Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 278: C561-C569, 2000;
0363-6143/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naghashpour, M.
Right arrow Articles by Dahl, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naghashpour, M.
Right arrow Articles by Dahl, G.
Vol. 278, Issue 3, C561-C569, March 2000

Sensitivity of myometrium to CGRP varies during mouse estrous cycle and in response to progesterone

M. Naghashpour and G. Dahl

Department of Physiology and Biophysics, University of Miami School of Medicine, Miami, Florida 33136


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Calcitonin gene-related peptide (CGRP) inhibits contractions of the myometrium. Isometric force measurements on myometrial strips were carried out to monitor the inhibitory capacity of CGRP in the myometrium during the estrous cycle and in response to estrogen and progesterone in ovariectomized mice. CGRP inhibition of KCl-induced contractions was lowest at estrus and significantly increased during metestrus and diestrus. Progesterone treatment of ovariectomized mice resulted in a significant increase in the responsiveness of the myometrium to CGRP. Expression of CGRP-receptor component protein (CGRP-RCP), a marker of CGRP-receptor expression, was quantitated by Western and Northern blot analyses. The levels of inhibition exerted by CGRP during the various stages of the estrous cycle and in response to steroid hormone treatment correlated with the protein levels of CGRP-RCP. The mRNA levels did not change significantly during the estrous cycle or in response to hormone treatment, indicating that the regulation of CGRP-RCP protein does not occur at the transcriptional level. CGRP had an inhibitory effect both when applied before the stimulus for contraction and when applied during a sustained contracture induced by KCl. This suggests that CGRP-induced generation of second messengers can influence late events in electro-/chemomechanical coupling and/or the contractile machinery directly.

calcitonin gene-related peptide-receptor component protein; receptor activity modifying protein; potassium contracture; smooth muscle


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE SMOOTH MUSCLE LAYER of the uterus, the myometrium, is a marvel of functional adaptation working at extreme opposite ends of the activity spectrum. During pregnancy the myometrium is essentially quiescent, and only weak, asynchronous contractions provide a moderate tonus of the uterine wall. During parturition and postpartum the myometrium generates strong, well-synchronized contractions for expulsion of the fetus and for prevention of postpartum bleeding (42, 51). A similar but less-pronounced change occurs during the estrous and menstrual cycles (26, 38). In the nonpregnant state, the myometrial activity is highest during estrus or the time of ovulation. Activity at this time facilitates sperm entry and migration in the uterus.

The drastic augmentation in myometrial contractility at the time of parturition is brought about by the upregulation of a series of stimulatory factors. In most cases the upregulation occurs at the transcriptional level and is induced by estrogen (6, 27, 36, 55). A potassium channel presumably involved in pacing of spontaneous contractions is upregulated at term (6). Both the release of oxytocin in the uterus (29, 37) as well as the density of myometrial oxytocin receptors are increased at parturition (16, 24, 41, 50). alpha -Adrenergic receptors increase in density at term (14, 31, 36). The activity of myometrial cells becomes synchronized at parturition by the acquisition of gap junction channels (12, 13, 17-19, 30, 33, 55). The low abundance or absence of these factors during pregnancy allows the uterus to remain quiescent while their appearance at term permits the uterus to contract vigorously during the birthing process.

Inadvertent activation of any of these factors could result in premature labor. It appears that this is counteracted by a series of inhibitory factors, including calcitonin gene-related peptide (CGRP). Several of the inhibitory factors have also been reported to be regulated in abundance (4, 39, 40, 45, 49, 53). A reciprocal regulation is observed for the stimulatory and inhibitory factors. Thus uterine quiescence during gestation is warranted by the dominance of inhibitory factors. In preparation for birth, the inhibitory factors wane and the stimulatory factors allow the uterus to contract forcefully (4, 6, 13, 18, 24, 29, 36, 39, 40).

Several potential inhibitory factors of myometrial activity have been identified: CGRP (46), relaxin (7), nitric oxide (NO) (8, 11, 40, 49, 53), and carbon monoxide (CO) (1). Some of these inhibitory factors may be part of one signaling pathway. For example, NO has been suggested to mediate CGRP activity (48). Alternatively, they may represent independent pathways. CO generated by heme oxygenase (HO) has only recently been proposed as an inhibitory factor of myometrial activity and is thought to act via cGMP (1). Relaxin has been reported to relax uterine smooth muscle by activation of a calcium-activated potassium channel by a protein kinase A-mediated mechanism (35).

The receptor for CGRP has been elusive. The reason for its resistance to discovery is slowly emerging. It appears that the CGRP receptor belongs to a novel class of receptors in which ligand specificity is not inherent to the standard seven-transmembrane receptor linked to G proteins. Instead, receptor specificity appears to be conveyed onto a standard receptor molecule by a small accessory protein. The first example is CGRP-receptor component protein (CGRP-RCP), a 148-amino acid-containing protein that confers CGRP responsiveness to oocytes expressing this protein exogenously (32). Recently, with the use of the same expression cloning strategy that yielded CGRP-RCP, two more small proteins (RAMP 1 and 2) were identified, which, on interacting with the same seven-transmembrane protein, yield an adrenomedullin receptor or a CGRP receptor (34). During pregnancy the expression levels of CGRP-RCP correlate with the inhibitory activity of CGRP in the myometrium (39), suggesting that CGRP-RCP can be used as a marker for the CGRP receptor.

Most of the changes occurring in the stimulatory factors during gestation and parturition have also been observed at estrus or in response to estrogen (3, 5, 6, 15, 27, 28). Therefore, we investigated in the present study whether the inhibitory effect of CGRP on myometrial contractions also changes during the estrous cycle. In addition, we tested the effect of steroid hormones on CGRP responsiveness of the myometrium. Furthermore, we measured the expression of CGRP-RCP. We also investigated signaling pathways involved in CGRP-mediated relaxation.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Isometric force measurements of the myometrial strips. Adult female CD1 mice were obtained from Charles River Laboratories (Wilmington, MA). The stage of the estrous cycle was determined by daily monitoring of mice by vaginal smears. Strips of myometrium (0.05-0.07 mm in diameter) were dissected from the longitudinal muscle layer of the uterus of cycling mice at proestrus, estrus, metestrus, and diestrus and were placed in Krebs-bicarbonate solution (in mM: 119 NaCl, 25 NaHCO3, 1.2 MgSO4 3.6 KCl, 1.2 KH2PO4, 2.5 CaCl2, and 11 glucose, pH 7.4). Myometrial strips were mounted between forceps in a 0.5-ml perfusion chamber. Changes in isometric tension were measured by a force-displacement transducer (Grass FT03E) and recorded on a Gould model TA240 recorder. The mounted strips were perfused continuously with gassed (95% O2-5% CO2) Krebs-bicarbonate solution and equilibrated for 30 min before the experiment was started. All measurements were performed at 20°C.

For determination of the inhibitory effect of CGRP, the muscle strips were first stimulated to contract with a 10-s pulse of high-potassium Krebs solution (25 mM KCl replacing NaCl). The muscle was then perfused with 10-7 M CGRP and subsequently stimulated repeatedly with 10-s pulses of high-potassium solution.

Hormone administration of ovariectomized animals. Mature female ovariectomized mice (Charles River) were injected intramuscularly with estrogen (20 µg), progesterone (2 mg), or estrogen plus progesterone. Control ovariectomized animals received oil injection. After 24 h, the mice were killed and their uteri excised and used for extracting mRNA and protein as described. Northern and Western blot analyses were carried out to study the effects of hormone treatment on CGRP-RCP mRNA and protein expression. Additionally, isometric force measurements using myometrial strips from hormone-treated ovariectomized animals were carried out to investigate the effects of hormonal treatment on the CGRP responsiveness of the myometrium.

RNA and protein extraction. Uteri from animals at various stages of the estrous cycle were excised and the endometrium removed by scraping. Muscle strips were dissected for force measurements, and the remaining myometrium from individual uteri were placed in Tri Reagent (Molecular Research Center) for both protein and RNA extraction. Control and progesterone-treated ovariectomized mice required pooling of three to four uteri. Tissue samples were homogenized in Tri Reagent (100 mg tissue/1 ml Tri Reagent) using a Polytron homogenizer. Total RNA and protein was isolated according to the manufacturer's instructions (Molecular Research Center).

Poly(A)+ RNA was selected from the total RNA using Poly A Tract mRNA isolation system IV (Promega).

Protein samples were resuspended in 0.1% SDS plus proteinase inhibitors (50 mg/ml lima bean trypsin inhibitor, 2 mg/ml leupeptin, 16 mg/ml benzamidine, 2 mg/ml Pepstatin A), and the protein content was determined using a Pierce Micro-BCA kit (Pierce, Rockford, IL). Both gels and blots were Coomassie stained for visual inspection of protein bands.

Northern blot analysis. Four micrograms of uterine poly(A)+ RNA extracted from cycling mice (proestrus, estrus, metestrus, and diestrus) were analyzed by electrophoresis on a denaturing 1.3% agarose-6% formaldehyde gel, transferred, and ultraviolet cross-linked onto Nytran nylon membranes (Schleicher & Schuell, Keene, NH). Membranes were hybridized for 16 h with a 148-bp, 32P-labeled mouse CGRP-RCP probe and washed as described (39). Membranes were exposed to Kodak Biomax film (Eastman Kodak, Rochester, NY) with an intensifying screen at -80°C. Membranes were subsequently stripped of probe and reprobed with a 32P-labeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe for normalization purposes. The hybridization signals were quantified by scanning densitometry, using the Imagequant program (Molecular Dynamics).

Probes for CGRP-RCP mRNA were synthesized by carrying out PCR on mouse CGRP-RCP cDNA using primers TCATTGCTGTGAGGAATTCTTGGA and GAGCAGCGGAAGGAGAGTGGGAAGAAC, in the presence of [32P]alpha dCTP (3,000 Ci/mmol, New England Nuclear), with the use of PCR radioactive labeling system (GIBCO BRL). A cDNA probe for RAMP 1 was prepared similarly with the primers CTGCCGGGAGCCTGACTATGG and CGATGGTGGACAGCGATGAAG. A PCR-generated radioactive probe consisting of a 900-bp fragment of GAPDH cDNA was used for normalization.

Western blot analysis. Protein samples containing 40 µg of protein were resolved by 15% SDS-PAGE at a constant voltage of 140 V and electrotransferred at room temperature at a constant voltage of 15 V overnight to Immobilon-P membranes (Millipore). The transfer buffer contained 25 mM Tris (pH 8.3), 192 mM glycine, and 20% methanol. Following Millipore's rapid immunoblotting protocol, membranes were dried before incubation with primary antibody. Blots were next incubated for 2 h with 1:500 dilution of CGRP-RCP antibody R82, which was raised against the peptide sequence TDLKDQRPRESGKMRHSAG. The blots were washed twice (a minimum of 10 s each) in 0.01 M Tris-buffered saline plus 0.05% Tween (TBS-T) and incubated with a 1:10,000 dilution of anti-rabbit antibody conjugated to horse radish peroxidase (Amersham) for 30 min and washed twice with TBS-T (10 s each). The amount of CGRP-RCP in the membrane preparations was detected by chemiluminescence using SuperSignal Western blotting detection system (Pierce).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Inhibition of myometrial contractions by CGRP. Previous studies of the CGRP effect on myometrial contraction were restricted to observation of inhibition of spontaneous activity or of contractions initiated by stimulatory agonists like ACh. With that approach it is not possible to discriminate between potential targets of CGRP, i.e., whether CGRP inhibits the contractile machinery itself or acts on signaling events. We addressed this issue by using timed applications of a test stimulus in relation to CGRP. As stimulus, we chose elevated potassium concentrations, because exposure of the strips to ACh could not be assumed to result in constant responses, because the ACh receptors may or may not be a variable during the estrous cycle.

Figure 1 shows the effect of CGRP on potassium-evoked contractions of myometrial muscle strips isolated from a mouse uterus at metestrus. In Fig. 1A, the muscle was stimulated with short pulses of potassium every minute before, during, and after a 12-min lasting exposure to CGRP. The inhibitory effect of CGRP set in slowly and reached a plateau within 4-5 min. After removal of CGRP it took several minutes for the contraction amplitudes to recover to the same level as before CGRP application.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Time course of calcitonin gene-related peptide (CGRP) effect on myometrial contractions. A: myometrial strips were induced to contract by application of a 10-s KCl (25 mM) pulse (first contraction). After a short delay, the strip was preincubated with CGRP for 1 min and then induced to contract with 10-s KCl pulses every 2 min, as indicated by arrows. Maximal inhibitory effect of CGRP occurred 3 min after application of CGRP and lasted long after the peptide was washed out. Magnitude of the force of contraction recovered slowly over time. B: effect of CGRP on myometrial contractions induced by 25 or 100 mM KCl. Muscle strips were stimulated to contract with the different KCl concentrations before and after a 1-min incubation with CGRP as indicated.

Contrary to earlier reports (10, 43), potassium-induced contractions of myometrial muscle strips were inhibited by CGRP even at potassium concentrations as high as 100 mM (Fig. 1B). Considering that the inhibitory effect of CGRP requires >1 min to be maximal, it is possible for the effect to be missed on this basis. Short pulses of CGRP are as effective in inhibiting myometrial contractions as the continued presence of the peptide. Figure 2 shows that after a brief pulse of CGRP the amplitudes of potassium-induced contractions first diminish and then slowly recover to prepeptide levels with a time course similar to the one shown in Fig. 1. The observation that the inhibitory effect of CGRP outlasts its presence by many minutes indicates that the signaling pathway initiated by binding of the peptide to its receptor is slow (>1 min) and long lasting (>10 min). CGRP not only can prevent generation of full amplitude contractions but can also relax myometrial muscle that is already in the contracted state. Figure 3 shows a series of contractures induced by prolonged application of KCl. CGRP was applied at various time intervals in the continued presence of KCl. CGRP application relaxed the muscle with a time course similar to that observed in Figs. 1 and 2.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 2.   Inhibition of myometrial contractions by a short pulse of CGRP. After a test contraction induced by a 10-s 25 mM KCl pulse, the muscle strip was superfused with 10-7 M CGRP for 1 min. Subsequently, the muscle was stimulated to contract with 10-s KCl pulses every 2 min.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   Inhibition of KCl-induced contractures by CGRP. Myometrial strips were incubated with 25 mM KCl, and CGRP was applied in the presence of KCl at various elapsed intervals after the onset of the contracture as indicated by arrows. At all time points, CGRP initiated relaxation of the contracted muscle, within a short (30-s) delay after its application.

Effect of estrous cycle. The response of myometrial muscle strips isolated from late pregnant mice (before parturition) to CGRP is fairly constant (39). In contrast, we noticed considerable variability in myometria of nonpregnant mice. We therefore investigated whether the CGRP effect is estrous cycle dependent. Uterine muscle strips were obtained from mice staged by vaginal smears for status in the estrous cycle. For measuring the inhibitory effect of CGRP on myometrial contractility, the paradigm shown in Fig. 2 was followed. After a test contraction induced by 25 mM KCl, 0.1 mM CGRP was applied for 1 min, followed by a series of 10-s incubations with KCl (Fig. 4). The magnitude of the KCl-induced contractions did not vary with the estrous cycle.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   A: records of KCl-induced contractions of muscle strips isolated from mouse myometrium (longitudinal layer) at various stages of the estrous cycle. In all records, regimen described in Fig. 2 was applied. Muscle strips were first induced to contract by application of a 10-s KCl (25 mM) pulse (1st contraction) or by 25 mM KCl and 0.1 µM CGRP after a 1-min preincubation with 0.1 µM CGRP (2nd contraction). After washout, subsequent contractions were induced by application of KCl only. Responsiveness of myometrium to CGRP was lowest during estrus, as indicated by diminished inhibitory capacity of CGRP on KCl-induced contractions. For quantitative analysis, contractions with minimal amplitude (asterisks) were evaluated. B: quantitative analysis of CGRP inhibition of KCl-evoked contractions of myometrial strips obtained from mice at various stages of the estrous cycle. Bars represent percent inhibition (maximal, labeled with asterisk in A) produced by preincubation with 0.1 µM CGRP. Means ± SE are plotted; n is indicated above bars as number of muscle strips/number of mice analyzed.

The level of inhibition of KCl-induced contractions by CGRP varied during the estrous cycle. For quantitative analysis, the smallest contraction in each series (indicated by an asterisk in Fig. 4A) was used to calculate percentage of inhibition compared with the test contraction (Figs. 4B and 5B). CGRP inhibited KCl-induced contractions of myometrial strips from mice at metestrus by >70%. In contrast, during estrus the inhibitory effect of CGRP was lowest (<30%).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   Correlation of CGRP-receptor component protein (CGRP-RCP) protein expression in the uterus during the estrous cycle with the inhibitory capacity of CGRP on KCl-evoked myometrial contractions. A: Western blot analysis of mouse uterine tissue with CGRP-RCP antibody R82. Protein extracts (40 µg/lane) from uteri of mice at metestrus, diestrus, proestrus, and estrus (lanes 1-4) were separated by 15% SDS-PAGE, transferred to Immobilon-P membrane, and immunoblotted with CGRP-RCP antibody. Two immunoreactive bands are prominent at 20 and 28 kDa. Bottom band comigrates with in vitro translation product of CGRP-RCP mRNA. Top band is either a splice variant or a secondary modification product of CGRP-RCP (39). Intensities of both protein bands vary in parallel during the estrus cycle and are lowest at estrus. B: inhibition of myometrial contractions as a function of expression levels of CGRP-RCP. Symbols refer to experimental conditions specified below Western blot in A. Quantitative analysis of CGRP-RCP protein level was done by densitometric scanning of 20-kDa immunoreactive band from 6 independent Western blots. Values were normalized to signal intensity obtained from uterus at estrus. These values (means ± SE ) are plotted against values of inhibition of myometrial contractions shown in Fig. 4B. Aliquots of same uteri were used for Western blots and force measurements.

Dose-response curves of CGRP-mediated inhibition of myometrial contractile activity at estrus and metestrus have similar EC50 values but have different maximal levels (Fig. 6).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   Dose-response curves of CGRP-mediated inhibition of myometrial contractions at estrus () and metestrus (). Each point represents mean ± SE from 4 measurements.

CGRP-RCP expression varies during the estrous cycle. We have previously shown that the responsiveness of myometrium to CGRP varies at different gestational stages in correlation with the expression of CGRP-RCP protein levels (39).

The expression of CGRP-RCP protein in the uterus during the estrous cycle was determined by Western blot analysis of uterine protein extracts from myometria of mice at proestrus, estrus, metestrus, and diestrus. Forty micrograms of protein from each stage were subjected to SDS-PAGE and electrotransferred to membranes.

A previously characterized CGRP-RCP antibody, R82, was used for immunodetection of CGRP-RCP protein. CGRP-RCP protein levels were significantly (P < 0.001) lower during estrus compared with metestrus and diestrus (Fig. 5) and correlated with CGRP's capacity to inhibit myometrial contractions.

Northern blot analysis was used to quantify the CGRP-RCP transcript in the mouse uterus and to monitor any variations in mRNA expression during the estrus cycle. Poly(A)+ RNA was extracted from the uteri of animals at proestrus, estrus, metestrus, and diestrus and hybridized with a 32P-labeled CGRP-RCP-specific probe. A prominent band of 1.8 kb was detected by hybridization, equally intense at all stages (Fig. 7). The blot was then stripped and reprobed for GAPDH expression to determine equal loading of mRNA. CGRP-RCP mRNA expression did not change significantly (P > 0.05) during the estrous cycle, as revealed by four independent Northern blot analyses.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 7.   Northern blot analysis of mouse uterine CGRP-RCP mRNA during various stages of the estrous cycle: proestrus, estrus, metestrus, and diestrus (lanes 1-4). A: poly(A)+ RNA (5 µg/lane) was hybridized to a 32P-labeled CGRP-RCP cDNA probe. Positions of 18S and 28S ribosomal RNA are indicated. B: GAPDH mRNA levels served as a loading control . Membranes were stripped after 1st hybridization and rehybridized to a GAPDH cDNA probe. C: quantitative analysis of CGRP-RCP expression. Each column represents mean ± SE from 4 experiments (same uteri as in Fig. 5).

Effect of progesterone. In rodents, ovaries are the only source of estrogen and progesterone supply to the uterus. To determine the effect of hormonal treatment on the CGRP responsiveness of the uterus, isometric force measurements were carried out. Myometrial strips obtained from ovariectomized mice that were injected with either estrogen (20 µg), progesterone (2 mg), or the combination of estrogen plus progesterone were induced to contract with 25 mM KCl (Fig. 8). The responsiveness of the myometrium of progesterone-treated animals to CGRP was significantly greater than the controls (P < 0.001). Preincubation with CGRP inhibited the KCl-induced contractions by >65% for strips obtained from progesterone-treated animals. CGRP inhibition of contractions of myometrial strips obtained from estrogen-treated animals was not significantly different from the ovariectomized controls. Treatment with simultaneous combination of estrogen and progesterone also enhanced the CGRP responsiveness of myometrial strips compared with the controls (P < 0.05; Fig. 9).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 8.   Records of CGRP inhibition of KCl-induced contractions of muscle strips isolated from myometrium (longitudinal layer) of ovariectomized (ovx) mice. Muscle strips were isolated from the uterus of ovariectomized mice injected with 1) sesame oil, 2) 20 µg estradiol, 3) 2 mg progesterone, and 4) a combination of estrogen and progesterone at the same respective concentrations. Quantitative analysis of such records is shown in Fig. 9. In all records, strips were induced to contract (1st contraction) by a 10-s application of 25 mM KCl. Then, after a 1-min incubation with 0.1 µM CGRP, 10-s KCl pulses were reapplied (2nd and subsequent contractions) to obtain a record of maximal CGRP inhibition. Ctrl, control.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 9.   Effect of steroid hormones on CGRP-RCP protein expression in the uterus. Protein was isolated (24 h postinjection) from uteri of ovariectomized mice that were injected with sesame oil (vehicle; ctrl), 20 µg estrogen (E), 2 mg progesterone (P), and a combination of estrogen + progesterone (E+P). A: Western blot analysis using 40 µg of protein from each sample, which was subjected to SDS-PAGE analysis, as described. Protein samples obtained from uteri of ovariectomized animals that received progesterone showed enhanced staining for CGRP-RCP, compared with samples from control or estrogen-treated animals. B: inhibition of myometrial contractions as a function of expression levels of CGRP-RCP in hormone-treated ovariectomized mice. Symbols refer to experimental conditions specified above Western blot in A. CGRP-RCP protein levels were determined by densitometric scanning of bands detected in autoradiographs of 3 independent Western blots. Values are normalized to signal intensity of 20-kDa band of uninjected, ovariectomized controls. Percent inhibition of KCl-induced contractions by CGRP in muscle strips isolated from ovariectomized mice, subjected to hormone treatment, was determined as before. Means ± SE are plotted; n is indicated as number of muscle strips/number of mice analyzed.

Forty micrograms of protein isolated from uteri of the ovariectomized animals that were injected with either oil (ovx ctrl), estrogen (ovx E), progesterone (ovx P), or the combination of estrogen and progesterone (ovx E+P) were subjected to SDS-PAGE. Western blot analysis with R82 antibody reveals that the immunoreactive bands of the uterine protein samples from progesterone-treated animals were significantly (P < 0.01) more intense compared with control animals injected with oil (Fig. 9). This indicates that CGRP-RCP immunoreactive protein expression in the uterus is enhanced as a result of progesterone administration. Estrogen treatment did not significantly alter the expression of CGRP-RCP compared with the controls. With hormone treatment, the highest level of CGRP-RCP was correlated with the highest level of inhibition of contraction (Fig. 9).

The change in protein levels does not appear to be a result of transcriptional regulation, because CGRP-RCP mRNA transcription was not altered as a result of hormonal treatment, as revealed by Northern analysis (4 experiments involving pools of 3-4 animals for each experimental condition; data not shown).

Northern blot analysis of myometrial RAMP mRNA. CGRP-RCP is not the only protein to convey CGRP receptiveness to oocytes. The same function appears to be exerted by RAMP 1 to form a different CGRP receptor. We therefore tested whether RAMP 1 expression also correlated with the inhibitory capacity of CGRP at various stages of the estrus cycle. Figure 10 shows the hybridization product of the size reported for RAMP 1 mRNA, but also shows a larger mRNA species. The intensity of neither hybridization product was found to correlate with the inhibitory action of CGRP during the estrus cycle.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 10.   Northern blot analysis of mouse uterine RAMP mRNA during various stages of the estrous cycle: proestrus, estrus, metestrus, and diestrus (lanes 1-4). A: poly(A)+ RNA (5 µg/lane) was hybridized to a 32P-labeled RAMP cDNA probe. Positions of 18S and 28S ribosomal RNA are indicated. B: GAPDH mRNA levels served as a loading control. C: quantitative analysis of RAMP mRNA expression. Each column represents mean ± SE from 4 experiments. D: data from Fig. 4B redrawn for assessment of correlation between RAMP mRNA concentration and inhibitory capacity of CGRP on myometrial contractions.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The present results show that, during the estrus cycle, the sensitivity of the myometrium to CGRP changes. Inhibition of myometrial contractions by the peptide was most pronounced at metestrus and weakest at estrus. Thus, like during gestation and parturition, the regulation of this inhibitory factor of myometrial contraction is reciprocal to that of the stimulatory factors, which include oxytocin receptors, oxytocin release, and gap junctions. This dual regulation of myometrial activity by changing both inhibitory and stimulatory factors warrants quiescence of the pregnant uterus and vigorous contractions for parturition and during estrus. In the case of CGRP, the withdrawal of CGRP-secreting neurons from the uterus at term and during estrus accentuates this effect (2, 20, 56).

The activity of nonpregnant uterus has been used in the past as a reference point for assessment of changes occurring during pregnancy (10). Without staging the estrus cycle, such practice is obsolete, because the changes during the estrus cycle are of the same magnitude as those occurring during pregnancy and parturition.

The mechanism of inhibition of myometrial contractions by CGRP is not clear. Several signaling pathways have been invoked in the literature, including activation of calcium-activated potassium channels, release of nitric oxide, and generation of cAMP.

Activation of adenylate cyclase and generation of cAMP are well-documented consequences of CGRP binding to its receptor (22, 25, 47). Casey and co-workers (9) have shown that CGRP induces a 90-fold increase in cAMP concentration in myometrium. However, no correlated force measurements were performed. Consistent with the cAMP hypothesis is the finding that CGRP can activate the cAMP sensor cystic fibrosis transmembrane conductance regulator in oocytes expressing myometrial mRNA exogenously (39).

Based on patch-clamp data and the observation of attenuation of the inhibitory effect of CGRP on spontaneous contractions by specific channel blockers, Tritthart and co-workers (52) concluded that CGRP inhibits myometrial contractility by opening calcium-activated potassium channels without activation of adenylate cyclase. A similar mechanism but with involvement of adenylate cyclase appears to be established as an operating mechanism in vascular relaxation (44).

Shew et al. (48) reported that NO synthase (NOS) inhibitors can block the relaxing effect of CGRP but not of isoproterenol on the myometrium. Furthermore, they observed that NADPH-diaphorase, thought to be indicative of NOS, is localized in uterine nerve fibers. Based on these observations, the authors concluded that the inhibitory action of CGRP may be dependent on NO formation. NO mediation of CGRP-induced relaxation of vascular smooth muscle has also been reported (2) but appears to be dependent on the presence of the endothelium (54), which probably is the site of NO release. NO, however, may not be involved in potassium channel activation (44).

When assessing the mechanism of action of CGRP in myometrial inhibition, one has to discriminate between inhibition of initiation of contraction (i.e., the electrical signal) vs. inhibition of contraction itself, a distinction often not made and possibly the cause for some confusion in the literature. For example, opening of potassium channels could be very effective in suppressing pacemaker activity and thereby abolishing spontaneous contractions at their origin. Once electromechanical coupling has occurred, opening of potassium channels would become inconsequential. Thus apparently contradictory results may be due to more than one mechanism of action of CGRP in the myometrium. In the present study we found that CGRP attenuates potassium-induced contractions. This observation is inconsistent with an exclusive mechanism involving opening of potassium channels. Because of the change in equilibrium potential associated with increased extracellular potassium ions, opening of more potassium channels would result in a faster depolarization rather than the hyperpolarization that would ensue at physiological potassium concentration (21). Furthermore, CGRP even relaxes contracted muscle, i.e., acts after electromechanical coupling has taken place. Thus during the contraction cycle multiple mechanisms may be activated by CGRP, which could include calcium sequestration and phosphorylation of myosin light chain kinase (23) in addition to potential effects on potassium channels.

The receptor for CGRP at present is not identified with certainty. Several orphan receptors have been proposed to be CGRP receptors with the typical structural feature of seven transmembrane segments. However, functional expression was limited to few cell lines. Xenopus oocytes become responsive to CGRP when they are coerced to exogenously express either one of two small proteins, CGRP-RCP or RAMP 1 (32, 34). These proteins appear to interact with an autochthonous oocyte protein, converting it to an active CGRP receptor. Probably CGRP-RCP and RAMP form different CGRP receptor types. One of the RAMP types (RAMP 2) forms a different receptor altogether, the adrenomedullin receptor. CGRP-RCP appears to mediate the inhibitory effect in the uterus, since this protein but not RAMP 1 shows correlation with inhibitory capacity of CGRP. This correlation was seen both during the estrous cycle (the present study) as well as during pregnancy and parturition (39). CGRP-RCP can, therefore, be used as a marker for CGRP receptor activity.

No changes in mRNA levels corresponding to the variation in protein levels was observed, suggesting that the regulation of CGRP-RCP protein does not occur at the transcriptional level. Yet, progesterone treatment of ovariectomized mice promotes both an increase in CGRP-RCP protein and the inhibitory effect of CGRP on myometrial contractions. It is conceivable that the stability of CGRP-RCP protein is higher when associated with the receptor core protein, which in turn could be regulated at the transcriptional level. Alternatively, progesterone may directly alter translatability or turnover of CGRP-RCP protein.


    ACKNOWLEDGEMENTS

This work was supported by National Institute of General Medical Sciences Grant GM-48610.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: G. Dahl, Dept. of Physiology & Biophysics (R-430), Univ. of Miami School of Medicine, PO Box 016430, Miami, FL 33101 (E-mail: gdahl{at}miami.edu).

Received 4 May 1999; accepted in final form 8 October 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Acevedo, CH, and A. Ahmed. Hemeoxygenase-1 inhibits human myometrial contractility via carbon monoxide and is upregulated by progesterone during pregnancy. J Clin Invest 101: 949-955, 1998[Web of Science][Medline].

2.   Anouar, A, A Schirar, and G. Germain. Relaxant effect of the calcitonin gene-related peptide (CGRP) on the nonpregnant and pregnant rat uterus. Comparison with vascular tissue. Naunyn Schmiedebergs Arch Pharmacol 357: 446-453, 1998[Web of Science][Medline].

3.   Anuradha, P, and RV. Thampan. Synthesis of gap junction proteins and collagenases in the preimplantation rat uterus. Membr Biochem 10: 163-169, 1993[Web of Science][Medline].

4.   Bansal, RK, PC Goldsmith, Y He, CJ Zaloudek, JL Ecker, and RK. Riemer. A decline in myometrial nitric oxide synthase expression is associated with labor and delivery. J Clin Invest 99: 2502-2508, 1997[Web of Science][Medline].

5.   Boyle, MB, EM Azhderian, NJ MacLusky, F Naftolin, and LK. Kaczmarek. Xenopus oocytes injected with rat uterine RNA express very slowly activating potassium currents. Science 235: 1221-1224, 1987[Abstract/Free Full Text].

6.   Boyle, MB, NJ MacLusky, F Naftolin, and LK. Kaczmarek. Hormonal regulation of K+-channel messenger RNA in rat myometrium during oestrus cycle and in pregnancy. Nature 330: 373-375, 1987[Medline].

7.   Bradshaw, JM, SJ Downing, A Moffatt, JC Hinton, and DG. Porter. Demonstration of some of the physiological properties of rat relaxin. J Reprod Fertil 63: 145-153, 1981[Abstract/Free Full Text].

8.   Buhimschi, I, M Ali, V Jain, K Chwalisz, and RE. Garfield. Differential regulation of nitric oxide in the rat uterus and cervix during pregnancy and labour. Hum Reprod 11: 1755-1766, 1996[Abstract/Free Full Text].

9.   Casey, ML, J Smith, G Alsabrook, and PC. MacDonald. Activation of adenylyl cyclase in human myometrial smooth muscle cells by neuropeptides. J Clin Endocrinol Metab 82: 3087-3092, 1997[Abstract/Free Full Text].

10.   Chan, KK, G Robinson, and FB. Pipkin. Differential sensitivity of human nonpregnant and pregnant myometrium to calcitonin gene-related peptide. J Soc Gynecol Investig 4: 15-21, 1997[Web of Science][Medline].

11.   Chwalisz, K, S Shao-Qing, RE Garfield, and HM. Beier. Cervical ripening in guinea-pigs after a local application of nitric oxide. Hum Reprod 12: 2093-2101, 1997[Abstract/Free Full Text].

12.   Dahl, G, R Azarnia, and R. Werner. Induction of cell-cell channel formation by mRNA. Nature 289: 683-685, 1981[Medline].

13.   Dahl, G, and W. Berger. Nexus formation in the myometrium during parturition and induced by estrogen. Cell Biol Int Rep 2: 381-387, 1978[Web of Science][Medline].

14.   Dahle, LO, RG Andersson, G Berg, M Hurtig, and G. Ryden. alpha -Adrenergic receptors in human myometrium: changes during pregnancy. Gynecol Obstet Invest 36: 75-80, 1993[Web of Science][Medline].

15.   Fuchs, AR, R Ivell, PA Fields, SM Chang, and MJ. Fields. Oxytocin receptors in bovine cervix: distribution and gene expression during the estrous cycle. Biol Reprod 54: 700-708, 1996[Abstract].

16.   Garfield, RE, and S. Beier. Increased myometrial responsiveness to oxytocin during term and preterm labor. Am J Obstet Gynecol 161: 454-461, 1989[Web of Science][Medline].

17.   Garfield, RE, S Rabideau, JR Challis, and EE. Daniel. Ultrastructural basis for maintenance and termination of pregnancy. Am J Obstet Gynecol 133: 308-315, 1979[Web of Science][Medline].

18.   Garfield, RE, S Sims, and EE. Daniel. Gap junctions: their presence and necessity in myometrium during parturition. Science 198: 958-960, 1977[Abstract/Free Full Text].

19.   Garfield, RE, SM Sims, MS Kannan, and EE. Daniel. Possible role of gap junctions in activation of myometrium during parturition. Am J Physiol Cell Physiol 235: C168-C179, 1978[Abstract/Free Full Text].

20.   Haase, EB, J Buchman, AE Tietz, and LP. Schramm. Pregnancy-induced uterine neuronal degeneration in the rat. Cell Tissue Res 288: 293-306, 1997[Web of Science][Medline].

21.   Hille, B. Ionic channels of excitable membranes. Sunderland, MA: Sinauer, 1992.

22.   Ishikawa, T, N Okamura, A Saito, and K. Goto. Effects of calcitonin gene-related peptide (CGRP) and isoproterenol on the contractility and adenylate cyclase activity in the rat heart. J Mol Cell Cardiol 19: 723-727, 1987[Web of Science][Medline].

23.   Kerrick, WG, and PE. Hoar. Inhibition of smooth muscle tension by cyclic AMP-dependent protein kinase. Nature 292: 253-255, 1981[Medline].

24.   Kimura, T, O Tanizawa, K Mori, MJ Brownstein, and H. Okayama. Structure and expression of a human oxytocin receptor. Nature 356: 526-529, 1992[Medline]. [Corrigenda. Nature 357: May 1992, p. 176.]

25.   Kubota, M, JM Moseley, L Butera, GJ Dusting, PS MacDonald, and TJ. Martin. Calcitonin gene-related peptide stimulates cyclic AMP formation in rat aortic smooth muscle cells. Biochem Biophys Res Commun 132: 88-94, 1985[Web of Science][Medline].

26.   Kunz, G, D Beil, H Deininger, L Wildt, and G. Leyendecker. The dynamics of rapid sperm transport through the female genital tract: evidence from vaginal sonography of uterine peristalsis and hysterosalpingoscintigraphy. Hum Reprod 11: 627-632, 1996.

27.   Larcher, A, J Neculcea, C Breton, A Arslan, F Rozen, C Russo, and HH. Zingg. Oxytocin receptor gene expression in the rat uterus during pregnancy and the estrous cycle and in response to gonadal steroid treatment. Endocrinology 136: 5350-5356, 1995[Abstract].

28.   Lefebvre, DL, R Farookhi, A Larcher, J Neculcea, and HH. Zingg. Uterine oxytocin gene expression. I. Induction during pseudopregnancy and the estrous cycle. Endocrinology 134: 2556-2561, 1994[Abstract/Free Full Text].

29.   Lefebvre, DL, A Giaid, H Bennett, R Lariviere, and HH. Zingg. Oxytocin gene expression in rat uterus. Science 256: 1553-1555, 1992[Abstract/Free Full Text].

30.   Lefebvre, DL, M Piersanti, XH Bai, ZQ Chen, and SJ. Lye. Myometrial transcriptional regulation of the gap junction gene, connexin-43. Reprod Fertil Dev 7: 603-611, 1995[Medline].

31.   Legrand, C, JP Maltier, and Y. Benghan-Eyene. Rat myometrial adrenergic receptors in late pregnancy. Biol Reprod 37: 641-650, 1987[Abstract].

32.   Luebke, AE, GP Dahl, BA Roos, and IM. Dickerson. Identification of a protein that confers calcitonin gene-related peptide responsiveness to oocytes by using a cystic fibrosis transmembrane conductance regulator assay. Proc Natl Acad Sci USA 93: 3455-3460, 1996[Abstract/Free Full Text].

33.   Lye, SJ, BJ Nicholson, M Mascarenhas, L MacKenzie, and T. Petrocelli. Increased expression of connexin-43 in the rat myometrium during labor is associated with an increase in the plasma estrogen:progesterone ratio. Endocrinology 132: 2380-2386, 1993[Abstract/Free Full Text].

34.   McLatchie, LM, NJ Fraser, MJ Main, A Wise, J Brown, N Thompson, R Solari, MG Lee, and SM. Foord. RAMPs regulate the transport and ligand specificity of the calcitonin- receptor-like receptor. Nature 393: 333-339, 1998[Medline].

35.   Meera, P, K Anwer, M Monga, C Oberti, E Stefani, L Toro, and BM. Sanborn. Relaxin stimulates myometrial calcium-activated potassium channel activity via protein kinase A. Am J Physiol Cell Physiol 269: C312-C317, 1995[Abstract/Free Full Text].

36.   Mhaouty, S, J Cohen-Tannoudji, R Bouet-Alard, I Limon-Boulez, JP Maltier, and C. Legrand. Characteristics of the alpha 2/beta 2-adrenergic receptor-coupled adenylyl cyclase system in rat myometrium during pregnancy. J Biol Chem 270: 11012-11016, 1995[Abstract/Free Full Text].

37.   Mitchell, BF, X Fang, and S. Wong. Oxytocin: a paracrine hormone in the regulation of parturition? Rev Reprod 3: 113-122, 1998[Abstract].

38.   Moawad, AH, and LP. Bengtsson. In vivo studies of the motility patterns of the nonpregnant human uterus. I. The normal menstrual cycle. Am J Obstet Gynecol 98: 1057-1064, 1967[Web of Science][Medline].

39.   Naghashpour, M, MI Rosenblatt, IM Dickerson, and GP. Dahl. Inhibitory effect of calcitonin gene-related peptide on myometrial contractility is diminished at parturition. Endocrinology 138: 4207-4214, 1997[Abstract/Free Full Text].

40.   Natuzzi, ES, PC Ursell, M Harrison, C Buscher, and RK. Riemer. Nitric oxide synthase activity in the pregnant uterus decreases at parturition. Biochem Biophys Res Commun 194: 1-8, 1993[Web of Science][Medline].

41.   Nissenson, R, G Fluoret, and O. Hechter. Opposing effects of estradiol and progesterone on oxytocin receptors in rabbit uterus. Proc Natl Acad Sci USA 75: 2044-2048, 1978[Abstract/Free Full Text].

42.   Norwitz, ER, JN Robinson, and JR. Challis. The control of labor. N Engl J Med 341: 660-666, 1999[Free Full Text].

43.   Pennefather, JN, NA Reynoldson, and GM. Handberg. Inhibition of rat uterine contractions by rat and human CGRP. Peptides 11: 903-906, 1990[Web of Science][Medline].

44.   Quayle, JM, AD Bonev, JE Brayden, and MT. Nelson. Calcitonin gene-related peptide activated ATP-sensitive K+ currents in rabbit arterial smooth muscle via protein kinase A. J Physiol (Lond) 475: 9-13, 1994[Abstract/Free Full Text].

45.   Riemer, RK, C Buscher, RK Bansal, SM Black, Y He, and ES. Natuzzi. Increased expression of nitric oxide synthase in the myometrium of the pregnant rat uterus. Am J Physiol Endocrinol Metab 272: E1008-E1015, 1997[Abstract/Free Full Text].

46.   Samuelson, UE, CJ Dalsgaard, JM Lundberg, and T. Hokfelt. Calcitonin gene-related peptide inhibits spontaneous contractions in human uterus and fallopian tube. Neurosci Lett 62: 225-230, 1985[Web of Science][Medline].

47.   Seifert, H, P Sawchenko, J Chesnut, J Rivier, W Vale, and SJ. Pandol. Receptor for calcitonin gene-related peptide: binding to exocrine pancreas mediates biological actions. Am J Physiol Gastrointest Liver Physiol 249: G147-G151, 1985.

48.   Shew, RL, RE Papka, DL McNeill, and JA. Yee. NADPH-diaphorase-positive nerves and the role of nitric oxide in CGRP relaxation of uterine contraction. Peptides 14: 637-641, 1993[Web of Science][Medline].

49.   Sladek, SM, AC Regenstein, D Lykins, and JM. Roberts. Nitric oxide synthase activity in pregnant rabbit uterus decreases on the last day of pregnancy. Am J Obstet Gynecol 169: 1285-1291, 1993[Web of Science][Medline].

50.   Soloff, MS, M Alexandrova, and MJ. Fernstrom. Oxytocin receptors: triggers for parturition and lactation? Science 204: 1313-1315, 1979[Abstract/Free Full Text].

51.   Thorburn, GD, and JR. Challis. Endocrine control of parturition. Physiol Rev 59: 863-918, 1979[Free Full Text].

52.   Tritthart, HA, W Mahnert, A Fleischhacker, and N. Adelwohrer. Potassium channels and modulating factors of channel functions in the human myometrium. Z Kardiol 80: 29-33, 1991.

53.   Yallampalli, C, RE Garfield, and M. Byam-Smith. Nitric oxide inhibits uterine contractility during pregnancy but not during delivery. Endocrinology 133: 1899-1902, 1993[Abstract/Free Full Text].

54.   Yoshimoto, R, M Mitsui-Saito, H Ozaki, and H. Karaki. Effects of adrenomedullin and calcitonin gene-related peptide on contractions of the rat aorta and porcine coronary artery. Br J Pharmacol 123: 1645-1654, 1998[Web of Science][Medline].

55.   Yu, W, G Dahl, and R. Werner. The connexin43 gene is responsive to oestrogen. Proc R Soc Lond B Biol Sci 255: 125-132, 1994[Medline].

56.   Zoubina, EV, Q Fan, and PG. Smith. Variations in uterine innervation during the estrous cycle in rat. J Comp Neurol 397: 561-571, 1998[Web of Science][Medline].


Am J Physiol Cell Physiol 278(3):C561-C569
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
D. Roosterman, T. Goerge, S. W. Schneider, N. W. Bunnett, and M. Steinhoff
Neuronal control of skin function: the skin as a neuroimmunoendocrine organ.
Physiol Rev, October 1, 2006; 86(4): 1309 - 1379.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Siaut, C. Zaros, E. Levivier, M.-L. Ferri, M. Court, M. Werner, I. Callebaut, P. Thuriaux, A. Sentenac, and C. Conesa
An Rpb4/Rpb7-Like Complex in Yeast RNA Polymerase III Contains the Orthologue of Mammalian CGRP-RCP
Mol. Cell. Biol., January 1, 2003; 23(1): 195 - 205.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
B. N. Evans, M. I. Rosenblatt, L. O. Mnayer, K. R. Oliver, and I. M. Dickerson
CGRP-RCP, a Novel Protein Required for Signal Transduction at Calcitonin Gene-related Peptide and Adrenomedullin Receptors
J. Biol. Chem., September 29, 2000; 275(40): 31438 - 31443.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Naghashpour, M.
Right arrow Articles by Dahl, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Naghashpour, M.
Right arrow Articles by Dahl, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online