|
|
||||||||
Division of Gastroenterology, Department of Medicine, School of Medicine, Johns Hopkins University, Baltimore, Maryland 21205
| |
ABSTRACT |
|---|
|
|
|---|
We found mRNA for the three isoforms of the cyclic nucleotide-gated nonselective cation channel expressed in the mucosal layer of the rat intestine from the duodenum to the colon and in intestinal epithelial cell lines in culture. Because these channels are permeable to sodium and calcium and are stimulated by cGMP or cAMP, we measured 8-bromo-cGMP-stimulated sodium-mediated short-circuit current (Isc) in proximal and distal colon and unidirectional 45Ca2+ fluxes in proximal colon to determine whether these channels could mediate transepithelial sodium and calcium absorption across the colon. Sodium-mediated Isc, stimulated by 8-bromo-cGMP, were inhibited by dichlorobenzamil and l-cis-diltiazem, blockers of cyclic nucleotide-gated cation channels, suggesting that these ion channels can mediate transepithelial sodium absorption. Sodium-mediated Isc and net transepithelial 45Ca2+ absorption were stimulated by heat-stable toxin from Escherichia coli that increases cGMP. Addition of l-cis-diltiazem inhibited the enhanced transepithelial absorption of both ions. These results suggest that cyclic nucleotide-gated cation channels simultaneously increase net sodium and calcium absorption in the colon of the rat.
sodium absorption; calcium absorption; cation channels
| |
INTRODUCTION |
|---|
|
|
|---|
UNDER CONDITIONS OF SALT restriction or when aldosterone is elevated, sodium-mediated short-circuit current (Isc) across the distal colon is blocked by apical addition of amiloride (20, 31, 32). The channel mediating this sodium transport is the amiloride-sensitive sodium channel (ENaC) (3, 4). In other portions of the intestine, for example, the proximal colon and the ileum, sodium absorption is mediated via the electroneutral sodium-proton exchanger (NHE) (19, 26). ENaC (27) and NHE (15) have been cloned, and the mRNA and protein have been identified in the epithelia of the intestinal mucosa. However, the molecular mechanisms underlying calcium entry and transepithelial calcium absorption are less clear. Although there is evidence for vesicle entry mechanisms (22), calcium entry via ion channels has also been implicated (25, 30). To determine whether cyclic nucleotide-gated (CNG) cation channels might mediate sodium and calcium entry in the intestine, we evaluated the distribution of mRNA for the three isoforms of the cyclic nucleotide-gated cation channel in the intestine and in cultures of intestinal cell lines. We investigated the effect of 8-bromo-cGMP (8-Br-cGMP)-mediated stimulation and transport inhibition by blockers of cyclic nucleotide-gated cation channels on sodium-mediated Isc and 45Ca2+ fluxes in the rat colon, because the secondary subunit that increases calcium permeability (5) is expressed in this segment.
Cyclic nucleotide-gated cation channels are not voltage dependent but are gated directly by micromolar amounts of cyclic nucleotides (cAMP and/or cGMP). These channels are equally selective for sodium and potassium and exhibit a large conductance (25 pS) in monovalent cation solutions and a smaller conductance in the presence of calcium (13, 14, 17, 24). The channels are blocked by l-cis-diltiazem and dichlorobenzamil (23) but are rather insensitive to amiloride (13). With use of RNase protection assay and in situ hybridization (8), the presence of a cyclic nucleotide-gated cation channel was documented in rat lung airway epithelia. In primary cultures of rat tracheal airway epithelial cells, a sodium-mediated 8-Br-cGMP-stimulated Isc was inhibited by l-cis-diltiazem and dichlorobenzamil, suggesting that this channel contributes to transepithelial sodium transport in this epithelium (28). Thus cyclic nucleotide-gated cation channels carry sodium currents in airway cells that are not blocked by amiloride. This suggested that other epithelia such as the kidney (2) and intestine may also possess these channels. This is the first demonstration that cyclic nucleotide-gated cation channel mRNAs are expressed in all segments of the intestine and that these channels mediate apical calcium and sodium entry and transepithelial transport of these ions across the colon of the rat.
| |
METHODS |
|---|
|
|
|---|
Animal Treatments
Male Sprague-Dawley rats (200-250 g; Charles River, Wilmington, MA) were fed a standard rat chow (0.8 g NaCl/kg) or a low-salt (0.02 g NaCl/kg) diet (Laboratory Animal Diet, PMI Feeds, St. Louis, MO) for 2 wk. Evaluation of serum aldosterone and corticosterone levels in control animals showed that the aldosterone level was 14.5 ± 8.5 ng/dl (n = 4). Animals fed the low-salt diet showed an increase in aldosterone to 1,624 ± 251 ng/dl (n = 5). Animals were killed and used for transport studies described below, or intestinal segments, including duodenum, jejunum, ileum, and ascending and descending colon, were isolated and perfused with saline solution, then the mucosal layer of each segment was gently scraped from the underlying muscle layer with a clean glass slide. The mucosal scrapes were placed in TRIzol (GIBCO BRL, Gaithersburg, MD), homogenized (Polytron), and frozen at
80°C until RNA was made.
Isc
Male Sprague-Dawley rats (200 g) were killed with an overdose of pentobarbital sodium, and the colon was isolated in a solution of (in mM) 114 NaCl, 5 KCl, 1.65 NaH2PO4, 1.25 CaCl2, 1.1 MgCl2, 5 HEPES, and 10 glucose (pH 7.4). The proximal or distal colon was quickly stripped of its serosal layer and mounted in Ussing chambers. Isc was measured using a modified Ussing chamber (model CHM2) with a 9-mm-diameter opening (63.6-mm2 area; World Precision Instruments, Sarasota, FL); the chamber was warmed to 37°C with a heated circulating water bath. For Isc measurements, the apical and basolateral solutions were nominally chloride and bicarbonate free. This Isc solution was composed of (in mM) 76 Na2SO4, 3.3 K2SO4, 1.65 NaH2PO4, 1.25 CaSO4, 1.1 MgSO4, 5 HEPES, and 10 glucose (pH 7.4). The chamber was connected to a voltage-current clamp (model DVC-1000, World Precision Instruments), and Isc was measured while voltage was clamped at 0 mV. The initial Isc, along with the initial potential difference, was measured as soon as the epithelium was mounted. From this measurement, the initial resistance was calculated. The resistance was also measured at the end of the experiment, and if it changed >15% from the initial value, the experiment was discarded. For the data from normal rats in Table 1 or 3, the current just before addition of agents that increased 8-Br-cGMP (basal Isc) was recorded again, and this current was set at 100 as the normalized current for each epithelium. The changes in Isc for each current were expressed as an increase or decrease compared with the same normalized current, i.e., 100, before the treatments. The averaged normalized currents are expressed as means ± SE.45Ca2+ Fluxes
The proximal colon was isolated, and two portions from the same animal were mounted in Ussing chambers, as described above for Isc. The resistance of the epithelium for the unidirectional mucosal-to-serosal flux (Jms) was matched for resistance within 15% to the epithelium from the same animal that was used for the unidirectional serosal-to-mucosal flux (Jsm). About 2 µCi/ml of 45Ca2+ were added to the mucosal side to measure Jms, or the same amount of 45Ca2+ was added to the serosal side to measure Jsm. After a 15-min isotope equilibration period, 45Ca2+ samples were taken from the opposite side every 10 min. Three control 45Ca2+ samples were collected, three more samples were collected after addition of heat-stable toxin from Escherichia coli (STa), and a final three samples were collected after addition of l-cis-diltiazem. The difference in the counts per minute (cpm) of the three time periods was averaged. This average value, collected over 10 min, was multiplied by 6 to give the counts per minute per hour. Because the area of the chamber opening was 63.6 mm2, this average value (cpm/h) was multiplied by 1.57 to give the average counts per minute per centimeter squared per hour. This average value (cpm · cm
2 · h
1)
was divided by the specific activity in counts per minute per mole to
give the flux in micromoles per centimeter squared per hour. To convert
net flux to current, the net flux
(µM · cm
2 · h
1)
was multiplied by the Faraday constant (96,500 C/mol) and divided by
3,600 to convert the hours to seconds and multiplied by the charge of
calcium to give the current in coulombs per centimeter squared per
second or amperes per centimeter squared.
Materials
2',4'-Dichlorobenzamil was synthesized through the National Institute of Mental Health Chemical Synthesis Program (Research Biochemicals, Natick, MA) and has been shown previously to block cyclic nucleotide-gated cation channels (23). l-cis-Diltiazem was obtained from Tanabe (Saitama, Japan) or from Research Biochemicals. Amiloride and phenamil methanesulfonate were obtained from Research Biochemicals. 8-Br-cGMP was obtained from two sources: for experiments in Table 1, rows 1 and 2, the supplier was Sigma Chemical (St. Louis, MO); for experiments in Table 1, rows 3-5, 8-Br-cGMP gave a greater response at the same 2 mM dose and was supplied by BioLog Life Science Institute (La Jolla, CA). STa was purchased from Sigma Chemical.Cell Lines
All cells were grown to confluence following standard culture procedures according to American Type Culture Collection methods. HT-29C and T84 are human colonic carcinoma cells that secrete chloride. HT-29 cells were cultured in DMEM with 10% fetal bovine serum, 10 µg/ml transferrin, 50 U/ml penicillin, and 50 µg/ml streptomycin. T84 cells were cultured in a 50:50 mixture of DMEM-Ham's F-12 with 10% fetal bovine serum, 50 U/ml penicillin, and 50 µg/ml streptomycin. IEC-6 and IEC-18 cells are rat normal small intestine and rat ileum epithelial cell lines, respectively. IEC-6 and IEC-18 cells were cultured in DMEM with 5% fetal bovine serum, 0.1 U/ml insulin, 50 U/ml penicillin, and 50 µg/ml streptomycin. Panc-1 is a permanent epithelial cell line established from a pancreatic carcinoma of duct origin. CFPAC is a pancreatic duct epithelial cell line established from a cystic fibrosis patient with pancreatic carcinoma. These cells were cultured in DMEM with 10% fetal bovine serum, 50 U/ml penicillin, and 50 µg/ml streptomycin. At 2 days-1 wk after confluence, cells were rinsed in Hanks' buffer, scraped into TRIzol, and homogenized by shaking.RT-PCR
Total RNA was isolated following the TRIzol protocol (GIBCO BRL), then dissolved in 0.01% diethylpyrocarbonate-treated water. The optical density at 260/280 nm was measured to determine the concentration and purity (ratio 1.7-1.9). First-strand cDNA was reverse transcribed using the SuperScript preamplification system for first-strand cDNA synthesis kit (GIBCO BRL). Each PCR of 50 µl was composed of 2 or 5-10 µl of first-strand cDNA, 1× PCR buffer (pH 9.0), 2.5 mM Mg2+ hot wax beads (Invitrogen, San Diego, CA), 0.2 mM dATP, dCTP, dGTP, and dTTP, 0.25-0.5 µM channel primers, 0.1 µM
-actin primers, and 2.5 units of
Taq DNA polymerase (Boehringer
Mannheim, Indianapolis, IN). A master mix composed of primers,
deoxytriphosphates, and Taq polymerase
was premixed and then added to Eppendorf tubes to which the cDNA or
water was added. The master mix ensured that each cDNA was exposed to
equal concentrations of reaction mixture components. RT-PCR
(denaturation at 94°C for 1.0 min, annealing at 55-65°C
for 1.0 min, and extension at 72°C for 1.0 min) was performed with
a DNA thermal cycler (model 480, Perkin-Elmer, Norwalk, CT). RT-PCR
products were analyzed by electrophoresis in a 2% agarose gel, then
extracted for sequencing. For RT-PCR involving degenerate primers, the
initial five cycles of annealing were done at 37°C, then the
temperature was shifted to 40, 45, and 50°C, each for 5 cycles and
to 55°C for the last 20 cycles.
Primers
Primers for
-actin were TATGCCAACACAGTGCTGTCTGG (bp 2760-2782)
and TACTCCTGCTTGCTGATCCACAT (bp 3089-3067). This set of primers was chosen to span an intron to check for contamination with genomic DNA. The
-actin RT-PCR product derived from RNA is 217 bp; the product from genomic DNA is 329 bp. Although the data are not shown,
RT-PCR for actin was preformed on all intestinal segments, and no
contaminating genomic cDNA was found. Primers chosen for rCNG1 do not
amplify rCNG2 from rat olfactory library or rCNG3 from rat kidney,
heart, or testis, as verified by sequencing. Choosing the primers in
areas where there were deletions in the CNG2 and CNG3 isoforms gave
this specificity. In this manner, the RNA for each of the three channel
isoforms could be distinguished in each segment. This is more difficult
with a Northern blot, because the mRNA for CNG3 and CNG1 are very close
in size; therefore, it is difficult to distinguish these in a Northern
blot (8). Primers for
rCNG1 were TGGTTTGACTACCTGTGGACTAACAA (bp
1282-1307) and GCTTCCATGAGGTCATCCTT (bp 1724-1715). Primers
for
rCNG2 were AAGGATGAGGAGTACCTATTTGTCAT (bp 1042-1067) and
GCTGAGAGCAAGGCATACTGAGTCAC (bp 1550-1525). Rat CNG3
was sequenced from kidney with use of degenerate primers based on the
sequence for bovine
CNG3, then specific primers for
rCNG3 were
designed on the basis of the partial rat sequence. The primers
correspond to the bovine nucleotide sequence GCTAACAGGAAGACGGTGGATGAAAA
(bp 1665-1690) and TCCGGGTACTCCGTGAGGGTCTCCAT (bp 2107-2082)
(2). The primers for
rCNG were AAG TAC ATG GCC TTC TTC GA (bp
1582-1598) and TGC CAG GTG TAC TCA TAC CA (bp 2057-2038;
accession no. AF068572). The primers for
hCNG1 were
TGGTCTACACTGACTACCATTGG (bp 1051-1079) and
AATTTCAAGACCAACTCCACCAACAGACCAGC (bp 1472-1441). A human retinal
library used to amplify message for
hCNC1 was provided by Jeremy
Nathans (Howard Hughes Institute, The Johns Hopkins University). A rat
olfactory library used to amplify message for
rCNG2 was provided by
Randall Reed (Howard Hughes Institute, Johns Hopkins University). All
PCRs yielded a single band, which was extracted from the gel and
sequenced in both directions at the Johns Hopkins Core Facility. All
PCR products were of the expected size and sequence compared with published mRNA sequence, except CNG3 from rat, which has not been sequenced, except in bovine kidney.
Northern Blot
Generation of probe.
The CNG3 316-bp probe was generated by RT-PCR spanning bp
1529-1845 relative to CNG3 (accession no. AB002801). The RT-PCR product was gel extracted, sequenced, ligated into PCR2.1 plasmid (Invitrogen, Carlsbad, CA), transformed into DH5
competent cells (Life Technology, Gaithersburg, MD), and grown in Laria-Bertani medium
containing 50 µg/ml ampicillin. The plasmids were extracted by
alkaline lysis and purified using a Mini-plasmid preparation kit for
sequencing followed by a Maxi-plasmid preparation kit (QIAGEN,
Valencia, CA) to generate the probe.
EcoR I was used to cut the probe cDNA
from the plasmid, and the insert was extracted from a gel with a
QIAquick gel extraction kit (QIAGEN) and then sequenced. The RT-PCR
product and the insert were identical to the reported sequence.
Hybridization.
RNA was denatured at 65°C and fractionated by electrophoresis in a
1% agarose gel containing 2.2 M formaldehyde. RNA was determined to be
intact by ethidium bromide stain and transferred overnight to Nytran
filters (Hybond, Amersham) that were cross-linked with ultraviolet
light and then stained with methylene blue to determine that transfer
was complete. The blot was prehybidized in Rapid-hyb (Amersham
Pharmacia Biotech, Picataway, NJ) at 65°C for 1.5 h. The probe was
radiolabeled by random primer extension (Multiprime DNA labeling kit,
Amersham), purified using Probe Quant G-50 micro columns (Pharmacia
Biotech), diluted to 1 × 106
cpm/ml in Rapid-hyb, and then hybridized at 65°C for 2 h following the manufacturer's protocol. The membrane was washed three times with
2× sodium chloride-sodium citrate (SSC) and 0.1% SDS at room temperature for 30 min, 1× SSC and 0.1% SDS at 65°C for 20 min, and 0.1× SSC and 0.1% SDS at 65°C for 20 min.
Autoradiography of the blot was performed at
80°C with
Hyper-film (Amersham Pharmacia). Sizes of mRNA were determined using
the 0.24- to 9.5-kb RNA ladder (Life Technologies GIBCO BRL).
| |
RESULTS |
|---|
|
|
|---|
To determine whether cyclic nucleotide-gated cation channels might
contribute to transepithelial sodium transport across intestinal epithelia, we investigated the distribution of mRNA for the three isoforms in all intestinal segments of the rat and in pancreatic and
intestinal cell culture lines. Figure
1A
shows that
rCNG1 mRNA is expressed in the mucosa of the
duodenum, jejunum, ileum, and colon. The mRNA is shown in
comparison to that in the eye, where mRNA for
rCNG1 has
been measured previously by Northern blot (17). No mRNA for CNG1 was
amplified from rat olfactory library, where
rCNG1 is not present
(7). Message for
rCNG1 is also expressed in HT-29 and T84 cells
(Fig. 1B), as well as in IEC-6 and
IEC-18 cells (Fig. 1C) and the
pancreatic cell lines Panc-1 and CFPAC-1 (Fig.
1D), when RT-PCR is used to show
expression of mRNA transcripts. The mRNA found in these cell lines
suggests that the cDNA amplified from the mucosal layer represents mRNA from epithelial cells.
|
Figure 2 shows that mRNA for
rCNG2 is
mainly restricted to the mucosa of the duodenum and ileum. The small
amount of message for CNG2 detected in the eye has not previously been
reported in rods and cones, where CNG1 and CNG3 are abundant (16).
Sequencing of the RT-PCR product confirmed that it was CNG2. Expression
of CNG2 in rat eye may represent message from the retinal pigment epithelium or cells other than those involved in sensing light. The
highest expression of CNG2 is in olfactory organ library. This channel
was cloned from the olfactory organ, where the expression has been
shown previously by Northern blot (7).
|
Restriction analysis of plasmid preparations after RT-PCR by use of
degenerate primers in intestinal segments and cell lines revealed nine
CNG1 plasmids and six CNG2 plasmids in the ileum. For the colon, 10 plasmids were shown to be CNG1 and 6 were CNG2. For HT-29 cells, nine
plasmid preparations had CNG1 and two contained CNG2. Sequencing of
clones from rat ileum also revealed that nine were CNG1 and six were
CNG2, and sequencing revealed eight CNG1 and four CNG2 clones in rat
colon. Sequencing of 11 of 15 clones from the HT-29 library suggested
that 9 were CNG1 and 2 were CNG2. These results suggest that CNG1 and
CNG2 are expressed in multiple intestinal segments. We previously
reported that CNG1 mRNA is expressed in the lung (8) and airway cells
(trachea, bronchus, bronchioles, and alveoli) and mediates electrogenic
transepithelial sodium absorption across tracheal epithelial cells
(28). The degenerate primers used here did not amplify CNG3, which is
also expressed in all the intestinal segments (Fig.
3). The kidney expresses high levels of
CNG3, as previously reported (2), and we have shown here by RT-PCR that
this isoform is also expressed in the kidney and lung (Fig. 3). By use
of Northern analysis, Fig. 4 shows that
CNG3 is expressed in all the intestinal segments in almost equal
abundance to that in the kidney or heart, where this channel mRNA was
previously reported (2). Figure 5 shows that the mRNA for the secondary (
) subunit, which alters calcium affinity or enhances drug affinity (5), is mainly in the colon. The
colon was used for transport experiments, because the presence of the
secondary subunit suggested a better drug efficacy (5).
|
|
|
To determine the functional role of cyclic nucleotide-gated cation
channels in intestinal epithelia, we measured
Isc across the
proximal and distal colon and
45Ca2+
fluxes across the proximal colon. Because cyclic nucleotide-gated cation channels carry cGMP-stimulated sodium currents, we used 8-Br-cGMP-stimulated sodium-mediated
Isc to
investigate the role of cyclic nucleotide-gated cation channels in
sodium entry and transepithelial transport in proximal and distal
colon, where CNG1 and CNG3 are expressed (Figs.
1A, 3, and 4). Because
amiloride-sensitive (ENaC-mediated) electrogenic sodium absorption has
been reported in the distal colon of the rats fed a low-salt diet,
electrogenic sodium current in this segment was investigated in the
presence of amiloride to block these currents; furthermore, only
l-cis-diltiazem was used to completely
distinguish cyclic nucleotide-gated channels from ENaC, both of which
are blocked by dichlorobenzamil. To distinguish electrogenic sodium
currents carried by cyclic nucleotide-gated cation channels, we used
two classes of blockers of these channels, l-cis-diltiazem and dichlorobenzamil,
which caused inhibition of cGMP-stimulated currents (Table 1), whereas
amiloride and phenamil did not. The
-subunit for cyclic nucleotide-gated cation channels was also
expressed in the colon (Fig. 5). Because this subunit is thought to
increase the calcium conductance of cyclic nucleotide-gated cation
channels (5), the role of cyclic nucleotide-gated cation channels in
transepithelial calcium transport was also measured by unidirectional
transepithelial
45Ca2+
fluxes. The role of STa, which increases cGMP-mediated chloride secretion in crypt-derived cells, has been well studied, but the role
of STa (or guanylin) on other transport pathways has not been well
defined. Therefore, we investigated the role of STa in mediating
transepithelial sodium and calcium transport. STa increased
transepithelial sodium transport, as measured by
Isc and
unidirectional and net
45Ca2+
transport across the proximal colon that was blocked by
l-cis-diltiazem (Table
2).
|
|
We also studied electrogenic sodium absorption in the distal colon of
the rats fed a normal-salt diet, where sodium currents mediated by ENaC
are minimal (Table 3).
Isc was also
measured in rats fed a low-salt diet for comparison (Table 3).
Experiments were performed in chloride-free media to eliminate chloride
conductances. To investigate the effects of various blockers or vehicle
on Isc, three
groups of experiments were performed (Table 3). The experiment consisted of measuring initial
Isc, potential,
and resistance; after a steady current was attained, 8-Br-cGMP, and
then an inhibitor, was added. The mean of the initial potential
difference in the distal colon of the control animals fed the
normal-salt diet was 6-9 mV, but this increased to a mean of 27 mV
in rats fed the low-salt diet (Table 3). The average initial
Isc for the two control distal colon groups was 38-65
µA/cm2 (Table 3), whereas the
average initial resistance in the five experimental groups was
196-236
/cm2 (Table 3). As
previously reported (31, 32), the initial Isc in rats fed
the low-salt diet was increased to an average of 210 µA/cm2 (Table 3). The addition
of 2 mM 8-Br-cGMP to the bath increased the average
sodium-mediated
Isc by
16-20% (Table 3), and this increased current differed
statistically from basal currents in all experiments
(P < 0.05). The 8-Br-cGMP-stimulated
current was inhibited by the apical addition of 200 µM
l-cis-diltiazem or 30 µM
2',4'-dichlorobenzamil (Table 3). This inhibition was
statistically different from the 8-Br-cGMP currents
(P < 0.05).
|
To distinguish the ENaC-mediated Isc from the currents resulting from activation of the cyclic nucleotide-gated cation channels, colons from rats fed the low-salt diet were treated with 10 µM amiloride before addition of 8-Br-cGMP. This decreased the basal Isc from 177 to 100 µA/cm2 (Table 3). After addition of 8-Br-cGMP, the currents increased 9% from 100 to 109 µA/cm2 (Table 3). This increased current was inhibited by l-cis-diltiazem (Table 3), which does not block ENaC channels.
| |
DISCUSSION |
|---|
|
|
|---|
Intestinal epithelial cells absorb sodium via electroneutral or
electrogenic uptake at the apical membrane and extrude sodium at the
basolateral membrane via the
Na+-K+-ATPase.
The major fraction of sodium delivered to the small intestine and
proximal colon is absorbed via the electroneutral NHE (6, 19, 26),
whereas the distal colon mediates electrogenic transepithelial sodium
absorption via ENaC under conditions of a low-salt diet (20, 31, 32).
Sodium entry and electrogenic sodium absorption via ENaC is increased
when circulating aldosterone is high (32) as a result of low salt
intake (31). The cloned ENaC is the most completely studied epithelial
sodium channel (3, 4). We now show that mRNA for the cyclic
nucleotide-gated cation channel
CNG1 is expressed in the mucosa of
all intestinal segments, in several intestinal epithelial cell lines,
and in two pancreatic cell lines. Other isoforms, CNG2 and CNG3, and
the secondary subunit
CNG are also present in intestinal mucosa,
suggesting that these channels may also mediate electrogenic sodium and
calcium currents into intestinal epithelial cells.
In the proximal and distal colon, cyclic nucleotide-gated cation channels carry an 8-Br-cGMP-stimulated, sodium-mediated Isc that is inhibited by l-cis-diltiazem. The current stimulated by cGMP is not inhibited by amiloride, suggesting that ENaC does not carry this current. Likewise, phenamil, a more potent blocker of ENaC than amiloride, did not inhibit the 8-Br-cGMP-stimulated, sodium-mediated Isc in the proximal colon, whereas dichlorobenzamil did inhibit the Isc. These results are consistent with previous data (31) which suggest that ENaC does not carry an amiloride-sensitive sodium current in the proximal colon of the rat. The transepithelial sodium transport carried by cyclic nucleotide-gated cation channels in the colon is less in magnitude than aldosterone-induced, ENaC-mediated sodium absorption in the distal colon (31, 32) or electroneutral sodium absorption mediated by NHE in the proximal colon (6), but these other pathways are specific for sodium. Opening of cyclic nucleotide-gated cation channels by cGMP increases sodium and calcium conductance through this class of channels (14, 17, 24). In the same manner, because an inward electrochemical gradient for sodium and calcium exists across the apical membrane of intestinal epithelial cells, the opening of cyclic nucleotide-gated cation channels by cGMP would increase calcium and sodium influx across the apical membrane. We have shown that STa increases sodium-mediated Isc to increase electrogenic transepithelial transport of sodium, and at the same time, STa increases transepithelial calcium transport. The finding that blockers of cyclic nucleotide-gated cation channels, but not amiloride, inhibit the transepithelial movement of sodium and calcium suggests that cyclic nucleotide-gated cation channels mediate an electroconductive sodium and calcium entry at the apical membrane of the proximal colon. Therefore, unlike ENaC and NHE, cyclic nucleotide-gated cation channels mediate transepithelial sodium and calcium transport stimulated by STa or cGMP.
The receptors for STa and guanylin are distributed from the crypt-to-villus axis along the entire intestine (21, 29). The role of these receptors in transepithelial transport or signal transduction in the villus tip is not clearly defined, but the major localization of guanylate cyclase is in the brush border (29). Guanylin and STa act in the small and large intestine to increase cGMP-mediated chloride secretion from intestinal crypts (11). Likewise, the role of guanylin in the surface epithelia of the colon is not well defined, but this segment also has a surface distribution of this receptor (29).
It was previously shown in porcine distal colon that cGMP, in the absence of chloride, increases sodium-mediated Isc and inhibits electroneutral sodium chloride absorption, as measured by 22Na+ flux (10). Similarly, atrial natriuretic peptide in this preparation inhibits electroneutral sodium chloride absorption via cGMP- and calcium-mediated mechanisms (1). Extracellular calcium, as well as protein kinase C, was previously shown to activate particulate guanylate cyclase activity in rat colon (18). Thus a calcium influx mediated by cyclic nucleotide-gated cation channels would be expected to enhance increases in cGMP caused by the action of STa in the colon.
Although we did not measure transepithelial 22Na+ fluxes in the small intestine, inhibition of NHE by calcium is well documented (9). Because the mRNA for cyclic nucleotide-gated cation channels also exist in the ileum, it is likely that increased influx of calcium stimulated by cGMP could inhibit transepithelial sodium absorption via NHE in the small intestine and/or enhance chloride secretion in this segment. Our experiments predict that STa, by increasing calcium influx via cyclic nucleotide-gated cation channels, would act to alter sodium absorption or chloride secretion along the entire intestine. Increases in intracellular calcium are not usually associated with the action of STa on chloride secretion (11), but it is more difficult to measure small increases in intracellular calcium, such as those mediated by calcium influx, than to measure the large increases caused by release of calcium from intracellular stores related to inositol trisphosphate (12).
In summary, we have documented, for the first time, that mRNA of the three isoforms of cyclic nucleotide-gated cation channels exist in intestinal mucosa from the duodenum to the distal colon. The finding that the mRNA is also present in intestinal and pancreatic epithelial cell lines is evidence that these channels reside in the epithelial cells. In addition, functional transport assays suggest that these channels mediate transepithelial calcium and sodium across the proximal and distal colon; this transepithelial transport also implies that these channels reside in transporting epithelial cells. Because these channels exist along the entire intestinal tract, we speculate that they are poised to enhance cGMP-mediated activation of guanylate cyclase activity that would inhibit sodium absorption or stimulate chloride secretion, if these channels are expressed along the whole crypt-to-villus axis.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. S. Khurana and J. Wright for helpful discussions regarding flux analysis.
| |
FOOTNOTES |
|---|
This work was funded by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-44648 (to S. E. Guggino) and DK-48977 (to S. E. Guggino), Cystic Fibrosis Foundation Grant P977 (to S. E. Guggino), and the Johns Hopkins Institutional Research Grant Project (to S. E. Guggino). W. Qiu was supported by a fellowship from the Cystic Fibrosis Research Development Training Program. B. Lee was awarded a Student Research Fellowship Award from the American Digestive Health Foundation.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: S. E. Guggino, 929 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205 (E-mail: sguggino{at}jhmi.edu).
Received 14 April 1999; accepted in final form 20 October 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Argenzio, R. A.,
and
M. Armstrong.
ANP inhibits NaCl absorption and elicits Cl secretion in porcine colon: evidence for cGMP and Ca mediation.
Am. J. Physiol. Regulatory Integrative Comp. Physiol.
265:
R57-R65,
1993
2.
Biel, M.,
Z. Zong,
M. Distler,
E. Bosse,
N. Klugbauer,
M. Murakami,
V. Flockerzi,
and
F. Hofmann.
Another member of the cyclic nucleotide-gated channel family, expressed in testis, kidney, and heart.
Proc. Natl. Acad. Sci. USA
91:
3505-3509,
1994
3.
Canessa, C. M.,
J. D. Horisberger,
and
B. C. Rossier.
Epithelial sodium channel related to proteins involved in neurodegeneration.
Nature
361:
467-470,
1993[Medline].
4.
Canessa, C. M.,
L. Schild,
G. Buell,
B. Thorens,
I. Gautschi,
J. Horisberger,
and
B. C. Rossier.
Amiloride-sensitive epithelial Na channel is made of three homologous subunits.
Nature
367:
463-467,
1994[Medline].
5.
Chen, T. Y.,
Y. W. Peng,
R. S. Dhallan,
B. Ahmed,
R. R. Reed,
and
K. W. Yau.
A new subunit of the cyclic nucleotide-gated cation channel in retinal rods.
Nature
362:
764-767,
1993[Medline].
6.
Cho, J. H.,
M. W. Musch,
C. M. Bookstein,
R. L. McSwine,
K. Rabenau,
and
E. B. Chang.
Aldosterone stimulates intestinal Na+ absorption in rats by increasing NHE3 expression of the proximal colon.
Am. J. Physiol. Cell Physiol.
274:
C586-C594,
1998
7.
Dhallan, R. S.,
K.-W. Yau,
K. W. Schrader,
and
R. R. Reed.
Primary structure and functional expression of a cyclic nucleotide-activated channel from olfactory neurons.
Nature
347:
184-187,
1990[Medline].
8.
Ding, C.,
E. D. Potter,
W. Qiu,
S. L. Coon,
M. A. Levine,
and
S. E. Guggino.
Cloning and widespread distribution of the rat rod-type cyclic nucleotide-gated cation channel.
Am. J. Physiol. Cell Physiol.
272:
C1335-C1344,
1997
9.
Donowitz, M.
Ca2+ in the control of active intestinal Na and Cl transport: involvement in neurohormonal action.
Am. J. Physiol. Gastrointest. Liver Physiol.
245:
G165-G177,
1983
10.
Du Vall, M. D.,
and
S. M. O'Grady.
cGMP and Ca2+ regulation of ion transport across the isolated porcine distal colon epithelium.
Am. J. Physiol. Regulatory Integrative Comp. Physiol.
267:
R1026-R1033,
1994
11.
Field, M.,
L. H. Graf,
W. J. Laird,
and
P. L. Smith.
Heat-stable enterotoxin of Escherichia coli: in vitro effects on guanylate cyclase activity, cGMP concentration and ion transport in the small intestine.
Proc. Natl. Acad. Sci. USA
75:
2800-2804,
1978
12.
Foskett, J. K.,
P. J. Gunter-Smith,
J. E. Melvin,
and
R. J. Turner.
Physiological localization of an agonist-sensitive pool of Ca2+ in parotid acinar cells.
Proc. Natl. Acad. Sci. USA
86:
167-171,
1989
13.
Frings, S.,
J. W. Lynch,
and
B. Lindemann.
Properties of cyclic nucleotide-gated cation channels mediating olfactory transduction. Activation, selectivity and blockage.
J. Gen. Physiol.
100:
45-67,
1992
14.
Frings, S.,
R. Seifert,
M. Godde,
and
U. B. Kaupp.
Profoundly different calcium permeation and blockage determine the specific function of distinct cyclic nucleotide-gated channels.
Neuron
15:
169-179,
1995[Web of Science][Medline].
15.
Hoogerwerf, W. A.,
S. C. Tsao,
O. Devuyst,
S. A. Levine,
C. H. Yun,
J. W. Yip,
M. E. Cohen,
P. D. Wilson,
A. J. Lazenby,
C. M. Tse,
and
M. Donowitz.
NHE2 and NHE3 are human and rabbit intestinal brush-border proteins.
Am. J. Physiol. Gastrointest. Liver Physiol.
270:
G29-G41,
1996
16.
Kaupp, U. B.
The cyclic nucleotide-gated channels of vertebrate photoreceptors and olfactory epithelium.
Trends Neurol. Sci.
14:
149-151,
1991.
17.
Kaupp, U. B.,
T. Niidome,
T. Tanabe,
S. Terada,
W. Bonigk,
W. Stuhmer,
N. J. Cook,
K. Kangawa,
H. Matsuo,
T. Hirose,
T. Miyata,
and
S. Numa.
Primary structure and functional expression from complementary DNA of the rod photoreceptor cyclic GMP-gated channel.
Nature
342:
762-766,
1989[Medline].
18.
Khare, S.,
D. M. Wison,
X. Y. Tien,
R. K. Wali,
M. Bissonnette,
and
T. A. Brasitus.
Protein kinase C mediates the calcium-induced activation of rat colonic particulate cyclase.
Arch. Biochem. Biophys.
314:
200-2004,
1994[Web of Science][Medline].
19.
Knickelbein, R. G.,
P. S. Aronson,
W. Atherton,
and
J. W. Dobbins.
Sodium and chloride transport across rabbit ileal brush border. I. Evidence for Na-H exchange.
Am. J. Physiol. Gastrointest. Liver Physiol.
245:
G504-G510,
1983
20.
Linguelia, E.,
S. Renard,
R. Waldman,
N. Voilley,
G. Champigny,
H. Plass,
M. Lazdunski,
and
P. Barbry.
Different homologous subunits of the amiloride-sensitive Na+ channel are regulated differently by aldosterone.
J. Biol. Chem.
269:
13736-13739,
1994
21.
Nabdi, A.,
R. Bhandari,
and
S. S. Visweswariah.
Epitope conservation and immunohistochemical localization of the gua-nylin/stable toxin peptide receptor, guanylyl cyclase C.
J. Cell. Biochem.
66:
500-511,
1997[Web of Science][Medline].
22.
Nemere, I.,
and
A. W. Norman.
1,25-Dihydroxyvitamin D3-mediated vesicular transport of calcium in intestine: time course studies.
Endocrinology
122:
2962-2969,
1988
23.
Nicol, G. D.,
P. P. M. Sachnetkamp,
Y. Saimi,
E. J. Cragoe, Jr.,
and
M. D. Bownds.
A derivative of amiloride blocks the light-regulated and cyclic GMP-regulated conductances in rod photoreceptors.
J. Gen. Physiol.
90:
651-669,
1987
24.
Picones, A.,
and
J. I. Korenbrot.
Permeability and interaction of Ca2+ with cGMP-gated ion channels differ in retinal rod and cone photoreceptors.
Biophys. J.
69:
120-127,
1995[Web of Science][Medline].
25.
Picotto, G.,
V. Massheimer,
and
R. Boland.
Parathyroid hormone stimulates calcium influx and the cAMP messenger system in rat enterocytes.
Am. J. Physiol. Cell Physiol.
273:
C1349-C1353,
1997
26.
Rajendran, V. M.,
and
H. J. Binder.
Characterization of Na-H exchange in apical membrane vesicles of rat colon.
J. Biol. Chem.
265:
8408-8414,
1990
27.
Renard, S.,
N. Violley,
F. Bassilana,
M. Lazdunski,
and
P. Barbry.
Localization and regulation by steroids of the
-,
-, and
-subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney.
Pflügers Arch.
430:
299-307,
1995[Web of Science][Medline].
28.
Schwiebert, E. M.,
E. D. Potter,
T. H. Hwang,
J. S. Woo,
C. Ding,
W. Qiu,
W. B. Guggino,
M. A. Levine,
and
S. E. Guggino.
cGMP stimulates sodium and chloride currents in rat tracheal airway epithelia.
Am. J. Physiol. Cell Physiol.
272:
C911-C922,
1997
29.
Swenson, E. S.,
E. A. Mann,
M. L. Jump,
D. L. Whitte,
and
R. A. Gianella.
The guanylin/Sta receptor is expressed in crypts and apical epithelium throughout the mouse intestine.
Biochem. Biophys. Res. Commun.
225:
1009-1014,
1996[Web of Science][Medline].
30.
Wasserman, R. H.,
and
C. S. Fullmer.
On the molecular mechanism of intestinal calcium transport.
Adv. Exp. Med. Biol.
249:
45-65,
1989[Medline].
31.
Will, P. C.,
R. N. Cortright,
R. G. Grosecvlose,
and
U. Hoper.
Amiloride-sensitive salt and fluid absorption in small intestine of sodium-depleted rats.
Am. J. Physiol. Gastrointest. Liver Physiol.
248:
G133-G141,
1985
32.
Will, P. C.,
J. L. Lebowitz,
and
U. Hopfer.
Induction of amiloride-sensitive sodium transport in the rat colon by mineralocorticoids.
Am. J. Physiol. Renal Fluid Electrolyte Physiol.
238:
F261-F268,
1981.
This article has been cited by other articles:
![]() |
M. S. Awayda, A. Bengrine, N. A. Tobey, J. D. Stockand, and R. C. Orlando Nonselective cation transport in native esophageal epithelia Am J Physiol Cell Physiol, August 1, 2004; 287(2): C395 - C402. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kunzelmann and M. Mall Electrolyte Transport in the Mammalian Colon: Mechanisms and Implications for Disease Physiol Rev, January 1, 2002; 82(1): 245 - 289. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |