Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 278: C323-C330, 2000;
0363-6143/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (36)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Woo, S. K.
Right arrow Articles by Kwon, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woo, S. K.
Right arrow Articles by Kwon, H. M.
Vol. 278, Issue 2, C323-C330, February 2000

Nuclear redistribution of tonicity-responsive enhancer binding protein requires proteasome activity

Seung Kyoon Woo, Djikolngar Maouyo, Joseph S. Handler, and H. Moo Kwon

Division of Nephrology, School of Medicine, The Johns Hopkins University, Baltimore, Maryland 21205


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Tonicity-responsive enhancer binding protein (TonEBP) is the transcription factor that regulates tonicity-responsive expression of the genes for the sodium-myo-inositol cotransporter (SMIT) and the sodium-chloride-betaine cotransporter (BGT1). Hypertonicity stimulates the activity of TonEBP due to a combination of increased protein abundance and increased nuclear distribution (proportion of TonEBP that is in the nucleus). We found that inhibitors of proteasome activity markedly reduce the induction of SMIT and BGT1 mRNA in response to hypertonicity. These inhibitors also reduce hypertonicity-induced stimulation of expression of a reporter gene controlled by the tonicity-responsive enhancer. Western and immunohistochemical analyses revealed that the proteasome inhibitors reduce the hypertonicity-induced increase of TonEBP in the nucleus by inhibiting its nuclear redistribution without affecting its abundance. Although the nuclear distribution of TonEBP is sensitive to inhibition of proteasome activity as is that of nuclear factor (NF)-kappa B, the signaling pathways appear to be different in that hypertonicity does not affect the nuclear distribution of NF-kappa B. Conversely, treatment with tumor necrosis factor-alpha increases the nuclear distribution of NF-kappa B but not TonEBP.

hypertonicity-stimulated transcription; sodium-myo-inositol cotransporter; sodium-chloride-betaine cotransporter


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

WHEN EXPOSED TO A hypertonic solution, cells shrink, and their cellular ionic strength is increased due to osmotic water loss. Cells survive the stress of hypertonicity by lowering cellular ionic strength toward the isotonic level. This is achieved by replacement of the increased ionic strength, which perturbs protein function, with small organic solutes that are nonperturbing or compatible osmolytes (33). The medulla of mammalian kidney is hypertonic under physiological conditions due to the operation of the urinary concentrating mechanism. The major compatible osmolytes accumulated by cells in the medulla are myo-inositol, betaine, and sorbitol (8). The osmoprotective accumulation of most compatible osmolytes is driven by hypertonicity-induced stimulation of specific sodium-coupled transporters [the sodium-chloride-betaine cotransporter (BGT1; see Ref. 27) and the sodium-myo-inositol cotransporter (SMIT; see Ref. 32)] and by the enzyme aldose reductase (AR), which catalyzes synthesis of sorbitol from D-glucose (24). Certain diseases such as diabetes insipidus and some instances of diabetes mellitus cause hypernatremia that results in systemic hypertonicity. Under these conditions, nonrenal tissues such as brain (10, 18), endothelium (30), and monocytes and macrophages (3) accumulate compatible osmolytes using the same mechanisms used by the kidney medulla. If the accumulation of compatible osmolytes is blocked under hypertonic conditions by inhibiting the enzymes and transporters catalyzing the accumulation, cells do not grow (26) and die via necrosis (11, 12). When liver macrophages (Kupffer cells) are exposed to hypertonicity, cellular accumulation of compatible osmolytes restores their phagocytic activity (28) and modulates the production of PGE2 (29). Thus compatible osmolytes are important agents in protection from the stresses imposed by a hypertonic environment.

Recent studies show that hypertonicity-induced stimulation of BGT1 (19, 25), SMIT (21), and AR (13) occurs at the level of transcription and involves a common regulatory sequence element, tonicity-responsive enhancer (TonE). TonE has a consensus sequence of TGGAAANNYNY (Y is T or C; N is A, G, C, or T) (21) and serves as a specific binding site for the transcription factor, TonE binding protein (TonEBP; see Ref. 19). Cloning of TonEBP reveals that it is a novel Rel-like DNA binding protein (20). When cells are exposed to hypertonicity, activity of TonEBP is markedly stimulated in the nucleus due to a combination of an increase in TonEBP abundance and an increase in nuclear distribution (20). Activated TonEBP binds to the TonE sites located upstream of the genes and stimulates transcription (19, 21). Thus activation of TonEBP is the key event in activation of transcription by hypertonicity.

The ubiquitin-dependent proteolytic system is an important intracellular pathway for selective protein breakdown (9) related to a variety of cellular functions such as cell cycle regulation (14) and antigen presentation (22). Target proteins are covalently modified by conjugation with ubiquitin, and the ubiquitinated proteins are recognized and degraded by the 26S proteasome complex. Proteasome activity is essential for normal regulation of the activity of certain transcription factors such as nuclear factor (NF)-kappa B (2) and hypoxia-inducible factor-1alpha (17). The availability of potent and specific proteasome protease inhibitors such as MG-132, MG-115, lactacystin, and clasto-lactacystin beta -lactone (4, 6, 23) facilitates studies of the role of the proteasome in transcriptional regulation. We report here that proteasome inhibitors prevent the transcriptional response to hypertonicity at the nuclear redistribution step.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. Madin-Darby canine kidney (MDCK) cells were grown to confluence in defined medium as described previously (26, 32). To examine the effect of a reagent, cells were initially incubated with the reagent in isotonic medium for 30 min before incubation with the same reagent for 18 h in isotonic or hypertonic medium or with addition of tumor necrosis factor-alpha (TNF-alpha ; see Fig. 5). Each inhibitor was dissolved in DMSO or ethanol [Nalpha -p-tosyl-L-lysine chloromethyl ketone (TLCK) and N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)], and an appropriate volume of this solution was added to the medium. The same volume of solvent was added to the medium of controls. The final concentration of DMSO or ethanol in the medium was <0.5%. MG-132, MG-115, and clasto-lactacystin beta -lactone were obtained from Calbiochem. Other protease inhibitors were purchased from Sigma. Hypertonic medium was made by adding 200 mM raffinose.

Northern blot analysis. RNA was isolated using Trizol reagent (GIBCO-BRL). RNA (5 µg) was size-fractionated on a 1% agarose gel containing 2.2 M formaldehyde and was transferred to a nitrocellulose membrane. Membranes were hybridized overnight with radiolabeled BGT1 (31), SMIT (15), or TonEBP cDNA. Canine TonEBP cDNA corresponding to nucleotides 730-2187 of the human TonEBP (20) was obtained using RT-PCR. The canine cDNA shares 96% of nucleotides with the human cDNA. After washing under stringent conditions (65°C in 75 mM NaCl and 7.5 mM sodium citrate with 0.1% SDS), radioactivity was visualized and quantified using a Phosphorimager (Molecular Dynamics).

Transfection. The day before transfection, MDCK cells were seeded at a density of 2 × 105 cells per 35-mm tissue culture dish. They were transfected using DEAE-dextran as described (1). Each dish received one of the following constructs in which the Photinus luciferase gene is under the control of 1) a 426-bp genomic DNA fragment containing the promoter and TonEs of the BGT1 gene ["BGT1" construct (25), 2 µg/dish], 2) the SV40 promoter under the control of two copies of hTonE ["2× hTonE" construct (19), 2 µg/dish], or 3) the promoter of the beta -actin gene ["beta -actin" construct (25), 50 ng/dish]. pCMV-Renilla (50 ng; Promega) containing the Renilla luciferase gene under control of the promoter of cytomegalovirus was added with every Photinus construct to measure efficiency of transfection. Twenty-four hours after transfection, cells were incubated initially with a given inhibitor for 30 min in isotonic medium and then with the same inhibitor for 18 h in isotonic or hypertonic medium. The activity of Photinus and Renilla luciferase in extracts of the transfected cells was determined using a commercial kit, Dual-Luciferase Reporter Assay System (Promega). For each extract, activity of the Photinus luciferase was divided by the activity of the Renilla luciferase to correct for transfection efficiency. Under each tonicity condition, i.e., isotonic or hypertonic, the corrected activity of the Photinus luciferase from cells transfected with the BGT1 or 2× hTonE construct was again divided by that from cells transfected with the beta -actin construct, as described previously (25). The resulting luciferase activity standardized for the beta -actin promoter was used to calculate the degree of induction of luciferase by hypertonicity by dividing the activity of luciferase in hypertonic medium by the activity of luciferase in isotonic medium. Each experiment (n = 1) was performed in duplicate dishes.

Electrophoretic mobility shift assay. Nuclear extracts were prepared from confluent MDCK cells as described (5) and dialyzed against 20 mM Tris · HCl buffer (pH 7.8) containing 5 mM MgCl2, 1 mM DTT, 1 mM EDTA, and 20% (vol/vol) glycerol. Double-stranded hTonE (CTTGGTGGAAAAGTCCAGCTGGT), which has the highest affinity to TonEBP among various TonE sequences (19), was end-labeled using [gamma -32P]ATP. To determine the activity of TonEBP, 5 µg protein of nuclear extract were incubated for 10 min with 1.5 µg of nonspecific DNA [poly(dA · dT)] in 30 µl containing 20 mM HEPES (pH 7.9), 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, and 5% (vol/vol) glycerol. After addition of 10 fmol 32P-labeled hTonE, the reaction was incubated for 20 min at room temperature. The mixture was electrophoresed for 2.5 h on a 4.5% polyacrylamide gel in 45 mM Tris, 45 mM boric acid, and 1 mM EDTA with constant voltage of 150 V. Radioactivity of the TonEBP bands was visualized and quantified using a Phosphorimager.

Western blot analysis. To prepare whole cell extract, MDCK cells were lysed in a buffer containing 50 mM Tris · HCl (pH 7.6), 150 mM NaCl, 1 mM EDTA, 1% (vol/vol) Triton X-100, 0.2 µg/ml aprotinin, 5 µM leupeptin, 1 mM phenylmethylsulfonyl fluoride, and 10 µM trans-epoxylsuccinyl-L-leucylamido-(4-guanidino)butane (E-64) for 30 min at 4°C. The extracts were then cleared by centrifugation for 30 min at 15,000 g. Whole cell extracts and nuclear extracts were separated on a 6% polyacrylamide gel containing SDS and were transferred to a nitrocellulose membrane. The membrane was incubated for 1 h at room temperature with 1:2,000 dilution of the TonEBP antiserum (20) in 20 mM Tris · HCl (pH 7.6), 150 mM NaCl, 0.1% (vol/vol) Tween 20, and 5% (wt/vol) nonfat milk. The membrane was then incubated in the same way with anti-rabbit IgG conjugated with alkaline phosphatase (Jackson ImmunoResearch Laboratory). Alkaline phosphatase was visualized using a commercial kit (Sigma).

Immunohistochemistry. MDCK cells grown on glass coverslips were fixed for 15 min in 3.7% Formalin in PBS. After fixation, the cells were permeabilized in 0.5% Triton X-100 in Tris-buffered saline (TBS) for 15 min. The TonEBP antiserum (20) was diluted 1:400 in PBS, whereas the p65 antibody (rabbit polyclonal IgG; Santa Cruz) was diluted to 1 µg/ml in PBS containing 3% BSA and was incubated on the coverslips for 30 min at 37°C. The coverslips were washed three times in PBS and incubated as above in a 1:400 dilution of rhodamine-conjugated goat anti-rabbit IgG (Zymed). Finally, the coverslips were washed three times with PBS and mounted on slides for observation.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Inhibitors of proteasome activity prevent induction of BGT1 and SMIT mRNA in response to hypertonicity. When MDCK cells are cultured in hypertonic medium, the abundance of BGT1 and SMIT mRNA increases, as shown in Fig. 1, lanes 1 and 2. This increase in mRNA abundance is due to an increase in transcription of the BGT1 and SMIT genes in response to hypertonicity (27, 32). To test if any of the cellular proteases is involved in the stimulation of transcription by hypertonicity, we examined the effects of a variety of protease inhibitors on mRNA abundance (Fig. 1). MG-132, a potent inhibitor of proteasome activity, dramatically reduced the increase in mRNA abundance for both BGT1 and SMIT in response to hypertonicity (see also Fig. 2). TPCK, an inhibitor of serine and cysteine proteases, moderately reduced the BGT1 and SMIT mRNA abundance. The effects of TPCK may not be related to inhibition of serine and cysteine proteases because other inhibitors of serine and cysteine proteases such as TLCK and leupeptin had no effect, even at high concentrations (50 µM). Likewise, inhibitors of cysteine proteases (E-64) and metalloproteases (o-phenanthroline) did not affect mRNA abundance. None of the inhibitors affected the abundance of beta -actin mRNA under isotonic or hypertonic conditions (data not shown), indicating that the effects of MG-132 are specific for BGT1 and SMIT mRNA.


View larger version (73K):
[in this window]
[in a new window]
 
Fig. 1.   Effects of protease inhibitors on the abundance of sodium-chloride-betaine cotransporter (BGT1) and sodium-myo-inositol cotransporter (SMIT) mRNA. Confluent Madin-Darby canine kidney (MDCK) cells were incubated for 18 h in isotonic or hypertonic medium with inhibitors or vehicle alone (0.5% DMSO) as described in MATERIALS AND METHODS. Concentrations of inhibitors were as follows: 50 µM trans-epoxylsucci-nyl-L-leucylamido-(4-guanidino)butane (E-64), 50 µM leupeptin, 50 µM o-phenanthroline, 50 µM Nalpha -p-tosyl-L-lysine chloromethyl ketone (TLCK), 10 µM N-tosyl-L-phenylalanine chloromethyl ketone (TPCK), and 1 µM MG-132. RNA was isolated and analyzed by Northern blot hybridization with 32P-labeled BGT1 and SMIT cDNA probes. Radioactive bands representing BGT1 (top) and SMIT (middle) mRNA are shown. Ethidium bromide stain of the 18S RNA band is shown at bottom to demonstrate the quantity of RNA loaded. I and H indicate samples prepared from isotonic and hypertonic medium, respectively.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of proteasome inhibitors on the abundance of BGT1 and SMIT mRNA. Confluent MDCK cells were treated with proteasome inhibitors using the same protocol described in Fig. 1. Proteasome inhibitors used were MG-132 (A), MG-115 (B), and clasto-lactacystin beta -lactone (lactacystin beta -lactone; C) at concentrations indicated. Bands representing the BGT1 and SMIT mRNA and the 18S rRNA are shown. D: experiments in A with 1 µM MG-132 were repeated on 5 different preparations of MDCK cells, and the abundance of BGT1 (open bars) and SMIT (filled bars) mRNA was quantified and expressed relative to that of isotonic control cells. Data are means ± SD. All of the values in MG-132 are significantly lower than the corresponding control values (DMSO; P < 0.05, paired t-test).

The effects of MG-132 were nearly maximal at the relatively low concentration of 1 µM (Fig. 2A), supporting the idea that the effects were due to specific inhibition of proteasome activity. In isotonic conditions, 1 µM MG-132 lowered the abundance of BGT1 mRNA to 0.6-fold control (P < 0.05) and SMIT mRNA to 0.4-fold control (P < 0.001; Fig. 2D). Induction of mRNA abundance in response to hypertonicity (the abundance in hypertonicity divided by the abundance in isotonicity) was also reduced by 1 µM MG-132 as follows: for BGT1 mRNA, in MG-132-treated hypertonic cells 3.7-fold that of isotonic cells in MG-132 compared with 13.5-fold in DMSO-treated cells (P < 0.05); for SMIT mRNA, 2.0-fold compared with 6.8-fold (P < 0.05; Fig. 2D). Other inhibitors of proteasome activity, MG-115 (Fig. 2B) and clasto-lactacystin beta -lactone (Fig. 2C), also reduced the hypertonicity-induced increase in mRNA abundance and the mRNA abundance in isotonic cells. Thus the proteolytic activity of the proteasome is required for the induction of the BGT1 and SMIT mRNA by hypertonicity and maintenance of their expression in isotonic conditions.

To inhibit the activity of the proteasome without using the inhibitors, we attempted to use a temperature-sensitive mutant cell line in which ubiquitination and proteasome-mediated proteolysis can be blocked in a nonpermissive temperature (39°C) due to inactivation of the ubiquitin-activating enzyme, E1 (7). Unfortunately, we could not use these cells because they do not survive the combination of high temperature and hypertonicity for more than several hours (not shown).

MG-132 treatment inhibits transcription driven by TonE. Because TonE mediates the stimulation of transcription of the BGT1 (19, 25) and SMIT (21) genes in response to hypertonicity, we tested whether TonE-driven transcription is affected by inhibition of proteasome activity. Two different luciferase reporter constructs were used (Fig. 3). In the BGT1 construct (25), the luciferase gene is under the control of two TonEs and the promoter of the BGT1 gene, whereas in the 2× hTonE construct (19) the luciferase gene is controlled by two tandem copies of hTonE and the SV40 promoter. As expected, expression of luciferase increased 8.3- and 16.5-fold in response to hypertonicity in MDCK cells transfected with the BGT1 and 2× hTonE constructs, respectively. When the transfected cells were treated with 1 µM MG-132, the stimulation of luciferase by hypertonicity fell to 2.4-fold (P < 0.05) and 3.3-fold (P < 0.01), respectively. In contrast, expression of luciferase was not influenced by treatment with MG-132 in cells cultured in isotonic medium (not shown). These data support the idea that the blunted induction of BGT1 and SMIT mRNA in the presence of the proteasome inhibitors (Fig. 2) is due to inhibition of TonE-driven transcription.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of MG-132 on expression of the luciferase controlled by tonicity-responsive enhancer (TonE). MDCK cells were transfected with either of the Photinus luciferase expression constructs in which the luciferase gene is under the control of the promoter and TonEs of the BGT1 gene (25) or the SV40 promoter and 2 copies of hTonE (19), which is a TonE from an unknown human gene (2× hTonE). The transfected cells were treated without (open bars) or with (filled bars) 1 µM MG-132 under isotonic and hypertonic conditions exactly as described in Fig. 2. Activity of the expressed Photonius luciferase was corrected for transfection efficiency and standardized in reference to a control promoter (beta -actin) as detailed in MATERIALS AND METHODS. The degree of induction of luciferase in response to hypertonicity was calculated by dividing activity of the Photinus luciferase from hypertonic cells by activity of the Photinus luciferase from isotonic cells. Broken line denotes degree of induction of 1 (no induction). Data are means ± SD (n = 3). Values of filled bars were lower than open bars (P < 0.05 for BGT1 and P < 0.01 for 2× hTonE, paired t-test).

MG-132 treatment does not affect the abundance of TonEBP. We have recently shown that stimulation of TonEBP is the key event in TonE-mediated stimulation of transcription (19, 20). Activation of TonEBP in response to hypertonicity occurs via a combination of an increase in TonEBP abundance and an increase in nuclear distribution of TonEBP (20). First, to investigate the effect of proteasome inhibition on TonEBP abundance, Northern blot and Western blot analyses were performed using whole cell extracts. Figure 4, A and B, shows representative results of three independent experiments. In control cells (DMSO), the abundance of TonEBP mRNA increased threefold when they were switched to hypertonic medium for 18 h. Likewise, the abundance of TonEBP increased fourfold, as reported earlier (20). Treatment with MG-132 did not have any effect on the abundance of mRNA and protein. Thus, at the whole cell level, MG-132 treatment does not change the TonEBP abundance of MDCK cells cultured in isotonic and hypertonic medium.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of MG-132 on stimulation of TonE binding protein (TonEBP) in response to hypertonicity. MDCK cells were treated without (DMSO) or with 1 µM MG-132 in isotonic or hypertonic medium as in Fig. 2A. RNA was isolated and analyzed by Northern blot hybridization with TonEBP cDNA. Bands of TonEBP mRNA are shown. TonEBP in whole cells extracts (B) and nuclear extracts (C) was visualized by Western blot analysis using TonEBP antiserum (20). D: electrophoretic mobility shift assay was performed to detect TonEBP in the nuclear extracts. Arrows, double bands representing TonEBP; *, free probe. E: radioactivity of the TonEBP bands in D was quantified from MDCK cells treated without (open bars) or with (filled bars) 1 µM MG-132. Activity is expressed relative to the activity of the isotonic control cells. Data are means ± SD (n = 3). Values of the filled bars are significantly different from open bars (P < 0.05, paired t-test).

MG-132 treatment inhibits hypertonicity-induced nuclear distribution of TonEBP. Next, nuclear extracts were analyzed using Western blot analysis (Fig. 4C). In cells cultured in isotonic medium, MG-132 treatment increased the TonEBP abundance in the nucleus slightly. On the other hand, in cells cultured in hypertonic medium, MG-132 treatment resulted in a reduction of the TonEBP abundance in the nucleus. Semiquantitative Western analysis of four independent sets of samples in which serially diluted control samples were compared with MG-132-treated samples consistently showed that the abundance of the nuclear TonEBP is cut in half in cells treated with MG-132 under hypertonic conditions (not shown).

Similar results were obtained when TonEBP was measured using electrophoretic mobility shift assay (Fig. 4, D and E). In cells cultured in isotonic medium, MG-132 treatment increased the TonEBP abundance in the nucleus by 28% (P < 0.05). On the other hand, in cells cultured in hypertonic medium, the activity of TonEBP was 44% lower in nuclei of cells treated with MG-132 (P < 0.01). Thus the activity of TonE binding in the nucleus decreases pari passu with the amount of TonEBP (Fig. 4C) when MDCK cells are treated with MG-132 in hypertonic medium.

Decreased abundance of TonEBP in the nucleus despite no change at the whole cell level by treatment with MG-132 suggests that MG-132 may block the nuclear distribution of TonEBP in response to hypertonicity. To explore the subcellular distribution of TonEBP, we performed immunohistochemical staining of MDCK cells using TonEBP antiserum (20). In isotonic medium, MG-132 treatment tends to increase nuclear TonEBP (Fig. 5A), in keeping with the results from Western analysis (Fig. 4C) and electrophoretic mobility shift assay (Fig. 4D). On the other hand, in hypertonic medium, MG-132 treatment decreased the staining in the nucleus while substantially increasing the staining in the cytoplasm. Combined with the results in Fig. 4, these data demonstrate that inhibition of proteasome activity attenuates the redistribution of TonEBP into the nucleus in response to hypertonicity without affecting the induction of TonEBP. The reduced appearance of TonEBP in the nucleus should contribute to the reduced TonE-mediated transcription in cells treated with MG-132 (Fig. 3).



View larger version (6470K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of MG-132 on nuclear redistribution of TonEBP and nuclear factor (NF)-kappa B. MDCK cells were grown on glass coverslips and were treated with 1 µM MG-132 before treatment with hypertonicity as in Fig. 1 (A) or 20 ng/ml of TNF-alpha (B). Cells were peameabilized and stained with an antibody to TonEBP or an antibody to the p65 subunit of NF-kappa B, as indicated at bottom. Antibody binding was visualized using secondary antibody labeled with rhodamine.

The role of the proteasome is different in nuclear distribution of TonEBP and NF-kappa B. Proteasome activity is also required for nuclear translocation of the transcription factor NF-kappa B (reviewed in Ref. 16). In the basal state, NF-kappa B is sequestered in the cytoplasm (see below) through its association with an inhibitory subunit, Ikappa B. Activation of receptors for proinflammatory cytokines such as TNF-alpha and interleukin-1 results in phosphorylation and subsequent proteolytic degradation of Ikappa B by the proteasome. Once released from Ikappa B, NF-kappa B moves to the nucleus and stimulates transcription of specific genes. We asked the question whether the same mechanism is responsible for activation of TonEBP and NF-kappa B. To investigate the similarity between TonEBP and NF-kappa B, we performed immunohistochemical analysis of TonEBP and NF-kappa B under the same sets of conditions. When MDCK cells were cultured in hypertonic medium, the distribution of NF-kappa B was not changed, whereas TonEBP was redistributed into the nucleus slowly over several hours (Fig. 5A), as reported previously (20). On the other hand, treatment with TNF-alpha induced nuclear translocation of NF-kappa B in 30 min in a proteasome-dependent manner, i.e., sensitive to MG-132, but did not affect TonEBP at all (Fig. 5B). These data indicate that the underlying mechanisms are different for nuclear redistribution of TonEBP and NF-kappa B even though both processes are sensitive to inhibition of proteasome activity.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The long-term goal of this laboratory is to understand the signaling pathways for the induction of transcription by hypertonicity. This regulation is critical in the adaptation to hypertonic conditions. The data presented here demonstrate that the proteolytic activity of the proteasome plays an important role in the transcriptional induction of BGT1 and SMIT mRNA in response to hypertonicity. The proteasome is required for nuclear distribution of TonEBP, a key transcription factor regulating the BGT1 and SMIT genes. Inhibitors of the proteasome are the first reagents known to specifically interfere with the regulation of TonEBP by hypertonicity.

The effects of the inhibitors of proteasome activity differ in isotonic versus hypertonic conditions. In isotonic conditions, inhibition of proteasome leads to a reduction in the abundance of BGT1 and SMIT mRNA even though the apparent abundance of TonEBP in the nucleus is slightly increased without changing TonE-driven transcription. On the other hand, in hypertonic conditions, the abundance of TonEBP in the nucleus is decreased in correlation with decreased TonE-driven transcription of a reporter gene and decreased induction of BGT1 and SMIT mRNA. As the abundance of TonEBP in the nucleus determines the interaction of TonEBP and TonEs in the 5' flanking regions of the tonicity-responsive genes and subsequent TonE-driven transcription (19, 20), the decreased induction of BGT1 and SMIT mRNA in hypertonic cells treated with MG-132 (Figs. 1 and 2) is most likely caused by the decreased abundance of TonEBP in the nucleus (Figs. 4 and 5).

Although the nuclear abundance of TonEBP is reduced barely 50% by MG-132 treatment in hypertonic cells (Fig. 4), induction of mRNA for BGT1 and SMIT (Fig. 2) and induction of TonE-driven luciferase (Fig. 3) are decreased much more than 50%. Two explanations can be offered. First, the SMIT (21) and BGT1 (unpublished observation) promoters are regulated by multiple upstream TonEs. Because multiple TonEs function in synergy (19, 21), transcriptional regulation is not a linear function of the abundance of TonEBP. Second, proteasome activity may affect other processes such as mRNA stability. This might explain the decrease in the abundance of BGT1 and SMIT mRNA in isotonic conditions (Fig. 2D) even though TonE-mediated luciferase expression is not affected.

Unlike NF-kappa B in the basal state, TonEBP distributes in the nucleus as well as in the cytoplasm in isotonic conditions. Thus TonEBP is active in isotonic cells, and a substantial amount is found in the nucleus. In hypertonic conditions, the nuclear-to-cytoplasmic ratio of TonEBP clearly increases "redistribution" of TonEBP. Inhibition of the proteolytic activity of proteasome selectively reduces the proportion of TonEBP in the nucleus only in hypertonic conditions. It is difficult to speculate on the target or substrate of proteasome activity in hypertonic cells that increases nuclear distribution of TonEBP when the target is proteolytically degraded. We speculate that this target protein might function to retain TonEBP in the cytoplasm. Ikappa B is not this target because NF-kappa B is not regulated by hypertonicity, and, conversely, TonEBP is not regulated by TNF-alpha (see RESULTS). The identification of the target protein would provide an important clue to the hypertonicity signaling pathways that have eluded identification thus far.


    ACKNOWLEDGEMENTS

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-44484 and DK-42479.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: H. M. Kwon, 963 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205 (E-mail: mkwon{at}jhmi.edu).

Received 12 August 1999; accepted in final form 22 September 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Al-Moshilih, H. I., and G. R. Dubes. The kinetics of DEAE-dextran-induced cell sensitization to transfection. J. Gen. Virol. 18: 189-193, 1973[Abstract/Free Full Text].

2.   Chen, E., R. Hrdlickova, J. Nehyba, D. L. Longo, H. R. Bose, and C. C. H. Li. Degradation of proto-oncoprotein c-Rel by the ubiquitin-proteasome pathway. J. Biol. Chem. 273: 35201-35207, 1998[Abstract/Free Full Text].

3.   Denkert, C., U. Warskulat, F. Hensel, and D. Häussinger. Osmolyte strategy in human monocytes and macrophages: involvement of p38MAPK in hyperosmotic induction of betaine and myoinositol transporters. Arch. Biochem. Biophys. 354: 172-180, 1998[Web of Science][Medline].

4.   Dick, L. R., A. A. Cruikshank, L. Grenier, F. D. Melandri, S. Nunes, and R. L. Stein. Mechanistic studies on the inactivation of the proteasome by lactacystin: a central role for clasto-lactacystin beta-lactone. J. Biol. Chem. 271: 7273-7276, 1996[Abstract/Free Full Text].

5.   Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11: 1475-1489, 1983[Abstract/Free Full Text].

6.   Fenteany, G., R. F. Standaert, W. S. Lane, S. Choi, E. J. Corey, and S. L. Schreiber. Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin. Science 268: 726-731, 1995[Abstract/Free Full Text].

7.   Finley, D., A. Ciechanover, and A. Varshavsky. Thermolability of ubiquitin-activating enzyme from the mammalian cell cycle mutant ts85. Cell 37: 43-55, 1984[Web of Science][Medline].

8.   Garcia-Perez, A., and M. B. Burg. Renal medullary organic osmolytes. Physiol. Rev. 71: 1081-1115, 1991[Abstract/Free Full Text].

9.   Hershko, A., and A. Ciechanover. The ubiquitin system. Annu. Rev. Biochem. 67: 425-479, 1998[Web of Science][Medline].

10.   Ibsen, L., and K. Strange. In situ localization and osmotic regulation of the Na+-myo-inositol cotransporter in rat brain. Am. J. Physiol. Renal Fluid Electrolyte Physiol. 271: F877-F885, 1996[Abstract/Free Full Text].

11.   Kitamura, H., A. Yamauchi, T. Nakanishi, Y. Takamitsu, T. Sugiura, A. Akagi, T. Moriyama, M. Horio, and E. Imai. Effects of inhibition of myo-inositol transport on MDCK cells under hypertonic environment. Am. J. Physiol. Renal Physiol. 272: F267-F272, 1997[Abstract/Free Full Text].

12.   Kitamura, H., A. Yamauchi, T. Sugiura, Y. Matsuoka, M. Horio, M. Tohyma, S. Shimada, E. Imai, and M. Hori. Inhibition of myo-inositol transport causes acute renal failure with selective medullary injury in the rat. Kidney Int. 53: 146-153, 1998[Web of Science][Medline].

13.   Ko, B. C. B., B. Ruepp, K. M. Bohren, K. H. Gabbay, and S. S. M. Chung. Identification and characterization of multiple osmotic response sequences in the human aldose reductase gene. J. Biol. Chem. 272: 16431-16437, 1997[Abstract/Free Full Text].

14.   Koepp, D. M., J. W. Harper, and S. J. Elledge. How the cyclin became a cyclin: regulated proteolysis in the cell cycle. Cell 97: 431-434, 1999[Web of Science][Medline].

15.   Kwon, H. M., A. Yamauchi, S. Uchida, S. A. Preston, A. Garcia-Perez, M. B. Burg, and J. S. Handler. Cloning of the cDNA for a Na+/myo-inositol cotransporter, a hypertonicity stress protein. J. Biol. Chem. 267: 6297-6301, 1992[Abstract/Free Full Text].

16.   Laney, J. D., and M. Hochstrasser. Substrate targeting in the ubiquitin system. Cell 97: 427-430, 1999[Web of Science][Medline].

17.   Maxwell, P. H., M. S. Wiesener, G. W. Chang, S. C. Clifford, E. C. Vaux, M. E. Cockman, C. C. Wykoff, C. W. Pugh, E. R. Maher, and P. J. Ratcliffe. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399: 271-275, 1999[Medline].

18.   Minami, Y., K. Inoue, S. Shimada, H. Mormura, A. Miyai, A. Yamauchi, T. Matsunaga, and M. Tohyama. Rapid and transient up-regulation of Na+/myo-inositol cotransporter transcription in the brain of acute hypernatremic rats. Mol. Brain Res. 40: 64-70, 1996[Medline].

19.   Miyakawa, H., S. K. Woo, C. P. Chen, S. C. Dahl, J. S. Handler, and H. M. Kwon. Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity. Am. J. Physiol. Renal Physiol. 274: F753-F761, 1998[Abstract/Free Full Text].

20.   Miyakawa, H., S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon. Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity. Proc. Natl. Acad. Sci. USA 96: 2538-2542, 1999[Abstract/Free Full Text].

21.   Rim, J. S., M. G. Atta, S. C. Dahl, G. T. Berry, J. S. Handler, and H. M. Kwon. Transcription of the sodium/myo-inositol cotransporter gene is regulated by multiple tonicity-responsive enhancers spread over 50 kilobase pairs in the 5'-flanking region. J. Biol. Chem. 273: 20615-20621, 1998[Abstract/Free Full Text].

22.   Rock, K. L., and A. L. Goldberg. Degradation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol. 17: 739-779, 1999[Web of Science][Medline].

23.   Rock, K. L., C. Gramm, L. Rothstein, K. Clark, D. Hwang, and A. L. Goldberg. Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78: 761-771, 1994[Web of Science][Medline].

24.   Smardo, F. L., Jr., M. B. Burg, and A. Garcia-Perez. Kidney aldose reductase gene transcription is osmotically regulated. Am. J. Physiol. Cell Physiol. 262: C776-C782, 1992[Abstract/Free Full Text].

25.   Takenaka, M., A. S. Preston, H. M. Kwon, and J. S. Handler. The tonicity-sensitive element that mediates increased transcription of the betaine transporter gene in response to hypertonic stress. J. Biol. Chem. 269: 29379-29381, 1994[Abstract/Free Full Text].

26.   Uchida, S., T. Nakanishi, H. M. Kwon, A. S. Preston, and J. S. Handler. Taurine behaves as an osmolyte in Madin-Darby canine kidney cells. Protection by polarized, regulated transport of taurine. J. Clin. Invest. 88: 656-662, 1991.

27.   Uchida, S., A. Yamauchi, A. S. Preston, H. M. Kwon, and J. S. Handler. Medium tonicity regulates expression of the Na+- and Cl--dependent betaine transporter in Madin-Darby canine kidney cells by increasing transcription of the transporter gene. J. Clin. Invest. 91: 1604-1607, 1993.

28.   Warskulat, U., F. Zhang, and D. Häussinger. Modulation of phagocytosis by anisoosmolarity and betaine in rat liver macrophages and RAW 264.7 mouse macrophages. FEBS Lett. 391: 287-292, 1996[Web of Science][Medline].

29.   Warskulat, U., F. Zhang, and D. Häussinger. Taurine is an osmolyte in rat liver macrophages. J. Hepatol. 26: 1340-1347, 1997[Web of Science][Medline].

30.   Weik, C., U. Warskulat, J. Bode, T. Peters-Regehr, and D. Häussinger. Compatible organic osmolytes in rat liver sinusoidal endothelial cells. Hepatology 27: 569-575, 1998[Web of Science][Medline].

31.   Yamauchi, A., S. Uchida, H. M. Kwon, A. S. Preston, R. B. Robey, A. Garcia-Perez, M. B. Burg, and J. S. Handler. Cloning of a Na+- and Cl--dependent betaine transporter that is regulated by hypertonicity. J. Biol. Chem. 267: 649-652, 1992[Abstract/Free Full Text].

32.   Yamauchi, A., S. Uchida, A. S. Preston, H. M. Kwon, and J. S. Handler. Hypertonicity stimulates transcription of gene for Na+-myo-inositol cotransporter in MDCK cells. Am. J. Phsiol. Renal Fluid Electrolyte Physiol. 264: F20-F23, 1993.

33.   Yancey, P. H., M. E. Clark, S. C. Hand, R. D. Bowlus, and G. N. Somero. Living with water stress: evolution of osmolyte systems. Science 217: 1214-1222, 1982[Abstract/Free Full Text].


Am J Physiol Cell Physiol 278(2):C323-C330
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Kuper, D. Steinert, M.-L. Fraek, F.-X. Beck, and W. Neuhofer
EGF receptor signaling is involved in expression of osmoprotective TonEBP target gene aldose reductase under hypertonic conditions
Am J Physiol Renal Physiol, May 1, 2009; 296(5): F1100 - F1108.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. Bissonnette, K. Lahjouji, M. J. Coady, and J.-Y. Lapointe
Effects of hyperosmolarity on the Na+-myo-inositol cotransporter SMIT2 stably transfected in the Madin-Darby canine kidney cell line
Am J Physiol Cell Physiol, September 1, 2008; 295(3): C791 - C799.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva
Cellular Response to Hyperosmotic Stresses
Physiol Rev, October 1, 2007; 87(4): 1441 - 1474.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. S. O'Connor, S. T. Mills, K. A. Jones, S. N. Ho, and G. K. Pavlath
A combinatorial role for NFAT5 in both myoblast migration and differentiation during skeletal muscle myogenesis
J. Cell Sci., January 1, 2007; 120(1): 149 - 159.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Z. Zhang, J. D. Ferraris, C. E. Irarrazabal, N. I. Dmitrieva, J.-H. Park, and M. B. Burg
Ataxia telangiectasia-mutated, a DNA damage-inducible kinase, contributes to high NaCl-induced nuclear localization of transcription factor TonEBP/OREBP
Am J Physiol Renal Physiol, September 1, 2005; 289(3): F506 - F511.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
W. Neuhofer, M. Vastag, M.-L. Fraek, and F.-X Beck
Effect of ammonium on the expression of osmosensitive genes in Madin-Darby canine kidney cells
J. Physiol., March 1, 2005; 563(2): 497 - 505.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
K.-H. Han, S. K. Woo, W.-Y. Kim, S.-H. Park, J.-H. Cha, J. Kim, and H. M. Kwon
Maturation of TonEBP expression in developing rat kidney
Am J Physiol Renal Physiol, November 1, 2004; 287(5): F878 - F885.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. D. Lee, E. Colla, M. R. Sheen, K. Y. Na, and H. M. Kwon
Multiple Domains of TonEBP Cooperate to Stimulate Transcription in Response to Hypertonicity
J. Biol. Chem., November 28, 2003; 278(48): 47571 - 47577.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Z. H. Nemeth, E. A. Deitch, C. Szabo, and G. Hasko
Hyperosmotic Stress Induces Nuclear Factor-{kappa}B Activation and Interleukin-8 Production in Human Intestinal Epithelial Cells
Am. J. Pathol., September 1, 2002; 161(3): 987 - 996.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
W. Neuhofer, H. Bartels, M.-L Fraek, and F.-X Beck
Relationship between intracellular ionic strength and expression of tonicity-responsive genes in rat papillary collecting duct cells
J. Physiol., August 15, 2002; 543(1): 147 - 153.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. H. CHA, S. K. WOO, K. H. HAN, Y. H. KIM, J. S. HANDLER, J. KIM, and H. M. KWON
Hydration Status Affects Nuclear Distribution of Transcription Factor Tonicity Responsive Enhancer Binding Protein in Rat Kidney
J. Am. Soc. Nephrol., November 1, 2001; 12(11): 2221 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Matsuzaki, T. Suzuki, and K. Takata
Hypertonicity-induced expression of aquaporin 3 in MDCK cells
Am J Physiol Cell Physiol, July 1, 2001; 281(1): C55 - C63.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. Franchi-Gazzola, R. Visigalli, V. Dall'Asta, R. Sala, S. K. Woo, H. M. Kwon, G. C. Gazzola, and O. Bussolati
Amino acid depletion activates TonEBP and sodium-coupled inositol transport
Am J Physiol Cell Physiol, June 1, 2001; 280(6): C1465 - C1474.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
W. Tian and D. M. Cohen
Urea inhibits hypertonicity-inducible TonEBP expression and action
Am J Physiol Renal Physiol, May 1, 2001; 280(5): F904 - F912.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Leitch, P. Agre, and L. S. King
Altered ubiquitination and stability of aquaporin-1 in hypertonic stress
PNAS, February 27, 2001; 98(5): 2894 - 2898.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon
Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity
Am J Physiol Renal Physiol, June 1, 2000; 278(6): F1006 - F1012.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Nakayama, T. Peng, J. M. Sands, and S. M. Bagnasco
The TonE/TonEBP Pathway Mediates Tonicity-responsive Regulation of UT-A Urea Transporter Expression
J. Biol. Chem., December 1, 2000; 275(49): 38275 - 38280.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. D. Ferraris, C. K. Williams, P. Persaud, Z. Zhang, Y. Chen, and M. B. Burg
Activity of the TonEBP/OREBP transactivation domain varies directly with extracellular NaCl concentration
PNAS, January 22, 2002; 99(2): 739 - 744.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
H. Zhao, W. Tian, and D. M. Cohen
Rottlerin inhibits tonicity-dependent expression and action of TonEBP in a PKCdelta -independent fashion
Am J Physiol Renal Physiol, April 1, 2002; 282(4): F710 - F717.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (36)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Woo, S. K.
Right arrow Articles by Kwon, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woo, S. K.
Right arrow Articles by Kwon, H. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online