|
|
||||||||
Division of Nephrology, School of Medicine, The Johns Hopkins University, Baltimore, Maryland 21205
| |
ABSTRACT |
|---|
|
|
|---|
Tonicity-responsive enhancer binding
protein (TonEBP) is the transcription factor that regulates
tonicity-responsive expression of the genes for the
sodium-myo-inositol cotransporter
(SMIT) and the sodium-chloride-betaine cotransporter (BGT1).
Hypertonicity stimulates the activity of TonEBP due to a combination of
increased protein abundance and increased nuclear distribution
(proportion of TonEBP that is in the nucleus). We found that inhibitors
of proteasome activity markedly reduce the induction of SMIT and BGT1
mRNA in response to hypertonicity. These inhibitors also reduce
hypertonicity-induced stimulation of expression of a reporter gene
controlled by the tonicity-responsive enhancer. Western and immunohistochemical analyses revealed that the proteasome inhibitors reduce the hypertonicity-induced increase of TonEBP in the nucleus by
inhibiting its nuclear redistribution without affecting its abundance.
Although the nuclear distribution of TonEBP is sensitive to inhibition
of proteasome activity as is that of nuclear factor (NF)-
B, the
signaling pathways appear to be different in that hypertonicity does
not affect the nuclear distribution of NF-
B. Conversely, treatment
with tumor necrosis factor-
increases the nuclear distribution of
NF-
B but not TonEBP.
hypertonicity-stimulated transcription; sodium-myo-inositol cotransporter; sodium-chloride-betaine cotransporter
| |
INTRODUCTION |
|---|
|
|
|---|
WHEN EXPOSED TO A hypertonic solution, cells shrink, and their cellular ionic strength is increased due to osmotic water loss. Cells survive the stress of hypertonicity by lowering cellular ionic strength toward the isotonic level. This is achieved by replacement of the increased ionic strength, which perturbs protein function, with small organic solutes that are nonperturbing or compatible osmolytes (33). The medulla of mammalian kidney is hypertonic under physiological conditions due to the operation of the urinary concentrating mechanism. The major compatible osmolytes accumulated by cells in the medulla are myo-inositol, betaine, and sorbitol (8). The osmoprotective accumulation of most compatible osmolytes is driven by hypertonicity-induced stimulation of specific sodium-coupled transporters [the sodium-chloride-betaine cotransporter (BGT1; see Ref. 27) and the sodium-myo-inositol cotransporter (SMIT; see Ref. 32)] and by the enzyme aldose reductase (AR), which catalyzes synthesis of sorbitol from D-glucose (24). Certain diseases such as diabetes insipidus and some instances of diabetes mellitus cause hypernatremia that results in systemic hypertonicity. Under these conditions, nonrenal tissues such as brain (10, 18), endothelium (30), and monocytes and macrophages (3) accumulate compatible osmolytes using the same mechanisms used by the kidney medulla. If the accumulation of compatible osmolytes is blocked under hypertonic conditions by inhibiting the enzymes and transporters catalyzing the accumulation, cells do not grow (26) and die via necrosis (11, 12). When liver macrophages (Kupffer cells) are exposed to hypertonicity, cellular accumulation of compatible osmolytes restores their phagocytic activity (28) and modulates the production of PGE2 (29). Thus compatible osmolytes are important agents in protection from the stresses imposed by a hypertonic environment.
Recent studies show that hypertonicity-induced stimulation of BGT1 (19, 25), SMIT (21), and AR (13) occurs at the level of transcription and involves a common regulatory sequence element, tonicity-responsive enhancer (TonE). TonE has a consensus sequence of TGGAAANNYNY (Y is T or C; N is A, G, C, or T) (21) and serves as a specific binding site for the transcription factor, TonE binding protein (TonEBP; see Ref. 19). Cloning of TonEBP reveals that it is a novel Rel-like DNA binding protein (20). When cells are exposed to hypertonicity, activity of TonEBP is markedly stimulated in the nucleus due to a combination of an increase in TonEBP abundance and an increase in nuclear distribution (20). Activated TonEBP binds to the TonE sites located upstream of the genes and stimulates transcription (19, 21). Thus activation of TonEBP is the key event in activation of transcription by hypertonicity.
The ubiquitin-dependent proteolytic system is an important
intracellular pathway for selective protein breakdown (9) related to a
variety of cellular functions such as cell cycle regulation (14) and
antigen presentation (22). Target proteins are covalently modified by
conjugation with ubiquitin, and the ubiquitinated proteins are
recognized and degraded by the 26S proteasome complex. Proteasome
activity is essential for normal regulation of the activity of certain
transcription factors such as nuclear factor (NF)-
B (2) and
hypoxia-inducible factor-1
(17). The availability of
potent and specific proteasome protease inhibitors such as MG-132,
MG-115, lactacystin, and
clasto-lactacystin
-lactone (4, 6,
23) facilitates studies of the role of the proteasome in
transcriptional regulation. We report here that proteasome inhibitors
prevent the transcriptional response to hypertonicity at the nuclear
redistribution step.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture. Madin-Darby canine
kidney (MDCK) cells were grown to confluence in defined medium as
described previously (26, 32). To examine the effect of a reagent,
cells were initially incubated with the reagent in isotonic medium for
30 min before incubation with the same reagent for 18 h in isotonic or
hypertonic medium or with addition of tumor necrosis factor-
(TNF-
; see Fig. 5). Each inhibitor was dissolved in DMSO or ethanol
[N
-p-tosyl-L-lysine chloromethyl ketone (TLCK) and
N-tosyl-L-phenylalanine
chloromethyl ketone (TPCK)], and an appropriate volume of this
solution was added to the medium. The same volume of solvent was added
to the medium of controls. The final concentration of DMSO or ethanol in the medium was <0.5%. MG-132, MG-115, and
clasto-lactacystin
-lactone were
obtained from Calbiochem. Other protease inhibitors were purchased from
Sigma. Hypertonic medium was made by adding 200 mM raffinose.
Northern blot analysis. RNA was isolated using Trizol reagent (GIBCO-BRL). RNA (5 µg) was size-fractionated on a 1% agarose gel containing 2.2 M formaldehyde and was transferred to a nitrocellulose membrane. Membranes were hybridized overnight with radiolabeled BGT1 (31), SMIT (15), or TonEBP cDNA. Canine TonEBP cDNA corresponding to nucleotides 730-2187 of the human TonEBP (20) was obtained using RT-PCR. The canine cDNA shares 96% of nucleotides with the human cDNA. After washing under stringent conditions (65°C in 75 mM NaCl and 7.5 mM sodium citrate with 0.1% SDS), radioactivity was visualized and quantified using a Phosphorimager (Molecular Dynamics).
Transfection. The day before
transfection, MDCK cells were seeded at a density of 2 × 105 cells per 35-mm tissue culture
dish. They were transfected using DEAE-dextran as described (1). Each
dish received one of the following constructs in which the
Photinus luciferase gene is under the control of
1) a 426-bp genomic DNA fragment
containing the promoter and TonEs of the BGT1 gene ["BGT1"
construct (25), 2 µg/dish],
2) the SV40 promoter under the
control of two copies of hTonE ["2× hTonE" construct
(19), 2 µg/dish], or 3) the
promoter of the
-actin gene ["
-actin" construct (25),
50 ng/dish]. pCMV-Renilla (50 ng; Promega) containing the
Renilla luciferase gene under control of the promoter of
cytomegalovirus was added with every Photinus construct to
measure efficiency of transfection. Twenty-four hours after
transfection, cells were incubated initially with a given inhibitor for
30 min in isotonic medium and then with the same inhibitor for 18 h in
isotonic or hypertonic medium. The activity of Photinus and
Renilla luciferase in extracts of the transfected cells was
determined using a commercial kit, Dual-Luciferase Reporter Assay
System (Promega). For each extract, activity of the Photinus
luciferase was divided by the activity of the Renilla luciferase to correct for transfection efficiency. Under each tonicity
condition, i.e., isotonic or hypertonic, the corrected activity of the
Photinus luciferase from cells transfected with the BGT1 or
2× hTonE construct was again divided by that from cells
transfected with the
-actin construct, as described previously (25).
The resulting luciferase activity standardized for the
-actin
promoter was used to calculate the degree of induction of luciferase by
hypertonicity by dividing the activity of luciferase in hypertonic
medium by the activity of luciferase in isotonic medium. Each
experiment (n = 1) was performed in
duplicate dishes.
Electrophoretic mobility shift assay.
Nuclear extracts were prepared from confluent MDCK cells as described
(5) and dialyzed against 20 mM Tris · HCl buffer (pH
7.8) containing 5 mM MgCl2, 1 mM
DTT, 1 mM EDTA, and 20% (vol/vol) glycerol. Double-stranded hTonE
(CTTGGTGGAAAAGTCCAGCTGGT), which has the highest affinity to TonEBP
among various TonE sequences (19), was end-labeled using
[
-32P]ATP. To
determine the activity of TonEBP, 5 µg protein of nuclear extract
were incubated for 10 min with 1.5 µg of nonspecific DNA [poly(dA · dT)] in 30 µl containing 20 mM HEPES (pH 7.9), 50 mM KCl, 5 mM
MgCl2, 1 mM dithiothreitol, and
5% (vol/vol) glycerol. After addition of 10 fmol
32P-labeled hTonE, the reaction
was incubated for 20 min at room temperature. The mixture was
electrophoresed for 2.5 h on a 4.5% polyacrylamide gel in 45 mM Tris,
45 mM boric acid, and 1 mM EDTA with constant voltage of 150 V. Radioactivity of the TonEBP bands was visualized and quantified using a Phosphorimager.
Western blot analysis. To prepare whole cell extract, MDCK cells were lysed in a buffer containing 50 mM Tris · HCl (pH 7.6), 150 mM NaCl, 1 mM EDTA, 1% (vol/vol) Triton X-100, 0.2 µg/ml aprotinin, 5 µM leupeptin, 1 mM phenylmethylsulfonyl fluoride, and 10 µM trans-epoxylsuccinyl-L-leucylamido-(4-guanidino)butane (E-64) for 30 min at 4°C. The extracts were then cleared by centrifugation for 30 min at 15,000 g. Whole cell extracts and nuclear extracts were separated on a 6% polyacrylamide gel containing SDS and were transferred to a nitrocellulose membrane. The membrane was incubated for 1 h at room temperature with 1:2,000 dilution of the TonEBP antiserum (20) in 20 mM Tris · HCl (pH 7.6), 150 mM NaCl, 0.1% (vol/vol) Tween 20, and 5% (wt/vol) nonfat milk. The membrane was then incubated in the same way with anti-rabbit IgG conjugated with alkaline phosphatase (Jackson ImmunoResearch Laboratory). Alkaline phosphatase was visualized using a commercial kit (Sigma).
Immunohistochemistry. MDCK cells grown on glass coverslips were fixed for 15 min in 3.7% Formalin in PBS. After fixation, the cells were permeabilized in 0.5% Triton X-100 in Tris-buffered saline (TBS) for 15 min. The TonEBP antiserum (20) was diluted 1:400 in PBS, whereas the p65 antibody (rabbit polyclonal IgG; Santa Cruz) was diluted to 1 µg/ml in PBS containing 3% BSA and was incubated on the coverslips for 30 min at 37°C. The coverslips were washed three times in PBS and incubated as above in a 1:400 dilution of rhodamine-conjugated goat anti-rabbit IgG (Zymed). Finally, the coverslips were washed three times with PBS and mounted on slides for observation.
| |
RESULTS |
|---|
|
|
|---|
Inhibitors of proteasome activity prevent
induction of BGT1 and SMIT mRNA in response to
hypertonicity. When MDCK cells are cultured in
hypertonic medium, the abundance of BGT1 and SMIT mRNA increases, as
shown in Fig. 1, lanes
1 and 2. This increase in mRNA abundance is due to an increase in transcription of the BGT1
and SMIT genes in response to hypertonicity (27, 32). To test if any of
the cellular proteases is involved in the stimulation of transcription
by hypertonicity, we examined the effects of a variety of protease
inhibitors on mRNA abundance (Fig. 1). MG-132, a potent inhibitor of
proteasome activity, dramatically reduced the increase in mRNA
abundance for both BGT1 and SMIT in response to hypertonicity (see also
Fig. 2). TPCK, an inhibitor of serine and
cysteine proteases, moderately reduced the BGT1 and SMIT mRNA abundance. The effects of TPCK may not be related to inhibition of
serine and cysteine proteases because other inhibitors of serine and
cysteine proteases such as TLCK and leupeptin had no effect, even at
high concentrations (50 µM). Likewise, inhibitors of
cysteine proteases (E-64) and metalloproteases
(o-phenanthroline) did not affect mRNA
abundance. None of the inhibitors affected the abundance of
-actin
mRNA under isotonic or hypertonic conditions (data not shown),
indicating that the effects of MG-132 are specific for BGT1 and SMIT
mRNA.
|
|
The effects of MG-132 were nearly maximal at the relatively low
concentration of 1 µM (Fig. 2A),
supporting the idea that the effects were due to specific inhibition of
proteasome activity. In isotonic conditions, 1 µM MG-132 lowered the
abundance of BGT1 mRNA to 0.6-fold control
(P < 0.05) and SMIT mRNA to 0.4-fold control (P < 0.001; Fig.
2D). Induction of mRNA abundance in
response to hypertonicity (the abundance in hypertonicity divided by
the abundance in isotonicity) was also reduced by 1 µM MG-132 as
follows: for BGT1 mRNA, in MG-132-treated hypertonic cells 3.7-fold
that of isotonic cells in MG-132 compared with 13.5-fold in
DMSO-treated cells (P < 0.05); for
SMIT mRNA, 2.0-fold compared with 6.8-fold (P < 0.05; Fig.
2D). Other inhibitors of proteasome
activity, MG-115 (Fig. 2B) and
clasto-lactacystin
-lactone (Fig.
2C), also reduced the
hypertonicity-induced increase in mRNA abundance and the mRNA abundance
in isotonic cells. Thus the proteolytic activity of the proteasome is
required for the induction of the BGT1 and SMIT mRNA by hypertonicity
and maintenance of their expression in isotonic conditions.
To inhibit the activity of the proteasome without using the inhibitors, we attempted to use a temperature-sensitive mutant cell line in which ubiquitination and proteasome-mediated proteolysis can be blocked in a nonpermissive temperature (39°C) due to inactivation of the ubiquitin-activating enzyme, E1 (7). Unfortunately, we could not use these cells because they do not survive the combination of high temperature and hypertonicity for more than several hours (not shown).
MG-132 treatment inhibits transcription driven by
TonE. Because TonE mediates the stimulation of
transcription of the BGT1 (19, 25) and SMIT (21) genes in response to
hypertonicity, we tested whether TonE-driven transcription is affected
by inhibition of proteasome activity. Two different luciferase reporter
constructs were used (Fig. 3). In the BGT1
construct (25), the luciferase gene is under the control of two TonEs
and the promoter of the BGT1 gene, whereas in the 2× hTonE
construct (19) the luciferase gene is controlled by two tandem copies
of hTonE and the SV40 promoter. As expected, expression of luciferase
increased 8.3- and 16.5-fold in response to hypertonicity in MDCK cells
transfected with the BGT1 and 2× hTonE constructs, respectively.
When the transfected cells were treated with 1 µM MG-132, the
stimulation of luciferase by hypertonicity fell to 2.4-fold
(P < 0.05) and 3.3-fold
(P < 0.01), respectively. In
contrast, expression of luciferase was not influenced by treatment with
MG-132 in cells cultured in isotonic medium (not shown). These data
support the idea that the blunted induction of BGT1 and SMIT mRNA in
the presence of the proteasome inhibitors (Fig. 2) is due to inhibition
of TonE-driven transcription.
|
MG-132 treatment does not affect the abundance of
TonEBP. We have recently shown that stimulation of
TonEBP is the key event in TonE-mediated stimulation of transcription
(19, 20). Activation of TonEBP in response to hypertonicity occurs via
a combination of an increase in TonEBP abundance and an increase in
nuclear distribution of TonEBP (20). First, to investigate the effect of proteasome inhibition on TonEBP abundance, Northern blot and Western
blot analyses were performed using whole cell extracts. Figure
4, A and
B, shows representative results of
three independent experiments. In control cells (DMSO), the abundance
of TonEBP mRNA increased threefold when they were switched to
hypertonic medium for 18 h. Likewise, the abundance of TonEBP increased
fourfold, as reported earlier (20). Treatment with MG-132 did not have any effect on the abundance of mRNA and protein. Thus, at the whole
cell level, MG-132 treatment does not change the TonEBP abundance of
MDCK cells cultured in isotonic and hypertonic medium.
|
MG-132 treatment inhibits hypertonicity-induced nuclear distribution of TonEBP. Next, nuclear extracts were analyzed using Western blot analysis (Fig. 4C). In cells cultured in isotonic medium, MG-132 treatment increased the TonEBP abundance in the nucleus slightly. On the other hand, in cells cultured in hypertonic medium, MG-132 treatment resulted in a reduction of the TonEBP abundance in the nucleus. Semiquantitative Western analysis of four independent sets of samples in which serially diluted control samples were compared with MG-132-treated samples consistently showed that the abundance of the nuclear TonEBP is cut in half in cells treated with MG-132 under hypertonic conditions (not shown).
Similar results were obtained when TonEBP was measured using electrophoretic mobility shift assay (Fig. 4, D and E). In cells cultured in isotonic medium, MG-132 treatment increased the TonEBP abundance in the nucleus by 28% (P < 0.05). On the other hand, in cells cultured in hypertonic medium, the activity of TonEBP was 44% lower in nuclei of cells treated with MG-132 (P < 0.01). Thus the activity of TonE binding in the nucleus decreases pari passu with the amount of TonEBP (Fig. 4C) when MDCK cells are treated with MG-132 in hypertonic medium.
Decreased abundance of TonEBP in the nucleus despite no change at the
whole cell level by treatment with MG-132 suggests that MG-132 may
block the nuclear distribution of TonEBP in response to hypertonicity.
To explore the subcellular distribution of TonEBP, we performed
immunohistochemical staining of MDCK cells using TonEBP antiserum (20).
In isotonic medium, MG-132 treatment tends to increase nuclear TonEBP
(Fig.
5A), in
keeping with the results from Western analysis (Fig.
4C) and electrophoretic mobility shift assay (Fig. 4D). On the other
hand, in hypertonic medium, MG-132 treatment decreased the staining in
the nucleus while substantially increasing the staining in the
cytoplasm. Combined with the results in Fig. 4, these data demonstrate
that inhibition of proteasome activity attenuates the redistribution of
TonEBP into the nucleus in response to hypertonicity without affecting
the induction of TonEBP. The reduced appearance of TonEBP in the
nucleus should contribute to the reduced TonE-mediated transcription in
cells treated with MG-132 (Fig. 3).
|
The role of the proteasome is different in nuclear
distribution of TonEBP and NF-
B. Proteasome activity
is also required for nuclear translocation of the transcription factor
NF-
B (reviewed in Ref. 16). In the basal state, NF-
B is
sequestered in the cytoplasm (see below) through its association with
an inhibitory subunit, I
B. Activation of receptors for
proinflammatory cytokines such as TNF-
and interleukin-1 results in
phosphorylation and subsequent proteolytic degradation of I
B by the
proteasome. Once released from I
B, NF-
B moves to the nucleus and
stimulates transcription of specific genes. We asked the question
whether the same mechanism is responsible for activation of TonEBP and
NF-
B. To investigate the similarity between TonEBP and NF-
B, we
performed immunohistochemical analysis of TonEBP and NF-
B under the
same sets of conditions. When MDCK cells were cultured in hypertonic
medium, the distribution of NF-
B was not changed, whereas TonEBP was
redistributed into the nucleus slowly over several hours (Fig.
5A), as reported previously (20). On
the other hand, treatment with TNF-
induced nuclear translocation of
NF-
B in 30 min in a proteasome-dependent manner, i.e., sensitive to
MG-132, but did not affect TonEBP at all (Fig. 5B). These data indicate that the
underlying mechanisms are different for nuclear redistribution of
TonEBP and NF-
B even though both processes are sensitive to
inhibition of proteasome activity.
| |
DISCUSSION |
|---|
|
|
|---|
The long-term goal of this laboratory is to understand the signaling pathways for the induction of transcription by hypertonicity. This regulation is critical in the adaptation to hypertonic conditions. The data presented here demonstrate that the proteolytic activity of the proteasome plays an important role in the transcriptional induction of BGT1 and SMIT mRNA in response to hypertonicity. The proteasome is required for nuclear distribution of TonEBP, a key transcription factor regulating the BGT1 and SMIT genes. Inhibitors of the proteasome are the first reagents known to specifically interfere with the regulation of TonEBP by hypertonicity.
The effects of the inhibitors of proteasome activity differ in isotonic versus hypertonic conditions. In isotonic conditions, inhibition of proteasome leads to a reduction in the abundance of BGT1 and SMIT mRNA even though the apparent abundance of TonEBP in the nucleus is slightly increased without changing TonE-driven transcription. On the other hand, in hypertonic conditions, the abundance of TonEBP in the nucleus is decreased in correlation with decreased TonE-driven transcription of a reporter gene and decreased induction of BGT1 and SMIT mRNA. As the abundance of TonEBP in the nucleus determines the interaction of TonEBP and TonEs in the 5' flanking regions of the tonicity-responsive genes and subsequent TonE-driven transcription (19, 20), the decreased induction of BGT1 and SMIT mRNA in hypertonic cells treated with MG-132 (Figs. 1 and 2) is most likely caused by the decreased abundance of TonEBP in the nucleus (Figs. 4 and 5).
Although the nuclear abundance of TonEBP is reduced barely 50% by MG-132 treatment in hypertonic cells (Fig. 4), induction of mRNA for BGT1 and SMIT (Fig. 2) and induction of TonE-driven luciferase (Fig. 3) are decreased much more than 50%. Two explanations can be offered. First, the SMIT (21) and BGT1 (unpublished observation) promoters are regulated by multiple upstream TonEs. Because multiple TonEs function in synergy (19, 21), transcriptional regulation is not a linear function of the abundance of TonEBP. Second, proteasome activity may affect other processes such as mRNA stability. This might explain the decrease in the abundance of BGT1 and SMIT mRNA in isotonic conditions (Fig. 2D) even though TonE-mediated luciferase expression is not affected.
Unlike NF-
B in the basal state, TonEBP distributes in the nucleus as
well as in the cytoplasm in isotonic conditions. Thus TonEBP is active
in isotonic cells, and a substantial amount is found in the nucleus. In
hypertonic conditions, the nuclear-to-cytoplasmic ratio of TonEBP
clearly increases "redistribution" of TonEBP. Inhibition of the
proteolytic activity of proteasome selectively reduces the proportion
of TonEBP in the nucleus only in hypertonic conditions. It is difficult
to speculate on the target or substrate of proteasome activity in
hypertonic cells that increases nuclear distribution of TonEBP when the
target is proteolytically degraded. We speculate that this target
protein might function to retain TonEBP in the cytoplasm. I
B is not
this target because NF-
B is not regulated by hypertonicity, and,
conversely, TonEBP is not regulated by TNF-
(see
RESULTS). The identification of the target protein would
provide an important clue to the hypertonicity signaling pathways that
have eluded identification thus far.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-44484 and DK-42479.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: H. M. Kwon, 963 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205 (E-mail: mkwon{at}jhmi.edu).
Received 12 August 1999; accepted in final form 22 September 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Al-Moshilih, H. I.,
and
G. R. Dubes.
The kinetics of DEAE-dextran-induced cell sensitization to transfection.
J. Gen. Virol.
18:
189-193,
1973
2.
Chen, E.,
R. Hrdlickova,
J. Nehyba,
D. L. Longo,
H. R. Bose,
and
C. C. H. Li.
Degradation of proto-oncoprotein c-Rel by the ubiquitin-proteasome pathway.
J. Biol. Chem.
273:
35201-35207,
1998
3.
Denkert, C.,
U. Warskulat,
F. Hensel,
and
D. Häussinger.
Osmolyte strategy in human monocytes and macrophages: involvement of p38MAPK in hyperosmotic induction of betaine and myoinositol transporters.
Arch. Biochem. Biophys.
354:
172-180,
1998[Web of Science][Medline].
4.
Dick, L. R.,
A. A. Cruikshank,
L. Grenier,
F. D. Melandri,
S. Nunes,
and
R. L. Stein.
Mechanistic studies on the inactivation of the proteasome by lactacystin: a central role for clasto-lactacystin beta-lactone.
J. Biol. Chem.
271:
7273-7276,
1996
5.
Dignam, J. D.,
R. M. Lebovitz,
and
R. G. Roeder.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:
1475-1489,
1983
6.
Fenteany, G.,
R. F. Standaert,
W. S. Lane,
S. Choi,
E. J. Corey,
and
S. L. Schreiber.
Inhibition of proteasome activities and subunit-specific amino-terminal threonine modification by lactacystin.
Science
268:
726-731,
1995
7.
Finley, D.,
A. Ciechanover,
and
A. Varshavsky.
Thermolability of ubiquitin-activating enzyme from the mammalian cell cycle mutant ts85.
Cell
37:
43-55,
1984[Web of Science][Medline].
8.
Garcia-Perez, A.,
and
M. B. Burg.
Renal medullary organic osmolytes.
Physiol. Rev.
71:
1081-1115,
1991
9.
Hershko, A.,
and
A. Ciechanover.
The ubiquitin system.
Annu. Rev. Biochem.
67:
425-479,
1998[Web of Science][Medline].
10.
Ibsen, L.,
and
K. Strange.
In situ localization and osmotic regulation of the Na+-myo-inositol cotransporter in rat brain.
Am. J. Physiol. Renal Fluid Electrolyte Physiol.
271:
F877-F885,
1996
11.
Kitamura, H.,
A. Yamauchi,
T. Nakanishi,
Y. Takamitsu,
T. Sugiura,
A. Akagi,
T. Moriyama,
M. Horio,
and
E. Imai.
Effects of inhibition of myo-inositol transport on MDCK cells under hypertonic environment.
Am. J. Physiol. Renal Physiol.
272:
F267-F272,
1997
12.
Kitamura, H.,
A. Yamauchi,
T. Sugiura,
Y. Matsuoka,
M. Horio,
M. Tohyma,
S. Shimada,
E. Imai,
and
M. Hori.
Inhibition of myo-inositol transport causes acute renal failure with selective medullary injury in the rat.
Kidney Int.
53:
146-153,
1998[Web of Science][Medline].
13.
Ko, B. C. B.,
B. Ruepp,
K. M. Bohren,
K. H. Gabbay,
and
S. S. M. Chung.
Identification and characterization of multiple osmotic response sequences in the human aldose reductase gene.
J. Biol. Chem.
272:
16431-16437,
1997
14.
Koepp, D. M.,
J. W. Harper,
and
S. J. Elledge.
How the cyclin became a cyclin: regulated proteolysis in the cell cycle.
Cell
97:
431-434,
1999[Web of Science][Medline].
15.
Kwon, H. M.,
A. Yamauchi,
S. Uchida,
S. A. Preston,
A. Garcia-Perez,
M. B. Burg,
and
J. S. Handler.
Cloning of the cDNA for a Na+/myo-inositol cotransporter, a hypertonicity stress protein.
J. Biol. Chem.
267:
6297-6301,
1992
16.
Laney, J. D.,
and
M. Hochstrasser.
Substrate targeting in the ubiquitin system.
Cell
97:
427-430,
1999[Web of Science][Medline].
17.
Maxwell, P. H.,
M. S. Wiesener,
G. W. Chang,
S. C. Clifford,
E. C. Vaux,
M. E. Cockman,
C. C. Wykoff,
C. W. Pugh,
E. R. Maher,
and
P. J. Ratcliffe.
The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis.
Nature
399:
271-275,
1999[Medline].
18.
Minami, Y.,
K. Inoue,
S. Shimada,
H. Mormura,
A. Miyai,
A. Yamauchi,
T. Matsunaga,
and
M. Tohyama.
Rapid and transient up-regulation of Na+/myo-inositol cotransporter transcription in the brain of acute hypernatremic rats.
Mol. Brain Res.
40:
64-70,
1996[Medline].
19.
Miyakawa, H.,
S. K. Woo,
C. P. Chen,
S. C. Dahl,
J. S. Handler,
and
H. M. Kwon.
Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity.
Am. J. Physiol. Renal Physiol.
274:
F753-F761,
1998
20.
Miyakawa, H.,
S. K. Woo,
S. C. Dahl,
J. S. Handler,
and
H. M. Kwon.
Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity.
Proc. Natl. Acad. Sci. USA
96:
2538-2542,
1999
21.
Rim, J. S.,
M. G. Atta,
S. C. Dahl,
G. T. Berry,
J. S. Handler,
and
H. M. Kwon.
Transcription of the sodium/myo-inositol cotransporter gene is regulated by multiple tonicity-responsive enhancers spread over 50 kilobase pairs in the 5'-flanking region.
J. Biol. Chem.
273:
20615-20621,
1998
22.
Rock, K. L.,
and
A. L. Goldberg.
Degradation of cell proteins and the generation of MHC class I-presented peptides.
Annu. Rev. Immunol.
17:
739-779,
1999[Web of Science][Medline].
23.
Rock, K. L.,
C. Gramm,
L. Rothstein,
K. Clark,
D. Hwang,
and
A. L. Goldberg.
Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules.
Cell
78:
761-771,
1994[Web of Science][Medline].
24.
Smardo, F. L., Jr.,
M. B. Burg,
and
A. Garcia-Perez.
Kidney aldose reductase gene transcription is osmotically regulated.
Am. J. Physiol. Cell Physiol.
262:
C776-C782,
1992
25.
Takenaka, M.,
A. S. Preston,
H. M. Kwon,
and
J. S. Handler.
The tonicity-sensitive element that mediates increased transcription of the betaine transporter gene in response to hypertonic stress.
J. Biol. Chem.
269:
29379-29381,
1994
26.
Uchida, S.,
T. Nakanishi,
H. M. Kwon,
A. S. Preston,
and
J. S. Handler.
Taurine behaves as an osmolyte in Madin-Darby canine kidney cells. Protection by polarized, regulated transport of taurine.
J. Clin. Invest.
88:
656-662,
1991.
27.
Uchida, S.,
A. Yamauchi,
A. S. Preston,
H. M. Kwon,
and
J. S. Handler.
Medium tonicity regulates expression of the Na+- and Cl
-dependent betaine transporter in Madin-Darby canine kidney cells by increasing transcription of the transporter gene.
J. Clin. Invest.
91:
1604-1607,
1993.
28.
Warskulat, U.,
F. Zhang,
and
D. Häussinger.
Modulation of phagocytosis by anisoosmolarity and betaine in rat liver macrophages and RAW 264.7 mouse macrophages.
FEBS Lett.
391:
287-292,
1996[Web of Science][Medline].
29.
Warskulat, U.,
F. Zhang,
and
D. Häussinger.
Taurine is an osmolyte in rat liver macrophages.
J. Hepatol.
26:
1340-1347,
1997[Web of Science][Medline].
30.
Weik, C.,
U. Warskulat,
J. Bode,
T. Peters-Regehr,
and
D. Häussinger.
Compatible organic osmolytes in rat liver sinusoidal endothelial cells.
Hepatology
27:
569-575,
1998[Web of Science][Medline].
31.
Yamauchi, A.,
S. Uchida,
H. M. Kwon,
A. S. Preston,
R. B. Robey,
A. Garcia-Perez,
M. B. Burg,
and
J. S. Handler.
Cloning of a Na+- and Cl
-dependent betaine transporter that is regulated by hypertonicity.
J. Biol. Chem.
267:
649-652,
1992
32.
Yamauchi, A.,
S. Uchida,
A. S. Preston,
H. M. Kwon,
and
J. S. Handler.
Hypertonicity stimulates transcription of gene for Na+-myo-inositol cotransporter in MDCK cells.
Am. J. Phsiol. Renal Fluid Electrolyte Physiol.
264:
F20-F23,
1993.
33.
Yancey, P. H.,
M. E. Clark,
S. C. Hand,
R. D. Bowlus,
and
G. N. Somero.
Living with water stress: evolution of osmolyte systems.
Science
217:
1214-1222,
1982
This article has been cited by other articles:
![]() |
C. Kuper, D. Steinert, M.-L. Fraek, F.-X. Beck, and W. Neuhofer EGF receptor signaling is involved in expression of osmoprotective TonEBP target gene aldose reductase under hypertonic conditions Am J Physiol Renal Physiol, May 1, 2009; 296(5): F1100 - F1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bissonnette, K. Lahjouji, M. J. Coady, and J.-Y. Lapointe Effects of hyperosmolarity on the Na+-myo-inositol cotransporter SMIT2 stably transfected in the Madin-Darby canine kidney cell line Am J Physiol Cell Physiol, September 1, 2008; 295(3): C791 - C799. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva Cellular Response to Hyperosmotic Stresses Physiol Rev, October 1, 2007; 87(4): 1441 - 1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. O'Connor, S. T. Mills, K. A. Jones, S. N. Ho, and G. K. Pavlath A combinatorial role for NFAT5 in both myoblast migration and differentiation during skeletal muscle myogenesis J. Cell Sci., January 1, 2007; 120(1): 149 - 159. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, J. D. Ferraris, C. E. Irarrazabal, N. I. Dmitrieva, J.-H. Park, and M. B. Burg Ataxia telangiectasia-mutated, a DNA damage-inducible kinase, contributes to high NaCl-induced nuclear localization of transcription factor TonEBP/OREBP Am J Physiol Renal Physiol, September 1, 2005; 289(3): F506 - F511. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Neuhofer, M. Vastag, M.-L. Fraek, and F.-X Beck Effect of ammonium on the expression of osmosensitive genes in Madin-Darby canine kidney cells J. Physiol., March 1, 2005; 563(2): 497 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Han, S. K. Woo, W.-Y. Kim, S.-H. Park, J.-H. Cha, J. Kim, and H. M. Kwon Maturation of TonEBP expression in developing rat kidney Am J Physiol Renal Physiol, November 1, 2004; 287(5): F878 - F885. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Lee, E. Colla, M. R. Sheen, K. Y. Na, and H. M. Kwon Multiple Domains of TonEBP Cooperate to Stimulate Transcription in Response to Hypertonicity J. Biol. Chem., November 28, 2003; 278(48): 47571 - 47577. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. H. Nemeth, E. A. Deitch, C. Szabo, and G. Hasko Hyperosmotic Stress Induces Nuclear Factor-{kappa}B Activation and Interleukin-8 Production in Human Intestinal Epithelial Cells Am. J. Pathol., September 1, 2002; 161(3): 987 - 996. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Neuhofer, H. Bartels, M.-L Fraek, and F.-X Beck Relationship between intracellular ionic strength and expression of tonicity-responsive genes in rat papillary collecting duct cells J. Physiol., August 15, 2002; 543(1): 147 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. CHA, S. K. WOO, K. H. HAN, Y. H. KIM, J. S. HANDLER, J. KIM, and H. M. KWON Hydration Status Affects Nuclear Distribution of Transcription Factor Tonicity Responsive Enhancer Binding Protein in Rat Kidney J. Am. Soc. Nephrol., November 1, 2001; 12(11): 2221 - 2230. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuzaki, T. Suzuki, and K. Takata Hypertonicity-induced expression of aquaporin 3 in MDCK cells Am J Physiol Cell Physiol, July 1, 2001; 281(1): C55 - C63. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Franchi-Gazzola, R. Visigalli, V. Dall'Asta, R. Sala, S. K. Woo, H. M. Kwon, G. C. Gazzola, and O. Bussolati Amino acid depletion activates TonEBP and sodium-coupled inositol transport Am J Physiol Cell Physiol, June 1, 2001; 280(6): C1465 - C1474. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Tian and D. M. Cohen Urea inhibits hypertonicity-inducible TonEBP expression and action Am J Physiol Renal Physiol, May 1, 2001; 280(5): F904 - F912. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Leitch, P. Agre, and L. S. King Altered ubiquitination and stability of aquaporin-1 in hypertonic stress PNAS, February 27, 2001; 98(5): 2894 - 2898. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Woo, S. C. Dahl, J. S. Handler, and H. M. Kwon Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity Am J Physiol Renal Physiol, June 1, 2000; 278(6): F1006 - F1012. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakayama, T. Peng, J. M. Sands, and S. M. Bagnasco The TonE/TonEBP Pathway Mediates Tonicity-responsive Regulation of UT-A Urea Transporter Expression J. Biol. Chem., December 1, 2000; 275(49): 38275 - 38280. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Ferraris, C. K. Williams, P. Persaud, Z. Zhang, Y. Chen, and M. B. Burg Activity of the TonEBP/OREBP transactivation domain varies directly with extracellular NaCl concentration PNAS, January 22, 2002; 99(2): 739 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhao, W. Tian, and D. M. Cohen Rottlerin inhibits tonicity-dependent expression and action of TonEBP in a PKCdelta -independent fashion Am J Physiol Renal Physiol, April 1, 2002; 282(4): F710 - F717. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |