, in the absence of the PKA sites in the I-II linker, PKA activation potentiates sodium current amplitude.
Biphasic modulation of sodium current by PKA. The time courses
for the changes in peak current amplitude for the wild-type,
PKA,
and PKACOMP-A channels following stimulation of the
2-AR receptor are shown in Fig. 3. The time
course of current reduction for the wild-type channel is somewhat
faster than that of potentiation, with the maximal effect occurring
~10 min after isoproterenol stimulation. In comparison, maximal
potentiation for the
PKA and PKACOMP-A channels is relatively
delayed, with maximal current observed 15-20 min after PKA
activation. Both attenuation and potentiation of current are transient,
with current levels returning to baseline following washout of
isoproterenol. Similar time courses were obtained when PKA was
activated by PKA activation cocktail (data not shown). The difference
in time of onset for current attenuation and potentiation was
consistently observed in this and previous studies (20, 21). These data
demonstrate that PKA activation potentiates sodium current amplitude in
a reversible manner when the I-II linker PKA sites are absent. In
addition, the temporal separation of attenuation and potentiation
indicates that the effects of PKA are biphasic, with the onset of
attenuation preceding that of potentiation.
|
Substitution of muscle sequence into brain channel I-II linker
reduces potentiation. We previously demonstrated that neither current attenuation nor potentiation was observed for the wild-type rat
muscle sodium channel in response to PKA activation (19, 20). The I-II
linker of the muscle channel is substantially shorter than that of the
brain I-II linker, and it does not contain any consensus PKA
phosphorylation sites (Fig. 1). When isoproterenol was perfused on
oocytes expressing both the muscle channel and the
2-AR,
no change in peak current amplitude was observed (Fig. 4A). The attenuation response of
the brain sodium channel following PKA activation is shown for
comparison. Average and standard deviation values for the percent
change in current amplitude for multiple oocytes are summarized in Fig.
4C. To determine whether differences in the sequences of the
I-II linkers between the two channels were responsible for the
different responses to PKA activation, we constructed a chimeric
channel in which the entire I-II linker of the brain channel was
substituted with corresponding muscle channel sequence (BMB, Fig. 1).
The effects of PKA activation by isoproterenol stimulation of a
coexpressed
2-AR are shown in Fig. 4A.
Replacement of the brain I-II linker with muscle sequence completely
eliminated the attenuation of sodium current amplitude and eliminated
the majority of sodium current potentiation as well. These data
demonstrate that sequences unique to the brain channel I-II linker
compared with the muscle channel are required for both sodium current
attenuation and potentiation by PKA.
|
We previously demonstrated that the consensus PKA phosphorylation sites
are necessary and sufficient for the attenuation of sodium current
amplitudes (20, 21), and the muscle channel does not contain any of
these consensus sites. However, the results with the
PKA and
PKACOMP-A mutants demonstrate that the consensus PKA sites are not
necessary for the potentiation of sodium current amplitude (Fig. 2). To
determine which region(s) of the brain channel I-II linker are involved
in potentiation, we constructed two additional chimeras in which
smaller regions within the brain I-II linker were replaced with
corresponding muscle sequence (Fig. 1). For each of these chimeras, the
PKA sites in the brain channel sequence were eliminated by
replacement of the serines with alanines as in PKACOMP-A
to eliminate the effect of current attenuation. These chimeras were
designed to contain muscle sequence upstream of the PKA consensus sites
(BMB-Left) or downstream of the PKA sites (BMB-Right). Both BMB-Left
and BMB-Right expressed sodium currents that were potentiated by PKA
activation (Fig. 4, B and C). The BMB-Right chimera
demonstrated a level of potentiation that was similar to the PKACOMP-A
channel. However, the amount of potentiation for the BMB-L
chimera was significantly reduced relative to the PKACOMP-A mutant.
Currents through the PKACOMP-A channel were potentiated by 26 ± 4%,
whereas currents through the BMB-Left chimera were potentiated by only
15 ± 9%. Therefore, current potentiation was disrupted by a
region-specific replacement with muscle sequence. Substitution of
muscle sequence upstream and downstream of the PKA sites changed two
aspects of the brain sodium channel linker at the primary amino acid
level. First, the amino acid sequence was altered due to differences
between the muscle and brain isoforms, as shown in Fig. 1B.
Second, the overall length of the I-II linker was shortened in the case
of the BMB-Left chimera due to the fact that the region of the muscle channel upstream of the PKA sites is shorter (Fig. 1). The length of
the I-II linker in the BMB-Right chimera was preserved relative to that
of the brain sodium channel linker (Fig. 1).
Deletions of small regions of I-II linker disrupt current
potentiation. To determine if the disruption of potentiation by the
BMB-Left chimera resulted from a shortening of the linker rather than a
change in the amino acid sequence, three deletions in the I-II linker
were constructed. A large deletion termed
PKABIG removed 267 amino
acids, including the majority of the I-II linker and the consensus PKA
sites (Fig. 1). Two smaller deletions were constructed in the PKACOMP-A
mutant on either side of the mutated PKA sites to examine the effects
of deleting different regions of the I-II linker. These smaller
deletion mutants were termed
PKA-Left (71 amino acids deleted) and
PKA-Right (30 amino acids deleted) (Fig. 1). The channels all
expressed currents that were similar to the wild-type channel with
respect to current amplitude and inactivation kinetics (data not
shown). The effects of PKA activation on each of these deletion mutants
were then examined by stimulation of a coexpressed
2-AR
with isoproterenol (Fig. 5). Data are
included for the original
PKA mutant in which the central region of
the linker (138 amino acids) containing the five PKA consensus sites
was deleted. Representative responses observed in individual oocytes
are shown in Fig. 5A, and the average percentages of current
change in multiple oocytes are summarized in Fig. 5B. The
deletion mutants all showed some potentiation, but the magnitude of
the response was consistently smaller for the
PKABIG,
PKA-Left, and
PKA-Right mutants when compared with the
PKA
mutant (Fig. 5B). The reduction in potentiation for each of
these mutants was similar, demonstrating that the decrease in
potentiation resulted from a shortening of the linker, rather than from
removal of specific sequences in any one region of the I-II linker.
|
| |
DISCUSSION |
|---|
|
|
|---|
We have demonstrated that PKA activation in Xenopus oocytes potentiates currents through mutant rat brain sodium channels lacking PKA sites in the I-II linker, consistent with our previous results (19-21). It also has been shown previously that the wild-type brain sodium channel is attenuated by PKA phosphorylation (2, 8, 9, 20, 21). We propose that both forms of modulation occur for the wild-type channel, but that the net effect is a reduction in current amplitude because attenuation normally dominates. In addition, both forms of modulation require the I-II linker of the brain sodium channel.
Shortening of I-II linker reduces potentiation. By constructing
deletions of various regions of the I-II linker, we have determined that mutations that shorten the linker on either side of the centrally located PKA sites reduce the level of potentiation. Changing the amino
acid sequence downstream of the central PKA sites by a substitution of
muscle sequence (BMB-Right) maintained the length of the linker and had
no effect on the potentiation response. In contrast, a deletion of 30 amino acids within the same region significantly reduced potentiation.
When the region of the brain channel I-II linker upstream of the PKA
sites was replaced with corresponding muscle channel sequence
(BMB-Left), the length was reduced by 71 amino acids and the level of
potentiation was significantly reduced. The central portion of the
linker that was deleted in the
PKA mutant is apparently not required
for potentiation, as the level of potentiation observed for the
PKA
mutant is at least as large as that observed for the PKACOMP-A mutant.
There are at least two possible explanations for this result. First, it is possible that adjacent regions of the linker are important for
potentiation because they are in closer proximity to the putative transmembrane regions, so that deletions in these regions are more
likely to affect the structure of the channel. Alternatively, it is
possible that the central region of the I-II linker that was deleted in
the
PKA mutant has a compact secondary structure, so that deletion
of this region does not alter the overall structure of the remaining
linker. The potentiation of current that was observed in all cases was
not secondary to alterations in the electrophysiological properties of
the channels, as neither the deletion mutations nor the chimeric
constructs significantly affected any of these properties (data not shown).
Biphasic modulation of brain sodium channel by PKA. Our data
suggest that PKA-mediated potentiation of sodium current underlies the
normally observed attenuation of sodium current expressed from the
wild-type channel. It is possible that each type of modulation might
occur under different physiological conditions. For example, activation
of PKA to a low-to-moderate level could be sufficient to phosphorylate
the PKA sites in the I-II linker and attenuate current. However, if the
basal level of phosphorylation was already sufficient to phosphorylate
the I-II linker sites, additional activation of PKA might trigger the
secondary mechanism that potentiates current. Consistent with this
hypothesis, we previously observed potentiation of the wild-type sodium
channel under conditions that were predicted to result in an elevated
basal level of PKA activity (19). In that study, we coexpressed the
2-AR at a high level (about 1,000× higher than in
this study), so that unstimulated
2-AR activity would
activate PKA above the normal baseline level. Under those conditions,
sodium current amplitude already would have been attenuated to a new
basal level. We propose that when PKA was activated to even higher
levels by isoproterenol stimulation, we observed the secondary effect
of current potentiation.
Further support for the hypothesis that potentiation by PKA occurs even
when the consensus sites are phosphorylated is provided by results with
a mutant channel in which the serine residues in the consensus PKA
sites have been replaced with aspartates. The negative charge of the
aspartate residues should mimic the negative charge of the
phosphorylated PKA sites and resulted in smaller current amplitudes
compared with the wild-type channel (20). Currents through this mutant
channel were also potentiated when PKA was activated by stimulation of
a coexpressed
2-AR (20).
Potential mechanisms for potentiation. Although these data
demonstrate that the I-II linker of the brain sodium channel is required for potentiation, we do not know the molecular mechanism involved in the process. Sodium current potentiation was observed using
two independent means of PKA activation, which confirms that PKA
phosphorylation plays a central role. Our results indicate that
potentiation of current does not involve direct phosphorylation of the
I-II linker, because it was possible to disrupt the response by
nonoverlapping deletions (compare the
PKA-Left and
PKA-Right mutants). In addition, there are no consensus PKA sites in the I-II
linker other than the five sites that were mutated in the PKACOMP-A
mutant. One possible mechanism is that a cellular protein in the oocyte
is phosphorylated by PKA, and this protein then interacts with the I-II
linker of the sodium channel by binding to region(s) upstream or
downstream from the centrally located PKA sites. Candidate proteins
include cytoskeletal proteins such as ankyrin, spectrin, syntrophin,
and tenascin, all of which have been shown to interact with the sodium
channel (18, 22, 24). Consistent with the hypothesis that a secondary
protein is involved in current potentiation, the onset for current
attenuation by phosphorylation of the I-II linker sites is faster than
the appearance of current potentiation observed for mutants that lack
the I-II linker PKA sites. The delay in response suggests that
potentiation occurs through a separate and perhaps indirect mechanism.
Potentiation of brain and cardiac sodium channels is similar. Our results are similar to previous data for the cardiac sodium channels, which also has been shown to be potentiated by PKA activation in Xenopus oocytes (4, 5, 17). In that case, potentiation was abolished when the I-II linker of the cardiac channel was substituted with corresponding muscle sodium channel sequence. Elimination of eight PKA sites throughout the cardiac sodium channel did not affect current potentiation, prompting the authors to speculate that potentiation of the cardiac channel occurred either by phosphorylation of a nonoptimal PKA site or by phosphorylation of an oocyte protein that acts as an accessory protein. Assuming that the same mechanism is responsible for potentiation of brain and cardiac sodium channel currents, our data and those of Frohnwieser et al. (4, 5) suggest that potentiation is an indirect process.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Marianne Smith, Michael Pugsley, Ted Shih, and Daniel Allen for helpful discussions during the course of this work and Mimi Reyes for excellent technical assistance.
| |
FOOTNOTES |
|---|
This work was supported by the National Institute of Neurological Disorders and Stroke Grant NS-26729. A. L. Goldin is an Established Investigator of the American Heart Association.
Present address of R. D. Smith: Dept. of Biology, Univ. of California San Diego, La Jolla, CA 92093-0357.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: A. L. Goldin, Dept. of Microbiology and Molecular Genetics, Univ. of California, Irvine, CA 92697-4025 (E-mail: AGoldin{at}uci.edu).
Received 28 July 1999; accepted in final form 21 October 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Beavo, JA,
Rogers NL,
Crofford OB,
Hardman JG,
Sutherland EW,
and
Newman EV.
Effects of xanthine derivatives on lipolysis and on adenosine 3',5'-monophosphate phosphodiesterase activity.
Mol Pharmacol
6:
597-603,
1970
2.
Cantrell, AR,
Smith RD,
Goldin AL,
Scheuer T,
and
Catterall WA.
Dopaminergic modulation of sodium current in hippocampal neurons via cAMP-dependent phosphorylation of specific site(s) in the sodium channel
subunit.
J Neurosci
17:
7330-7338,
1997
3.
De Souza, NJ,
Dohadwalla AN,
and
Reden J.
Forskolin: a labdane diterpenoid with antihypertensive, positive inotropic, platelet aggregation inhibitory, and adenylate cyclase activating properties.
Med Res Rev
3:
201-219,
1983[ISI][Medline].
4.
Frohnwieser, B,
Chen L-Q,
Schreibmayer W,
and
Kallen RG.
Modulation of the human cardiac sodium channel
-subunit by cAMP-dependent protein kinase and the responsible sequence domain.
J Physiol (Lond)
498:
309-318,
1997[ISI][Medline].
5.
Frohnwieser, B,
Weigl L,
and
Schreibmayer W.
Modulation of cardiac sodium channel isoform by cyclic AMP dependent protein kinase does not depend on phosphorylation of serine 1504 in the cytosolic loop interconnecting transmembrane domains III and IV.
Pflügers Arch
430:
751-753,
1995[ISI][Medline].
6.
Gershon, E,
Weigl L,
Lotan I,
Schreibmayer W,
and
Dascal N.
Protein kinase A reduces voltage-dependent Na+ current in Xenopus oocytes.
J Neurosci
12:
3743-3752,
1992[Abstract].
7.
Goldin, AL.
Expression of ion channels by injection of mRNA into Xenopus oocytes.
Methods Cell Biol
36:
487-509,
1991[Medline].
8.
Li, M,
West JW,
Lai Y,
Scheuer T,
and
Catterall WA.
Functional modulation of brain sodium channels by cAMP-dependent phosphorylation.
Neuron
8:
1151-1159,
1992[ISI][Medline].
9.
Li, M,
West JW,
Numann R,
Murphy BJ,
Scheuer T,
and
Catterall WA.
Convergent regulation of sodium channels by protein kinase C and cAMP-dependent protein kinase.
Science
261:
1439-1442,
1993
10.
Miller, JP,
Boswell KH,
Muneyama K,
Simon LN,
Robins RK,
and
Shuman DA.
Synthesis and biochemical studies of various 8-substituted derivatives of guanosine 3',5'-cyclic phosphate, inosine 3',5'-cyclic phosphate, and xanthosine 3',5'-cyclic phosphate.
Biochemistry
12:
5310-5319,
1973[Medline].
11.
Murphy, BJ,
Rossie S,
DeJongh KS,
and
Catterall WA.
Identification of the sites of selective phosphorylation and dephosphorylation of the rat brain Na+ channel
subunit by cAMP-dependent protein kinase and phosphoprotein phosphatases.
J Biol Chem
268:
27355-27362,
1993
12.
Patton, DE,
and
Goldin AL.
A voltage-dependent gating transition induces use-dependent block by TTX of rat IIA sodium channels expressed in Xenopus oocytes.
Neuron
7:
637-647,
1991[ISI][Medline].
13.
Posternak, T,
and
Weimann G.
The preparation of acylated derivatives of cyclic nucleotides.
Methods Enzymol
38:
399-409,
1974[Medline].
14.
Rossie, S,
and
Catterall WA.
Phosphorylation of the alpha subunit of rat brain sodium channels by cAMP-dependent protein kinase at a new site containing ser686 and ser687.
J Biol Chem
264:
14220-14224,
1989
15.
Rossie, S,
Gordon D,
and
Catterall WA.
Identification of an intracellular domain of the sodium channel having multiple cAMP-dependent phosphorylation sites.
J Biol Chem
262:
17530-17535,
1987
16.
Schiffmann, SN,
Lledo P-M,
and
Vincent J-V.
Dopamine D1 receptor modulates the voltage-gated sodium current in rat striatal neurones through a protein kinase A.
J Physiol (Lond)
483:
95-107,
1995[ISI][Medline].
17.
Schreibmayer, W,
Frohnwieser B,
Dascal N,
Platzer D,
Spreitzer B,
Zechner R,
Kallen RG,
and
Lester HA.
-Adrenergic modulation of currents produced by rat cardiac Na+ channels expressed in Xenopus laevis oocytes.
Receptors Channels
2:
339-350,
1994[ISI][Medline].
18.
Schultz, J,
Hoffmüller U,
Krause G,
Ashurst J,
Macias MJ,
Schmieder P,
Schneider-Mergener J,
and
Oschkinat H.
Specific interactions between the syntrophin PDZ domain and voltage-gated sodium channels.
Nat Struct Biol
5:
19-24,
1998[ISI][Medline].
19.
Smith, RD,
and
Goldin AL.
Protein kinase A phosphorylation enhances sodium channel currents in Xenopus oocytes.
Am J Physiol Cell Physiol
263:
C660-C666,
1992
20.
Smith, RD,
and
Goldin AL.
Phosphorylation of brain sodium channels in the I-II linker modulates channel function in Xenopus oocytes.
J Neurosci
16:
1965-1974,
1996
21.
Smith, RD,
and
Goldin AL.
Phosphorylation at a single site in the rat brain sodium channel is necessary and sufficient for current reduction by PKA.
J Neurosci
17:
6086-6093,
1997
22.
Srinivasan, J,
Schachner M,
and
Catterall WA.
Interaction of voltage-gated sodium channels with the extracellular matric molecules tenascin-C and tenascin-R.
Proc Natl Acad Sci USA
95:
15753-15757,
1998
23.
White, MM,
and
Reisine T.
Expression of functional pituitary somatostatin receptors in Xenopus oocytes.
Proc Natl Acad Sci USA
87:
133-136,
1990
24.
Wood, SJ,
and
Slater CR.
-Spectrin is colocalized with both voltage-gated sodium channels and ankyrinG at the adult rat neuromuscular junction.
J Cell Biol
140:
675-684,
1998
This article has been cited by other articles:
![]() |
A. Chatelier, L. Dahllund, A. Eriksson, J. Krupp, and M. Chahine Biophysical Properties of Human Nav1.7 Splice Variants and Their Regulation by Protein Kinase A J Neurophysiol, May 1, 2008; 99(5): 2241 - 2250. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Song, Z. Liu, J. Tan, Y. Nomura, and K. Dong RNA Editing Generates Tissue-specific Sodium Channels with Distinct Gating Properties J. Biol. Chem., July 30, 2004; 279(31): 32554 - 32561. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Lundbaek, P. Birn, A. J. Hansen, R. Sogaard, C. Nielsen, J. Girshman, M. J. Bruno, S. E. Tape, J. Egebjerg, D. V. Greathouse, et al. Regulation of Sodium Channel Function by Bilayer Elasticity: The Importance of Hydrophobic Coupling. Effects of Micelle-forming Amphiphiles and Cholesterol J. Gen. Physiol., April 26, 2004; 123(5): 599 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Vijayaragavan, M. Boutjdir, and M. Chahine Modulation of Nav1.7 and Nav1.8 Peripheral Nerve Sodium Channels by Protein Kinase A and Protein Kinase C J Neurophysiol, April 1, 2004; 91(4): 1556 - 1569. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Grieco, F. S. Afshari, and I. M. Raman A Role for Phosphorylation in the Maintenance of Resurgent Sodium Current in Cerebellar Purkinje Neurons J. Neurosci., April 15, 2002; 22(8): 3100 - 3107. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |