Am J Physiol Cell Physiol AJP citation statistics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 278: C589-C600, 2000;
0363-6143/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (31)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dirksen, W. P.
Right arrow Articles by Fisher, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dirksen, W. P.
Right arrow Articles by Fisher, S. A.
Vol. 278, Issue 3, C589-C600, March 2000

A myosin phosphatase targeting subunit isoform transition defines a smooth muscle developmental phenotypic switch

Wessel P. Dirksen1, Franjo Vladic1, and Steven A. Fisher1,2

Departments of 1 Medicine (Cardiology) and 2 Physiology and Biophysics, Case Western Reserve University School of Medicine, Cleveland, Ohio 44106-4958


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Smooth muscle myosin phosphatase dephosphorylates the regulatory myosin light chain and thus mediates smooth muscle relaxation. The activity of this myosin phosphatase is dependent upon its myosin-targeting subunit (MYPT1). Isoforms of MYPT1 have been identified, but how they are generated and their relationship to smooth muscle phenotypes is not clear. Cloning of the middle section of chicken and rat MYPT1 genes revealed that each gene gave rise to isoforms by cassette-type alternative splicing of exons. In chicken, a 123-nucleotide exon was included or excluded from the mature mRNA, whereas in rat two exons immediately downstream were alternative. MYPT1 isoforms lacking the alternative exon were only detected in mature chicken smooth muscle tissues that display phasic contractile properties, but the isoform ratios were variable. The patterns of expression of rat MYPT1 mRNA isoforms were more complex, with three major and two minor isoforms present in all smooth muscle tissues at varying stoichiometries. Isoform switching was identified in the developing chicken gizzard, in which the exon-skipped isoform replaced the exon-included isoform around the time of hatching. This isoform switch occurred after transitions in myosin heavy chain and myosin light chain (MLC17) isoforms and correlated with a severalfold increase in the rate of relaxation. The developmental switch of MYPT1 isoforms is a good model for determining the mechanisms and significance of alternative splicing in smooth muscle.

smooth muscle phenotype; myosin heavy chain; myosin light chain; alternative splicing


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

CONTRACTION OF SMOOTH MUSCLE occurs by myosin light chain kinase (MLCK)-mediated phosphorylation of myosin, and relaxation occurs by myosin phosphatase-mediated dephosphorylation (19, 29). These smooth muscle contractile proteins are expressed as isoforms which, with the exception of MLCK (12, 16, 45), appear to be generated by alternative splicing of pre-mRNA transcripts. Unlike striated muscles, in which contractile protein isoforms have been shown to confer fast or slow contractile properties (reviewed in Ref. 41), the relationship between contractile protein isoforms and fast (phasic) or slow (tonic) contractile properties in smooth muscle tissue remains unclear (47). It has been suggested that myosin heavy and light chain isoforms confer distinct contractile properties (2, 11, 21, 31, 33-35, 38, 51). It is also possible that variation in the proteins that activate and deactivate the contractile apparatus, i.e., MLCK and myosin phosphatase, contribute to the fast or slow contractile properties.

Smooth muscle myosin phosphatase is a type 1, P-Ser/P-Thr phosphatase (26) that functions as a trimer consisting of ~130-, 38-, and 20-kDa subunits (1, 43, 44). The 130-kDa myosin phosphatase targeting subunit 1 (MYPT1) (48) has also been called MBS, M133, M130 (43), and M110 (8, 22, 28). This subunit targets the 38-kDa PP1 catalytic subunit to the myosin filament (1, 20) and thus is critical to the dephosphorylation of myosin (20). The role of the MYPT1 subunit in regulating myosin phosphatase activity and smooth muscle contractility has been demonstrated in experiments in which the MYPT1 subunit is phosphorylated through the small G protein (rho) pathway (32, 39). Isoforms of MYPT1 have been identified in chicken and rat smooth muscle tissues that also could impart differences in smooth muscle function. Two MYPT1 isoforms were identified in a chicken gizzard cDNA library, one of which differed only by the presence of an additional block of 123 nucleotides in the central portion of the molecule (43). Three distinct MYPT1 (M110) isoforms were identified in rat aorta and kidney cDNA libraries (8, 22, 28). All of the isoforms differ from one another in the central region, and some of them also vary at the carboxy terminus. Their pattern of expression at the mRNA or protein level was not examined.

The aim of this study was to characterize the MYPT1 isoforms that differ in the central region of the protein and understand their relationship to smooth muscle phenotypes and contractile properties. We demonstrate by cDNA and genomic cloning that MYPT1 isoforms are generated in both chicken and rat by cassette-type alternative splicing but that different exons are utilized as alternative exons in the two species. The MYPT1 isoforms were found to be expressed in tissue-specific patterns, and comparisons with myosin heavy chain (MHC) head and myosin light chain (MLC17) splice variant isoforms revealed the complexity of smooth muscle phenotypes. In addition, a developmental switch was identified in the MYPT1 isoform expressed in gizzard smooth muscle, from exon inclusion to exon exclusion, which correlated with an increase in the rate of relaxation of the tissue. The MYPT1 isoform switch occurred after MHC head and MLC17 isoform transitions. These results identify isoform switching in the development of the phasic (gizzard) phenotype, demonstrate the phenotypic diversity of smooth muscle, and suggest that at least two distinct mechanisms exist to regulate smooth muscle tissue-specific mRNA alternative splicing.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Isolation and RT-PCR of RNA. Fertile white leghorn chicken (Gallus gallus) eggs were incubated at 38°C in humidified air. Tissues were harvested from embryonic chicks from 8-21 days of incubation (hatching is 21 days), 1-12 days after hatching, or from adult chickens, after decapitation. Tissues from Sprague-Dawley adult rats (Rattus norvegicus) were harvested after lethal injection. After organs were removed and stripped of adventitia, the smooth muscle tissues were dissected, frozen in liquid nitrogen, and processed for total RNA isolation using a proprietary formulation of guanidinium thiocyanate, Ultraspec II (Biotecx Laboratories), as previously described (12). RT-PCR reactions were performed with 0.5-5 µg input total RNA as previously described (12), to determine the ratios of MYPT1, MHC head, and MLC17 isoforms in the tissues analyzed. Briefly, the RT reaction used 1 µl (25 units) of avian myeloblastosis virus RT (Boehringer Mannheim) for up to 10 reactions at 42°C for 25 min, and PCR was 35 cycles of 95°C for 1 min and 60°C for 1 min (chicken) or 25 cycles of 95°C for 45 s, 55°C for 1 min, and 72°C for 1 min (rat), with a final extension step at 72°C for 7 min in both cases. Splice variants of MHC head, MLC17, and MYPT1 were examined in developing and adult chicken tissues and adult rat tissues, as well as in cultured chicken smooth muscle cells. The following sets of oligonucleotide primers, listed 5'-3', were used in these RT-PCR reactions: to chicken myosin phosphatase targeting subunit 1 (MYPT1) at +1620 GGCCAGTACCTCTGACATTGATGA and +2069 GCTGTAGTCATGGCTGTGGTAGTG, which generated 450 bp (aortic) or 327 bp (gizzard) fragments (43), spanning a 123 nt exon present in adult aorta but not in adult gizzard (see RESULTS and Fig. 1A); to rat myosin phosphatase targeting subunit 1 (MYPT1) at +1589 CAATCCCAAGGCGACTAGGCAGTA and +2191 TCACCCCCTGTGTTGACCGTCTA, which generated fragments of 603 bp, 567 bp, 492 bp, 435 bp, or 423 bp in various rat tissues, spanning two alternative exons of 168 nt and 180 nt each (see RESULTS, Fig. 1A, and Refs. 8, 22, 28); to smooth muscle MHC head at +511 GACATGTACAAGGGAAAGAAGAGGCA and +840 ATCGGGAGGAGTTGTCATTCTTGAC, which generated 330 bp (aortic) or 351 bp fragments (gizzard), spanning a 21 nt exon present in adult gizzard but not in adult aorta (31); to MLC17 at +67 GAGTTCAAGGAGGCATTCCAGCTGT and +465 CGCTCAGCACCATCCGGACGAG, which generated 422 bp (MLC17a, intestinal) and 461 bp (MLC17b) fragments, spanning a 39 nt exon present in a fraction of adult aorta transcripts but not in adult gizzard transcripts (38).

PCR products were visualized by ethidium bromide staining of 2% agarose gels. Bands were quantified directly using Multi-Analyst/MacIntosh software (Bio-Rad Laboratories), making sure that samples used for quantification were in the linear range of amplification, i.e., isoform ratios did not change over an approximate 10-fold range of input RNA at the cycle number used (data not shown). The accuracy of the quantitative RT-PCR for MHC head and MLC17 isoforms has been reported previously (13). The RT-PCR values given in the text represent means ± SD of the ratios of the two isoforms from three animals, with a few exceptions that are noted in the figure legends.

Identification of RT-PCR products. Selected products of the RT-PCR of chicken and rat MYPT1 mRNA were cloned and sequenced to identify the alternative spliced isoforms. The DNA fragments generated in the PCR were separated by electrophoresis through a 2% agarose gel. The ethidium bromide stained bands were cut out and purified using a QIAEX II gel extraction kit according to the manufacturer's instructions (Qiagen). The purified bands were cloned into the vector pCR2.1 using the TA cloning kit (Invitrogen). Approximately 1-2.5 µg of purified DNA from each positive clone was sequenced on an automated ABI DNA sequencer. The identities of the RT-PCR products were also confirmed by Southern blot analysis of selected gels containing RT-PCR products from multiple chicken smooth muscle tissues.

Western blotting. Gizzards (0.1-0.6 g) from chicks at various stages of development were homogenized in 1-1.5 ml of lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 10% glycerol, 1% Nonidet P-40, 20 mM NaF, 0.2 mM Na3VO4, 5 mM Na2Mo4, 2 mM phenylmethylsulfonyl fluoride, 20 µg/ml aprotinin, 20 µg/ml leupeptin, and 50 µg/ml soybean trypsin inhibitor). Homogenates were incubated for 20 min on ice and cleared by centrifugation for 20 min at 10,000 g. Total protein concentration of each supernatant was measured using the Bradford (Bio-Rad) method (6).

Twenty-five to 50 µg of protein from each gizzard homogenate was separated by SDS-PAGE using a modified Laemmli procedure (27). Samples were electrophoresed through 6% polyacrylamide gels (37.5:1 acrylamide:N,N'-methylenebisacrylamide) at 120 V for 2-2.5 h and blotted onto nitrocellulose membranes. The membranes were blocked with 5% dry milk in washing buffer (10 mM Tris, pH 7.4; 150 mM NaCl, 0.1% Tween 20) overnight at 4°C, incubated with a monoclonal antibody against myosin phosphatase (ASC.M130 from BabCO at 1:1,000 dilution ) for 1 h, washed for 1 h, and incubated with the secondary antibody conjugated to horseradish peroxidase (goat anti-mouse IgG, from Calbiochem at 1:5,000 dilution) for 1 h. After further washing, M133/M130 isoforms were detected using the enhanced chemiluminesence kit (ECL Plus, Amersham).

Cloning of chicken and rat MYPT1 genes. Total DNA was isolated from chicken and rat liver tissues using the Puregene DNA isolation kit (Gentra Systems). PCR-amplified genomic fragments of the MYPT1 gene were generated from each DNA sample using the Expand Long Template PCR system (Boehringer Mannheim). The following sets of oligonucleotide primers, listed 5'-3', were used in these PCR reactions. 1) Chicken myosin phosphatase targeting subunit 1 (MYPT1) at +1403 CTGCTTCGTGGAGGTTAGGTCTT and +2069 GCTGTAGTCATGGCTGTGGTAGTG, which generated a fragment of ~7 kb. This fragment was digested with Pst I, subcloned into pBluescript SK(+) (Stratagene), and sequenced with an automated ABI DNA sequencer. Greater than 95% of the genomic clone was sequenced in both directions, with the remainder sequenced in one direction. The sequence of the splice sites were confirmed by sequencing these portions from a second, independent PCR clone. 2) Rat myosin phosphatase targeting subunit 1 (MYPT1) at +1558 AAAGGATCCAGACTTGCATATGTCGCCCC +2087 CTCGAGCTCACCTCTGATGTGGAGGAAAG, which generated a fragment of ~2.6 kb. This fragment was cloned into the vector pCR2.1 and sequenced as described above.

The DNA sequences for these two genomic fragments were assembled from the sequences obtained from individual sequencing reactions using the SEQMAN program from the Lasergene software (DNASTAR). The chicken and rat genomic sequences were then aligned to one another using the Jotun Hein and Clustal algorithms in the Megalign program from the Lasergene software.

Force measurements. Chicken gizzard and aorta strips were excised from embryos at day 14/16 of development [embryonic day (ED)14] or from chicks 6 days after hatching (day 6). Smooth muscle strips (typically 250-1,000 µm long, 80-150 µm wide, and 80-150 µm thick) were dissected in relaxing solution (5 mM MgATP, 5 mM EGTA, 25 mM potassium methane sulfonate, pH 7, 6.9 mM MgCl2, 25 mM creatine phosphate, 2 mM glutathione, final pH to 7 with 1 N KOH) and mounted between two aluminum foil T clips (17). The preparations were then skinned at room temperature for 15 (gizzard) or 30 (aorta) min in a relaxing solution containing 400 µM beta -escin. After skinning, the tissues were mounted onto the stage of a computer-controlled mechanics workstation (46). One end of the tissue strip was hooked to a length driver (Physik Instrumente, Waldbron, Germany) and the other to a force transducer (Akers AE 801; Sensonor, Horten, Norway). The strips were stretched to optimum length for force development, which is 1.3 times their resting length, and allowed to equilibrate in relaxing solution for 10-20 min. Contractions were initiated by transferring the strips to a well containing pCa 4 activating solution (60 mM potassium methane sulfonate, pH 7, 5 mM EGTA, 5.3 mM CaCl2, 6.98 mM MgCl2, 5.56 mM Na2ATP, 25 mM creatine phosphate, 25 mM N,N-bis[2-hydroxyethyl]-2-aminoethanesulfonic acid final pH to 7 with 1 N KOH), and, after force reached a steady state, relaxation was initiated by transferring the preparations back into relaxing solution. The force trace was recorded on a digital oscilloscope (Nicolet). To determine the rate of relaxation, the force vs. time trace was fit to a single exponential decay. Results are reported as means ± SE (n = 3).

Smooth muscle cell culture. Gizzards and aortas were removed from 1- to 2-day-old chicks, separately minced into fine fragments, and digested with 0.15% type 1 collagenase (lot #M3S321J, Worthington Biochemical) in Ca2+/Mg2+-free Hanks' balanced salt solution (Life Technologies) for 30 min at 37°C on a rotation wheel. The digestion mix was subjected to brief low-speed centrifugation to pellet tissue fragments, which were then subjected to repeated rounds of collagenase digestion. The supernatant was centrifuged at 1,200 rpm for 5 min to pellet cells that were then resuspended in 10% fetal bovine serum (FBS) and stored on ice. This process was repeated for 5-7 cycles, and the pooled cells were plated at a density of 2-5 × 104 cells/cm2. Cells were cultured on tissue culture plastic in the presence of serum (10% FBS) with a DMEM/F-12 mix. Cells were passaged and characterized as previously described (13). Cells were harvested for RNA analysis after 0 to 5 passages.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Smooth muscle MYPT1 isoforms are generated by alternative splicing. Smooth muscle MYPT1 isoforms identified to date contain blocks of sequence that differ between these isoforms, suggesting that these isoforms are generated by alternative splicing from single pre-mRNAs (8, 22, 28, 43). To test this, we cloned portions of the chicken and rat MYPT1 genes by PCR using oligonucleotides that flank the presumptive alternatively spliced middle section of the MYPT1 pre-mRNA. PCR of chicken and rat genomic DNA yielded single fragments of ~7 and 2.6 kb, respectively. This observation, along with the results of Southern blot analysis (data not shown), is consistent with the presence of a single MYPT1 gene. A second myosin phosphatase targeting subunit gene (MYPT2) has 50% nucleotide sequence similarity to MYPT1 and is expressed in brain and cardiac muscle (15).

RT-PCR was performed on RNA from a number of chicken and rat smooth muscle tissues. Several RT-PCR products were observed that were purified, cloned, and sequenced. Comparison of sequences of the MYPT1 genes, RT-PCR products, and the reported MYPT1 isoforms (8, 22, 28, 43) was consistent with the generation of MYPT1 isoforms by alternative splicing of single gene pre-mRNAs (Fig. 1A). The genomic fragment cloned from chicken contains five exons and four introns. Each exon is flanked by sequences that are good matches to the consensus sequence for 5'-splice sites (CAG:GURAGU) and 3'-splice sites, which are characterized by a branch site (UNCURAC), a polypyrimidine tract of 18-38 nucleotides, and an acceptor site (CAG:G; see Fig. 1B and Refs. 18 and 42). Two chicken isoforms were identified in the RT-PCR that correspond to the reported M130 and M133 isoforms (43). These two isoforms differ by inclusion or exclusion of the 123 nt exon (Fig. 1A). No additional MYPT1 isoforms were identified in chicken after cloning and sequencing of selected products from the RT-PCR reaction.



View larger version (2573K):
[in this window]
[in a new window]
 
Fig. 1.   Structure and sequence of chicken (Ch) and rat myosin phosphatase targeting subunit 1 (MYPT1) genes and mRNA splice variants. A: the cloned middle portions of chicken and rat MYPT1 genes are shown in schematic form, as well as all splice variants detected by RT-PCR that arise from this portion of the gene. Exons, boxes; introns, horizontal lines connecting exons [they are each identified above diagram by numbers (exons) and letters (introns)]. Exon number refers only to cloned segment, not to its position within entire gene. Solid boxes, alternative exons. Sizes of exons and introns are not drawn to scale but are as shown in numbers below each exon and intron. Numbers in parentheses, exons that are at ends of cloned genomic fragments and whose sizes were inferred by comparison between genomic fragments and/or to cloned cDNA sequences. Chicken MYPT1 splice variants, V-shaped lines above (inclusion of alternative exon) and below (skipping of alternative exon) chicken gene diagram. Rat MYPT1 splice variants are depicted below the rat genomic fragment by boxes (exons included in mature mRNA) connected by V-shaped lines. Each of five rat isoforms is depicted by a separate diagram. Arrows, location of oligonucleotide primers used in RT-PCR reactions. B: alignment of portions of chicken and rat MYPT1 genomic cloned fragments. Dots, identical nucleotides in rat and chicken sequences; dashes, whenever gaps or deletions are required for maximal alignment; =, portions of sequences that are not shown; ( ), number of nucleotides not shown. Full sequences for chicken and rat MYPT1 genomic fragments can be obtained from sequence data banks under GenBank accession nos. AF110177 and AF110176, respectively. Exon sequences are boxed, and shaded boxes represent alternative exons. Chicken and rat sequences were aligned to each other using Jotun Hein algorithm in Megalign program from Lasergene software (DNASTAR).

The comparable genomic fragment cloned from rat contains four exons and three introns, due to the use of a different 5' PCR oligonucleotide primer that hybridizes 170 nucleotides downstream from the chicken 5' oligonucleotide. These exons are also flanked by typical 5'- and 3'-splice sites (see Fig. 1B). RT-PCR of MYPT1 mRNA in rat smooth muscle tissues revealed the presence of five distinct isoforms that differ from one another in the third and fourth exons of the rat genomic fragment. The largest product (isoform 1; Fig. 1A) includes all four of the exons in this region and corresponds to the rat3 isoform identified in rat aorta (28) and the chicken M133 isoform (43). The smallest product can be resolved into two distinct mRNAs that are very similar in size. One of these two products, isoform 4, corresponds to that identified in a rat aorta cDNA library (8) and is missing the exon labeled as exon 4 (168 nt) in Fig. 1A. The other isoform, isoform 5, corresponds to that identified in a rat kidney cDNA library (22) and is missing the exon labeled as exon 5 (180 nt) in Fig. 1A. We also identified two new isoforms (isoforms 2 and 3) that contain portions of exon 4. Isoform 3 contains 57 nt of the 168 nt exon, whereas isoform 2 contains these same 57 nt plus an additional 75 nt from the 168 nt exon. Alternative cryptic 3'-splice sites, containing canonical AG dinucleotides but poor polypyrimidine tracts, are used to generate these two isoforms. From these analyses of the chicken and rat MYPT1 genes and mRNA transcripts, it is evident that the exon that is alternative in chicken (exon 3) is constitutive in rat. In contrast, the two immediate downstream exons are alternative in rat and constitutive in chicken (exons 4 and 5, Fig. 1A). Of note, the number of nucleotides in each of the alternatively spliced exons, even when the cryptic splice sites are used, are divisible by three, so that the translation reading frame is maintained in each isoform.

MYPT1 isoforms in chicken smooth muscle tissues. A previous study had identified two distinct isoforms of MYPT1 in a chicken gizzard cDNA library (43), but their pattern of expression was not examined. We selected smooth muscle-containing tissues that are known to display contrasting contractile properties to determine whether the pattern of expression of MYPT1 mRNA isoforms correlated with these known properties. RT-PCR was performed across the region of the mRNA that had been previously identified to contain isoformic differences (43) and yielded the expected DNA fragments of 327 and 450 bp, corresponding to the exon-skipped and exon-retained products, respectively. The ratios of the exon-included to exon-excluded products in each tissue were directly quantified (see METHODS). This method of quantification was linear over an approximate 10-fold range of input RNA (data not shown). Because the fluorescence of ethidium bromide intercalated into the DNA is measured, and this is proportional to the mass of DNA, the molar amount of the smaller (exon-excluded) DNA product will be underestimated relative to the larger product by ~30% (i.e., the difference in their mass).

The exon-included isoform was the exclusive isoform in the arterial tissues examined, the aorta and mesenteric arteries (Fig. 2 and Table 1). In the phasic portal vein, in contrast, the exon-included to exon-skipped mRNAs were detected at a ratio of 5:1. In the lung and visceral tissues, intestines and bladder, the ratios were 24:1, 7:1, and 32:1, respectively. In contrast, the gizzard tissue was the only tissue in which the exon-skipped isoform was predominant (1:15). The pattern of expression of the exon-included and exon-excluded MYPT1 transcripts is in good agreement with the distribution of the M130 and M133 proteins determined by Western blotting (40), suggesting that the M130 and M133 proteins are generated from the exon-excluded and exon-included transcripts, respectively (see MYPT1 isoform switches in developing tissues and cultured cells).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 2.   Tissue-specific expression of chicken MYPT1 splice variant isoforms. RT-PCR was performed on 2.5 µg of RNA isolated from each tissue using oligonucleotides as described in METHODS. RT-PCR products were examined by ethidium bromide staining of 2% agarose gels. Quantification of isoforms was performed directly on gels with Multi-Analyst/MacIntosh software and percentage of each isoform was plotted in bar graph shown below gel. Labels to left of gel refer to exon-included (450 bp) and exon-skipped (327 bp) RT-PCR products; n.s., nonspecific RT-PCR products, as determined by cloning and sequencing of these products. Size markers, in bp, are indicated to right of gel. AO, aorta; MA, mesenteric arteries; PV, portal veins; GI, gizzard; IN, intestines; BL, bladder; LU, lung. Quantification of isoforms in each tissue represents means ± SD from 3 animals, with exception of lung (n = 4).


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Summary of MLC17, MHC-head, and MYPT1 isoforms in chicken smooth muscle tissues

MYPT1 isoforms in rat smooth muscle tissues. Because the isoforms of chicken and rat MYPT1 were not identical, it was of interest to determine whether they would exhibit similar tissue-specific patterns of mRNA expression. The pattern of expression of rat MYPT1 mRNA isoforms was determined by RT-PCR using oligonucleotides that bracket the alternative exons (Fig. 1A). Quantification of the RT-PCR products from rat smooth muscle tissues revealed that, whereas the five rat MYPT1 isoforms shown in Fig. 1A are present in all tissues examined, there are significant quantitative differences in the expression of these isoforms (Fig. 3). The isoform in which all exons are present, isoform 1, is detected in all tissues examined, and is predominant in all of these tissues except the lung. Isoforms 2 and 3, which are generated by the use of alternative 3'-splice sites (Fig. 1A), are minor variants never accumulating to more than 15% of the MYPT1 mRNA. Isoforms 4 and 5, which are generated by the skipping of an alternative exon (Fig. 1A), are also detected in all tissues examined, although the ratio between them differs among the tissues examined.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3.   Patterns of expression of rat MYPT1 splice variant isoforms. RT-PCR was performed on 1-3 µg of RNA isolated from each tissue, using the oligonucleotides as described in METHODS. Visualization of products, identification, and quantification were as described in Fig. 2. Migration of each of five MYPT1 isoforms diagrammed in Fig. 1A is indicated to left of gel and their sizes are as follows: isoform 1, 603 bp; isoform 2, 567 bp; isoform 3, 492 bp; isoform 4, 435 bp; isoform 5, 423 bp. AO, aorta; PV, portal vein; ST, stomach; IN, intestines; BL, bladder; LU, lung; MW, mol wt markers. Identity of each isoform was verified by performing RT-PCR on each tissue using different sets of oligonucleotides that specifically recognize individual isoforms (data not shown). Quantification of isoforms in each tissue represents means ± SD from 3 animals, with exception of stomach (n = 2). Isoforms 2 and 3 are more clearly visible on longer exposures that overexpose isoforms 1, 4, and 5.

Comparison of the tissue-specific expression of chicken and rat MYPT1 mRNA isoforms reveals similarities and differences. The exon-included isoform is present in all tissues examined. The exon-excluded isoform is abundant in both chicken gizzard and its equivalent rat structure, the stomach. An intriguing difference is that the rat lungs express predominantly the exon-skipped isoform, whereas this isoform is barely detected in chicken lungs. A second difference is that in chicken aorta only exon inclusion is observed, whereas in rat aorta the exon-skipped isoforms are present.

Tissue patterns of MHC head and MLC17 splicing. We correlated the pattern of expression of MYPT1 mRNA isoforms with MHC head and MLC17 mRNA isoforms, two other contractile proteins in which isoforms generated by alternative splicing have been suggested to be determinants of smooth muscle tonic and phasic contractile properties (2, 11, 23, 34, 35, 51). MHC head transcripts in chicken thoracic arterial tissues and abdominal aorta, as well as in first, second, and third mesenteric artery subbranches, were exclusively of the exon-skipped isoform (Fig. 4A, data not shown). In the portal vein, the ratio of MHC head isoforms was 1.7:1 (exon inclusion:exon skipping), and in the lung, the ratio was 0.31:1. In the visceral tissues, MHC head splicing varied from exclusive exon inclusion in the gizzard to predominant exon skipping (0.1:1) in the bladder, with the intestine showing an intermediate ratio of 0.36:1.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4.   Tissue-specific expression of chicken myosin light chain (MLC17) and myosin heavy chain (MHC) head splice variant isoforms. RT-PCR, visualization, identification, and quantification of bands was as described in Fig. 2. Sizes for RT-PCR products are as follows: MHC exon-in, 351 bp; MHC exon-out, 330 bp; MLC17 exon-in, 461 bp; MLC17 exon-out, 422 bp. Size markers, in bp, are indicated to right of gel. AO, aorta; MA, mesenteric arteries; PV, portal veins; GI, gizzard; IN, intestines; BL, bladder; LU, lung. Quantification of isoforms in each tissue represents means ± SD from 3 animals, with exception of lung (MHC head, n = 4; MLC17, n = 5).

In the chicken arterial vessels examined, splicing of MLC17 shifted from a ratio of 1.7:1 (exon inclusion:exon skipping) in the thoracic aorta to 0.77:1 in the abdominal aorta and mesenteric branch arteries (Fig. 4B, data not shown). The phasic portal vein displayed a predominance of the MLC17 exon-skipped isoform (0.23:1), whereas the lung displayed a slight predominance of this isoform (0.67:1). The phasic visceral tissues exhibited a range of isoforms in which the intestine and bladder showed an exon-skipping predominance (0.3:1), like the portal vein, whereas the gizzard showed exclusive exon skipping.

In summary, based on the patterns of expression of MYPT1, MHC head, and MLC17 mRNA isoforms in chicken, there appears to be a spectrum of smooth muscle tissue types that we placed into four subgroups (Table 1). In group 1, large and small arteries exhibit exclusive exon inclusion in MYPT1 and exon skipping in the MHC head, with a mixture of MLC17 isoforms. In groups 2 and 3, bladder, lung, intestines, and portal vein exhibit mixtures of MHC head, MLC17, and MYPT1 splice variants, with the main difference being that MHC head exon-out is predominant in group 2 and MHC head exon-in is predominant in group 3. Finally, gizzard appears to represent the "purest" example of phasic tissue with exclusive exon inclusion in MHC head and exon skipping in MLC17, and a predominance of exon skipping in MYPT1.

MYPT1 isoform switches in developing tissues and cultured cells. The spectrum of phenotypes observed in mature smooth muscle tissues led us to hypothesize that there may be temporal variation in isoform switching of MYPT1, MHC head, and MLC17 isoforms during the developmental specification of smooth muscle phenotypes. Embryonic aortic and gizzard tissues were examined to test this hypothesis because they are most representative of tonic and phasic phenotypes (Table 1), respectively, and each tissue is easily identifiable during development. We examined the ratios of MYPT1 isoforms throughout chicken development by RT-PCR. The embryonic aorta, at the earliest time point examined, ED10, exhibited only the exon-included isoform of MYPT1 (Fig. 5A). This pattern of exclusive expression of the exon-included isoform continued throughout development to the adult aorta without change. In the gizzard, the exon-included MYPT1 isoform was exclusively present early in development, as observed throughout the development of the aorta. The exon-skipped transcript was first detected at ED16, and a striking switch in isoforms from exon inclusion to exon skipping occurred around the time of hatching. This switch occurred much later (ED19-day 4 posthatching) than the transitions in the MHC head and MLC17 isoforms, which, as we previously reported, occurred between ED10 and 16 (Ref. 13 and Fig. 5B). Of note, in the case of all three mRNAs, the embryonic gizzard initially expressed isoforms present in the embryonic and mature aorta, whereas the reverse was not true.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 5.   MYPT1, MLC17, and MHC head splicing isoforms during development of chicken aorta (tonic) and gizzard (phasic). Tissues were removed from chicken embryos at days 8, 10, 14, 16, and 19 of development (hatching is at 21 days), from chicks 1 and 4 days after hatching (D1 and D4), and from adult (AD) chickens. RT-PCR was performed on 2.5 µg of RNA isolated from each stage, using oligonucleotides described in METHODS. A: MYPT1 isoforms. Labels on sides of gel are same as in Fig. 2. Quantification of MYPT1 isoforms is shown in bar graph at bottom and represents means ± SD from 3 animals, with exception of day 4 gizzard (n = 4). B: MLC17 and MHC head isoforms. Isoform switches in gizzard are evidenced by the following ratios obtained by quantification of isoforms at each stage of development: MLC17: embryonic day (ED)8, 1.9 (exon-in):1 (exon-out); ED14, 0:1; ED19, 0:1; AD, 0:1. MHC: ED8, 1.8:1; ED14, 3.8:1; ED19, 10:1; AD, 1:0. Isoforms are indicated on left of gel, and mRNA type on right of gel.

The developmental switch in gizzard MYPT1 transcripts was paralleled by a switch from M133 to M130 protein expression (Fig. 6). The embryonic gizzard, in its early stages of development, contained only the M133 protein, corresponding to the exclusive exon-included transcript observed at this stage. Between ED18 and day 5, a complete transition in MYPT1 isoforms from M133 to M130 occurred, corresponding to the transition from exon-included to exon-skipped transcripts. The protein isoform switch follows the mRNA isoform switch with an ~24 h delay. These results demonstrate that isoform shifts observed at the mRNA level are translated into differences in protein expression.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   MYPT1 protein switches from M133 isoform to M130 isoform during gizzard development. At various stages of development, 25-50 µg of protein from gizzard homogenates were separated on a 6% SDS-PAGE gel. After transfer to nitrocellulose, blot was probed with a monoclonal antibody that recognizes MYPT1 isoforms, M133 (exon-in) and M130 (exon-out) (43). ED16, ED18, and ED 20 refer to embryonic days 16, 18, and 20, respectively. D1, D2, and D5 refer to day 1, day 2, and day 5 after hatching, respectively. Size markers to right of gel refer to myosin (200 kDa) and beta -galactosidase (116 kDa).

Smooth muscle cells placed in culture also modulate their phenotype (7). The coordinated switch of alpha -tropomyosin and caldesmon splice variants in cultured gizzard and aorta smooth muscle cells suggested that they may share a common regulatory mechanism (30). This contrasted with what we observed with MHC head, MLC17, and MYPT1 isoforms in the developing gizzard. To test whether the phenotypic modulation resulting from a growth stimulus upon cell culture recapitulated the developmental program, smooth muscle cells isolated from the aortas and gizzards of newly hatched chicks were cultured on tissue culture plastic in 10% FBS. Under these conditions, the splice variants of MYPT1, MHC head, and MLC17 expressed in cultured gizzard smooth muscle cells all switched to the more embryonic, aortic pattern of splicing (Fig. 7, lanes 3 and 4). The cultured aorta smooth muscle cells maintained the aorta tissue pattern of splice variants (lanes 1 and 2). This is consistent with the aortic pattern being the default or early embryonic pattern of splicing for all three mRNAs. The splicing pattern in cultured gizzard smooth muscle cells reverted to the more embryonic type within 16 h of plating of freshly isolated cells (data not shown). Thus, whereas at least two separate periods of phenotypic switching were identified during gizzard development, when these cells are placed in culture, the phenotypic switch appears to be synchronous.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7.   MLC17, MHC head, and MYPT1 splice variant isoforms revert to more embryonic aortic pattern in cultured gizzard smooth muscle cells. Aorta and gizzard cells were isolated from 1- to 2-day old chicks as described in METHODS and cultured in 10% fetal bovine serum. RNA was isolated from cultured cells, as well as from tissues that were used to obtain isolated smooth muscle cells. MLC17, MHC head, and MYPT1 isoforms were detected in 1 µg of each RNA sample by RT-PCR. Numbers to right of gels refer to sizes of each isoform. Lane 1, aorta tissue; lane 2, aorta cells cultured for 2 passages; lane 3, gizzard tissue from 2-day-old chick; and lane 4, gizzard cells cultured for 2 days after isolation from tissue.

Rates of relaxation of embryonic smooth muscles. MYPT1 is known to mediate smooth muscle relaxation by the dephosphorylation of MLC20 (20). It was, therefore, of interest to determine whether expression of MYPT1 isoforms correlated with functional properties of smooth muscle. The rates of smooth muscle relaxation were measured for gizzard tissues prior to (ED14) and subsequent to (day 6) MYPT1 isoform switching. Skinned smooth muscle strips from ED14 and day 6 gizzard were activated in pCa 4 activating solution, and, after force reached a steady state, relaxation was initiated by transferring the preparations back into relaxing solution. The rate of relaxation of the ED14 gizzard strips was approximately threefold slower than that of the posthatched gizzard (Table 2). In contrast, the rate of relaxation of aortic strips, which do not switch MYPT1 isoforms, did not vary through development. Thus the transition in the expression of MYPT1 isoforms in the gizzard correlates with a threefold increase in the rate of relaxation of the tissue.

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Relaxation rates for gizzard and aorta tissues


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we have demonstrated that isoforms of both rat and chicken MYPT1 arise by alternative splicing of single gene pre-mRNAs. Whereas the gene structures are similar in rat and chicken, the MYPT1 isoforms that are generated are distinct. The MYPT1 isoforms in both chicken and rat are expressed in tissue-specific patterns. In addition, a developmental transition in the expression of the MYPT1 isoforms correlated with an increase in the rate of relaxation of chicken gizzard smooth muscle.

The exon-intron structure of chicken and rat MYPT1 genes are quite similar, yet the generation of mRNA isoforms by cassette-type alternative splicing is distinct between species. In chicken, a single exon is included or excluded in the central region of MYPT1 pre-mRNA, and the difference in size (123 nt) of these transcripts corresponds to the M130 and M133 isoforms detected by Western blotting of gizzard proteins (Ref. 40 and this study) and identified in a gizzard cDNA library (43). In rat, the two exons downstream of this exon are alternatively spliced to give rise to five distinct MYPT1 isoforms. Three of these isoforms (1, 4 and 5; Fig. 1A) have been previously identified as rat aorta and kidney isoforms of MYPT1 (8, 22, 28). However, they are not specific to the aorta and kidney, because these isoforms were present in all the tissues that we examined. In contrast to the expression of MYPT1 mRNA isoforms in chicken, in which the exon-skipped isoform is restricted to visceral tissues and portal vein, the exon-skipped isoforms in rat are expressed in all tissues examined, but at varying stoichiometries. The expression of rat MYPT1 isoforms at the protein level has not been examined.

The regulatory elements that account for the developmental and tissue-specific splicing of the MYPT1, as well as MHC head and MLC17, have not been identified. Analysis of the chicken and rat MYPT1 gene sequence in and surrounding the alternative exons revealed several aspects that could play a role in the regulated splicing of the exons. The exons that are constitutively spliced in chicken tissues have a high degree of sequence similarity with the corresponding rat exons (83%, 81%, and 89% for exons 2, 4, and 5, respectively). In contrast, the chicken alternative exon (exon 3) has only 64% sequence identity with the corresponding rat exon, and the largest difference in size (123 nt vs. 105 nt, Fig. 1). The 5'-splice site from chicken (alternative) exon 3 (AAG:GUGGGG) would appear to be weak/suboptimal as it is similar to the bovine growth hormone intron D 5'-splice site (CGG:GUGUGG) that is known to be weak/suboptimal (10). However, the 5'-splice site from rat exon 3 (AAG:GUAUGA) also deviates from consensus (CAG:GURAGU), suggesting that it is also weak/suboptimal, yet this exon is constitutively spliced. This suggests that the weak 5' splice site by itself is not sufficient for regulated splicing. It is possible that purine-rich sequences within the exons function as SR protein (arginine-serine rich splicing factors) protein binding sites and affect splicing (4, 5, 14, 50), although the purine content of exon 3 of the chicken (regulated) and rat (constitutive) pre-mRNAs are similar. One striking difference between these segments of the chicken and rat genes is the size of the introns. The chicken alternative exon is flanked by introns that are considerably larger than the corresponding rat introns (2,724 and 2,303 nt vs. 950 and 803 nt; introns B and C in Fig. 1A). Longer introns are removed less efficiently than shorter introns (3, 9), rendering the splicing of exons surrounded by larger introns susceptible to regulation. In this regard, it is notable that the splicing of the chicken alternative exon is more tightly regulated than that of the rat alternative exons that are flanked by smaller introns. In addition, several sequence elements were identified in the introns downstream of the alternative chicken and rat exons that are present in the introns of other genes and regulate pre-mRNA splicing (data not shown). The importance of exon and intron size, splice site sequence, and regulatory sequences within the exons and introns in regulating splicing can only be determined by examining the effects of mutations and deletions of the gene on the splicing of the alternative exon.

The relationship of MYPT1 isoforms to smooth muscle phenotypes was determined in several ways. Examination of a number of chicken smooth muscle-containing tissues demonstrated that the exon-excluded isoform was only detected in phasic contracting smooth muscle tissues. However, the ratio of exon-excluded to exon-included transcripts varied in these tissues, suggesting diversity in smooth muscle phenotypes. Some of this variation might be attributed to the presence of nonmuscle cells in the tissues, because isoforms of many contractile proteins present in smooth muscle, including MYPT1, are also expressed in nonmuscle cells (7, 40). Nonetheless, it is unlikely that this explanation accounts for a substantial portion of the variability between tissues for the following reasons. First, we compared the expression of MYPT1 mRNA isoforms with that of smooth muscle MHC head mRNA isoforms. The smooth muscle MHC gene product is not expressed in nonmuscle cells (37), yet there was also considerable variation in isoforms expressed between tissues. This is consistent with a prior study that demonstrated that single smooth muscle cells within a smooth muscle tissue, rabbit carotid artery, show a dispersion in the expression of smooth muscle MHC (SM1/SM2) isoforms (36). Second, we demonstrated that, during smooth muscle developmental specification, transitions in the MHC head and MLC17 alternatively spliced isoforms are temporally distinguished from the transition in MYPT1 isoforms (ED10-16 vs. hatching). This suggests that the regulation of the splicing of the MHC head and MLC17 gene products is distinct from that of the MYPT1 gene product. This distinction was not evident when smooth muscle cells were placed in culture. The gizzard smooth muscle cells synchronously converted from the gizzard-specific pattern of splicing of MHC head, MLC17, and MYPT1, to the more embryonic, aortic pattern of splicing after less than 24 h in cell culture. Third, interspecies comparisons further exemplifies the complexity of smooth muscle phenotypes. Whereas the splice variant isoforms of MHC head and MLC17 are the same in mammals and birds (2, 23, 34, 51), the MYPT1 isoforms examined in this study are not. In addition, there are similarities but also differences in the tissue patterns of expression of the mRNA isoforms across species. Some of these differences include the fact that the avian bladder and intestines express predominantly the exon-skipped MHC head isoform (2, 23, 34, 51), whereas, in rat and rabbit, the exon-included isoform is predominant in these smooth muscle tissues (34, 51). Also, it has been reported that the muscular rabbit femoral artery expresses the MHC head exon-inclusion isoform (11), whereas our analysis of chicken mesenteric arteries, as well as human internal mammary artery, coronary arteries, and saphenous vein did not detect this isoform (Fig. 4A, data not shown). Thus the spectrum of smooth muscle phenotypes appears to approach the complexity observed in skeletal muscle fiber types (41).

How do the contractile protein isoforms influence smooth muscle contractile properties? The expression of MHC head and MLC17 isoforms correlates with the rates of force development of various smooth muscle tissues (reviewed in Ref. 47), although as discussed above there is considerable complexity of the phenotypes. This correlation is supported by in vitro measurements of myosin ATPase activity and velocity of actin translocation (21, 23, 31, 34, 35) with MHC head and MLC17 isoforms. In the current study, we have demonstrated that a developmental switch in MYPT1 isoforms correlates with an increase in the rate of relaxation of the gizzard tissue (Fig. 6 and Table 2). Importantly, the developmental MYPT1 isoform switch and increase in the rate of relaxation occurs after MHC head and MLC17 isoform switches, thus separating this effect from the possible confounding effect of a faster myosin molecule. Although the structure-function relationships for MYPT1 and its isoforms is not clear (24, 28), it is interesting to note that the region of isoform differences in MYPT1 examined in this study lies between two MYPT1 phosphorylation sites. One site has been implicated in the regulation of phosphatase activity during mitosis (Ser-430 of M130/M133) (see Ref. 49) and the other in the regulation of smooth muscle relaxation (Thr-695 of M133) (see Refs. 20 and 25). The correlation that we observed between MYPT1 isoform switching and changes in smooth muscle relaxation rates provides a rationale for future studies to determine the role of MYPT1 isoforms in smooth muscle contractility.

In summary, we have demonstrated cassette-type alternative splicing and differential usage of alternative 3'-splice sites of MYPT1 pre-mRNA to generate several MYPT1 isoforms in chicken and rat. Variations in MYPT1, MHC head, and MLC17 mRNA isoform expression across smooth muscle tissues demonstrate the complexity of smooth muscle tissues both within and across species. Analysis of developmental phenotypic specification demonstrates two distinct periods of isoformic switching, suggesting at least two distinct regulatory mechanisms. The switches of MYPT1, MLC17, and MHC head isoforms during chicken gizzard development are good models for identifying the mechanisms of tissue-specific alternative splicing in smooth muscle.


    ACKNOWLEDGEMENTS

We thank Frank Brozovich and Ozgur Ogut for technical assistance with force measurements, Yasuchika Takeishi and Karim Berrada for technical assistance with Western blots, and Katherine M. Joyce, Lisa Gogol, and Afzal Nabi for technical assistance with RT-PCR. We also thank Fritz M. Rottman and Mitsuo Ikebe for critically reading the manuscript.


    FOOTNOTES

S. A. Fisher was supported by National Heart, Lung, and Blood Institute Grant K08HL-03275. W. P. Dirksen was supported in part by National Institutes of Health-National Research Service Award Training Grant AG-00105-12.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: S. A. Fisher, 422 BRB, 2109 Adelbert Road, Cleveland, OH 44106-4958 (E-mail: saf9{at}po.cwru.edu).

Received 9 August 1999; accepted in final form 1 October 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Alessi, D., L. K. MacDougall, M. M. Sola, M. Ikebe, and P. Cohen. The control of protein phosphatase-1 by targetting subunits. The major myosin phosphatase in avian smooth muscle is a novel form of protein phosphatase-1. Eur. J. Biochem. 210: 1023-1035, 1992[Web of Science][Medline].

2.   Babij, P. Tissue-specific and developmentally regulated alternative splicing of a visceral isoform of smooth muscle myosin heavy chain. Nucleic Acids Res. 21: 1467-1471, 1993[Abstract/Free Full Text].

3.   Bell, M. V., A. E. Cowper, M. P. Lefranc, J. I. Bell, and G. R. Screaton. Influence of intron length on alternative splicing of CD44. Mol. Cell. Biol. 18: 5930-5941, 1998[Abstract/Free Full Text].

4.   Berget, S. M. Exon recognition in vertebrate splicing. J. Biol. Chem. 270: 2411-2414, 1995[Free Full Text].

5.   Black, D. L. Finding splice sites within a wilderness of RNA. RNA 1: 763-771, 1995[Web of Science][Medline].

6.   Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254, 1976[Web of Science][Medline].

7.   Chamley-Campbell, J., G. R. Campbell, and R. Ross. The smooth muscle cell in culture. Physiol. Rev. 59: 1-61, 1979[Free Full Text].

8.   Chen, Y. H., M. X. Chen, D. R. Alessi, D. G. Campbell, C. Shanahan, P. Cohen, and P. T. Cohen. Molecular cloning of cDNA encoding the 110 kDa and 21 kDa regulatory subunits of smooth muscle protein phosphatase 1M. FEBS Lett. 356: 51-55, 1994[Web of Science][Medline].

9.   Cote, G. J., E. S. Huang, W. Jin, and R. S. Morrison. Sequence requirements for regulated RNA splicing of the human fibroblast growth factor receptor-1 alpha  exon. J. Biol. Chem. 272: 1054-1060, 1997[Abstract/Free Full Text].

10.   Dirksen, W. P., R. K. Hampson, Q. Sun, and F. M. Rottman. A purine-rich exon sequence enhances alternative splicing of bovine growth hormone pre-mRNA. J. Biol. Chem. 269: 6431-6436, 1994[Abstract/Free Full Text].

11.   DiSanto, M. E., R. H. Cox, Z. Wang, and S. Chacko. NH2-terminal-inserted myosin II heavy chain is expressed in smooth muscle of small muscular arteries. Am. J. Physiol. Cell Physiol. 272: C1532-C1542, 1997[Abstract/Free Full Text].

12.   Fisher, S. A., and M. Ikebe. Developmental and tissue distribution of expression of nonmuscle and smooth muscle isoforms of myosin light chain kinase. Biochem. Biophys. Res. Commun. 217: 696-703, 1995[Web of Science][Medline].

13.   Fisher, S. A., M. Ikebe, and F. Brozovich. Endothelin-1 alters the contractile phenotype of cultured embryonic smooth muscle cells. Circ. Res. 80: 885-893, 1997[Abstract/Free Full Text].

14.   Fu, X.-D. The superfamily of arginine/serine-rich splicing factors. RNA 1: 663-680, 1995[Web of Science][Medline].

15.   Fujioka, M., N. Takahashi, H. Odai, S. Araki, K. Ichikawa, J. Feng, M. Nakamura, K. Kaibuchi, D. J. Hartshorne, T. Nakano, and M. Ito. A new isoform of human myosin phosphatase targeting/regulatory subunit (MYPT2): cDNA cloning, tissue expression, and chromosomal mapping. Genomics 49: 59-68, 1998[Web of Science][Medline].

16.   Gallagher, P. J., B. P. Herring, S. A. Griffin, and J. T. Stull. Molecular characterization of a mammalian smooth muscle myosin light chain kinase. J. Biol. Chem. 266: 23936-23944, 1991[Abstract/Free Full Text].

17.   Goldman, Y. E., M. G. Hibberd, and D. R. Trentham. Relaxation of rabbit psoas muscle fibres from rigor by photochemical generation of adenosine-5'-triphosphate. J. Physiol. (Lond.) 354: 577-604, 1984[Abstract/Free Full Text].

18.   Green, M. R. Biochemical mechanisms of constitutive and regulated pre-mRNA splicing. Annu. Rev. Cell Biol. 7: 559-599, 1991[Web of Science].

19.   Hartshorne, D. J. Biochemistry of the contractile process in smooth muscle. In: Physiology of the Gastrointestinal Tract, edited by L. R. Johnson. New York: Raven, 1987, p. 423-482.

20.   Hartshorne, D. J., M. Ito, and F. Erdodi. Myosin light chain phosphatase: subunit composition, interactions and regulation. J. Muscle Res. Cell Motil. 19: 325-341, 1998[Web of Science][Medline].

21.   Hasegawa, Y., and F. Morita. Role of 17-kDa essential light chain isoforms of aorta smooth muscle myosin. J. Biochem. (Tokyo) 111: 804-809, 1992[Abstract/Free Full Text].

22.   Haystead, C. M., P. Gailly, A. P. Somlyo, A. V. Somlyo, and T. A. Haystead. Molecular cloning and functional expression of a recombinant 72.5 kDa fragment of the 110 kDa regulatory subunit of smooth muscle protein phosphatase 1M. FEBS Lett. 377: 123-127, 1995[Web of Science][Medline].

23.   Helper, D. J., J. A. Lash, and D. R. Hathaway. Distribution of isoelectric variants of the 17,000-dalton myosin light chain in mammalian smooth muscle. J. Biol. Chem. 263: 15748-15753, 1988[Abstract/Free Full Text]. [Corrigenda. J. Biol. Chem. 264: February 1989, p. 2391.]

24.   Hirano, K., B. C. Phan, and D. J. Hartshorne. Interactions of the subunits of smooth muscle myosin phosphatase. J. Biol. Chem. 272: 3683-3688, 1997[Abstract/Free Full Text].

25.   Ichikawa, K., M. Ito, and D. J. Hartshorne. Phosphorylation of the large subunit of myosin phosphatase and inhibition of phosphatase activity. J. Biol. Chem. 271: 4733-4740, 1996[Abstract/Free Full Text].

26.   Ingebritsen, T. S., and P. Cohen. The protein phosphatases involved in cellular regulation. I. Classification and substrate specificities. Eur. J. Biochem. 132: 255-261, 1983[Web of Science][Medline].

27.   Jiao, H., K. Berrada, W. Yang, M. Tabrizi, L. C. Platanias, and T. Yi. Direct association with and dephosphorylation of Jak2 kinase by the SH2-domain-containing protein tyrosine phosphatase SHP-1. Mol. Cell. Biol. 16: 6985-6992, 1996[Abstract].

28.   Johnson, D., P. Cohen, M. X. Chen, Y. H. Chen, and P. T. Cohen. Identification of the regions on the M110 subunit of protein phosphatase 1M that interact with the M21 subunit and with myosin. Eur. J. Biochem. 244: 931-939, 1997[Web of Science][Medline].

29.   Kamm, K. E., and J. T. Stull. The function of myosin and myosin light chain kinase phosphorylation in smooth muscle. Annu. Rev. Pharmacol. Toxicol. 25: 593-620, 1985[Web of Science][Medline].

30.   Kashiwada, K., W. Nishida, K. Hayashi, K. Ozawa, Y. Yamanaka, H. Saga, T. Yamashita, M. Tohyama, S. Shimada, K. Sato, and K. Sobue. Coordinate expression of alpha -tropomyosin and caldesmon isoforms in association with phenotypic modulation of smooth muscle cells. J. Biol. Chem. 272: 15396-15404, 1997[Abstract/Free Full Text].

31.   Kelley, C. A., M. Takahashi, J. H. Yu, and R. S. Adelstein. An insert of seven amino acids confers functional differences between smooth muscle myosins from the intestines and vasculature. J. Biol. Chem. 268: 12848-12854, 1993[Abstract/Free Full Text].

32.   Kimura, K., M. Ito, M. Amano, K. Chihara, Y. Fukata, M. Nakafuku, B. Yamamori, J. Feng, T. Nakano, K. Okawa, A. Iwamatsu, and K. Kaibuchi. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273: 245-248, 1996[Abstract].

33.   Lenz, S., P. Lohse, U. Seidel, and H. H. Arnold. The alkali light chains of human smooth and nonmuscle myosins are encoded by a single gene. Tissue-specific expression by alternative splicing pathways. J. Biol. Chem. 264: 9009-9015, 1989[Abstract/Free Full Text].

34.   Malmqvist, U., and A. Arner. Correlation between isoform composition of the 17 kDa myosin light chain and maximal shortening velocity in smooth muscle. Pflügers Arch. 418: 523-530, 1991[Web of Science][Medline].

35.   Matthew, J. D., A. S. Khromov, K. M. Trybus, A. P. Somlyo, and A. V. Somlyo. Myosin essential light chain isoforms modulate the velocity of shortening propelled by nonphosphorylated cross-bridges. J. Biol. Chem. 273: 31289-31296, 1998[Abstract/Free Full Text].

36.   Meer, D. P., and T. J. Eddinger. Heterogeneity of smooth muscle myosin heavy chain expression at the single cell level. Am. J. Physiol. Cell Physiol. 270: C1819-C1824, 1996[Abstract/Free Full Text].

37.   Miano, J. M., P. Cserjesi, K. L. Ligon, M. Periasamy, and E. N. Olson. Smooth muscle myosin heavy chain exclusively marks the smooth muscle lineage during mouse embryogenesis. Circ. Res. 75: 803-812, 1994[Abstract/Free Full Text].

38.   Nabeshima, Y., Y. Nabeshima, Y. Nonomura, and Y. Fujii-Kuriyama. Nonmuscle and smooth muscle myosin light chain mRNAs are generated from a single gene by the tissue-specific alternative RNA splicing. J. Biol. Chem. 262: 10608-10612, 1987[Abstract/Free Full Text].

39.   Noda, M., C. Yasuda-Fukazawa, K. Moriishi, T. Kato, T. Okuda, K. Kurokawa, and Y. Takuwa. Involvement of rho in GTP gamma  S-induced enhancement of phosphorylation of 20 kDa myosin light chain in vascular smooth muscle cells: inhibition of phosphatase activity. FEBS Lett. 367: 246-250, 1995[Web of Science][Medline].

40.   Okubo, S., M. Ito, Y. Takashiba, K. Ichikawa, M. Miyahara, H. Shimizu, T. Konishi, H. Shima, M. Nagao, D. J. Hartshorne, and T. Nakano. A regulatory subunit of smooth muscle myosin bound phosphatase. Biochem. Biophys. Res. Commun. 200: 429-434, 1994[Web of Science][Medline].

41.   Schiaffino, S., and C. Reggiani. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiol. Rev. 76: 371-423, 1996[Abstract/Free Full Text].

42.   Shapiro, M. B., and P. Senapathy. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 15: 7155-7174, 1987[Abstract/Free Full Text].

43.   Shimizu, H., M. Ito, M. Miyahara, K. Ichikawa, S. Okubo, T. Konishi, M. Naka, T. Tanaka, K. Hirano, D. J. Hartshorne, and T. Nakano. Characterization of the myosin-binding subunit of smooth muscle myosin phosphatase. J. Biol. Chem. 269: 30407-30411, 1994[Abstract/Free Full Text].

44.   Shirazi, A., K. Iizuka, P. Fadden, C. Mosse, A. P. Somlyo, A. V. Somlyo, and T. A. Haystead. Purification and characterization of the mammalian myosin light chain phosphatase holoenzyme. The differential effects of the holoenzyme and its subunits on smooth muscle. J. Biol. Chem. 269: 31598-31606, 1994[Abstract/Free Full Text].

45.   Shoemaker, M. O., W. Lau, R. L. Shattuck, A. P. Kwiatkowski, P. E. Matrisian, L. Guerra-Santos, E. Wilson, T. J. Lukas, L. J. Van Eldik, and D. M. Watterson. Use of DNA sequence and mutant analyses and antisense oligodeoxynucleotides to examine the molecular basis of nonmuscle myosin light chain kinase autoinhibition, calmodulin recognition, and activity. J. Cell Biol. 111: 1107-1125, 1990[Abstract/Free Full Text].

46.   Smith, J. P., and R. J. Barsotti. A computer-based servo system for controlling isotonic contractions of muscle. Am. J. Physiol. Cell Physiol. 265: C1424-C1432, 1993[Abstract/Free Full Text].

47.   Somlyo, A. P., and A. V. Somlyo. Signal transduction and regulation in smooth muscle. Nature 372: 231-236, 1994[Medline]. [Corrigenda. Nature 372: December 1994, p. 812.]

48.   Takahashi, N., M. Ito, J. Tanaka, T. Nakano, K. Kaibuchi, H. Odai, and K. Takemura. Localization of the gene coding for myosin phosphatase, target subunit 1 (MYPT1) to human chromosome 12q15-q21. Genomics 44: 150-152, 1997[Web of Science][Medline].

49.   Totsukawa, G., Y. Yamakita, S. Yamashiro, H. Hosoya, D. J. Hartshorne, and F. Matsumura. Activation of myosin phosphatase targeting subunit by mitosis-specific phosphorylation. J. Cell Biol. 144: 735-744, 1999[Abstract/Free Full Text].

50.   Valcárcel, J., and M. R. Green. The SR protein family: pleiotropic functions in pre-mRNA splicing. Trends Biochem. Sci. 21: 296-301, 1996[Web of Science][Medline].

51.   White, S., A. F. Martin, and M. Periasamy. Identification of a novel smooth muscle myosin heavy chain cDNA: isoform diversity in the S1 head region. Am. J. Physiol. Cell Physiol. 264: C1252-C1258, 1993[Abstract/Free Full Text].


Am J Physiol Cell Physiol 278(3):C589-C600
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Khromov, N. Choudhury, A. S. Stevenson, A. V. Somlyo, and M. Eto
Phosphorylation-dependent Autoinhibition of Myosin Light Chain Phosphatase Accounts for Ca2+ Sensitization Force of Smooth Muscle Contraction
J. Biol. Chem., August 7, 2009; 284(32): 21569 - 21579.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Shukla and S. A. Fisher
Tra2{beta} As a Novel Mediator of Vascular Smooth Muscle Diversification
Circ. Res., August 29, 2008; 103(5): 485 - 492.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Csortos, I. Kolosova, and A. D. Verin
Regulation of vascular endothelial cell barrier function and cytoskeleton structure by protein phosphatases of the PPP family
Am J Physiol Lung Cell Mol Physiol, October 1, 2007; 293(4): L843 - L854.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Zhang and S. A. Fisher
Conditioning Effect of Blood Flow on Resistance Artery Smooth Muscle Myosin Phosphatase
Circ. Res., March 16, 2007; 100(5): 730 - 737.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. G. Smith, A. Dreshaj, S. Chaudhuri, B. M. Onder, M. J. Mhanna, and R. J. Martin
Hyperoxic conditions inhibit airway smooth muscle myosin phosphatase in rat pups
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L68 - L73.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
A. M. Given, O. Ogut, and F. V. Brozovich
MYPT1 mutants demonstrate the importance of aa 888-928 for the interaction with PKGI{alpha}
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C432 - C439.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Belik, E. Kerc, and M. D. Pato
Rat pulmonary arterial smooth muscle myosin light chain kinase and phosphatase activities decrease with age
Am J Physiol Lung Cell Mol Physiol, March 1, 2006; 290(3): L509 - L516.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
S. SHUKLA, F. DEL GATTO-KONCZAK, R. BREATHNACH, and S. A. FISHER
Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1
RNA, November 1, 2005; 11(11): 1725 - 1736.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. C. Payne, H.-Y. Zhang, Y. Shirasawa, Y. Koga, M. Ikebe, J. N. Benoit, and S. A. Fisher
Dynamic changes in expression of myosin phosphatase in a model of portal hypertension
Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1801 - H1810.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
H. CEULEMANS and M. BOLLEN
Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button
Physiol Rev, January 1, 2004; 84(1): 1 - 39.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. P. SOMLYO and A. V. SOMLYO
Ca2+ Sensitivity of Smooth Muscle and Nonmuscle Myosin II: Modulated by G Proteins, Kinases, and Myosin Phosphatase
Physiol Rev, October 1, 2003; 83(4): 1325 - 1358.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
N. Takizawa, D. J. Schmidt, K. Mabuchi, E. Villa-Moruzzi, R. A. Tuft, and M. Ikebe
M20, the small subunit of PP1M, binds to microtubules
Am J Physiol Cell Physiol, February 1, 2003; 284(2): C250 - C262.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Khatri, K. M. Joyce, F. V. Brozovich, and S. A. Fisher
Role of Myosin Phosphatase Isoforms in cGMP-mediated Smooth Muscle Relaxation
J. Biol. Chem., September 28, 2001; 276(40): 37250 - 37257.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. T. Richards, O. Ogut, and F. V. Brozovich
Agonist-induced Force Enhancement. THE ROLE OF ISOFORMS AND PHOSPHORYLATION OF THE MYOSIN-TARGETING SUBUNIT OF MYOSIN LIGHT CHAIN PHOSPHATASE
J. Biol. Chem., February 1, 2002; 277(6): 4422 - 4427.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (31)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dirksen, W. P.
Right arrow Articles by Fisher, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dirksen, W. P.
Right arrow Articles by Fisher, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online