Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 278: C277-C291, 2000;
0363-6143/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Langloh, A. L. B.
Right arrow Articles by Benos, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Langloh, A. L. B.
Right arrow Articles by Benos, D. J.
Vol. 278, Issue 2, C277-C291, February 2000

Charged residues in the M2 region of alpha -hENaC play a role in channel conductance

Anne Lynn B. Langloh1, Bakhrom Berdiev1, Hong-Long Ji1, Kent Keyser2, Bruce A. Stanton3, and Dale J. Benos1

Departments of 1 Physiology and Biophysics and 2 Physiological Optics, University of Alabama at Birmingham, Birmingham, Alabama 35294-0005; and 3 Department of Physiology, Dartmouth Medical School, Hanover, New Hampshire 03755


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The epithelial Na+ channel (ENaC) is a low-conductance channel that is highly selective for Na+ and Li+ over K+ and impermeable to anions. The molecular basis underlying these conduction properties is not well known. Previous studies with the ENaC subunits demonstrated that the M2 region of alpha -ENaC is critical to channel function. Here we examine the effects of reversing the negative charges of highly conserved amino acids in alpha -subunit human ENaC (alpha -hENaC) M1 and M2 domains. Whole cell and single-channel current measurements indicated that the M2 mutations E568R, E571R, and D575R significantly decreased channel conductance but did not affect Na+:K+ permeability. We observed no functional perturbations from the M1 mutation E108R. Whole cell amiloride-sensitive current recorded from oocytes injected with the M2 alpha -hENaC mutants along with wild-type (wt) beta - and gamma -hENaC was low (46-93 nA) compared with the wt channel (1-3 µA). To determine whether this reduced macroscopic current resulted from a decreased number of mutant channels at the plasma membrane, we coexpressed mutant alpha -hENaC subunits with green fluorescent protein-tagged beta - and gamma -subunits. Confocal laser scanning microscopy of oocytes demonstrated that plasma membrane localization of the mutant channels was the same as that of wt. These experiments demonstrate that acidic residues in the second transmembrane domain of alpha -hENaC affect ion permeation and are thus critical components of the conductive pore of ENaC.

site-directed mutagenesis; Xenopus oocytes; dual-electrode voltage clamp; planar lipid bilayers; green fluorescent protein; biotinylation; confocal microscopy; channel pore


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

SINCE THE CLONING OF THE epithelial amiloride-sensitive Na+ channel (ENaC), many of its biochemical and electrophysiological characteristics have been elucidated. Human ENaC (hENaC), which is predominantly found in the epithelia of the colon, lung, and kidney, is composed of three subunits, alpha , beta , and gamma  (18, 19, 27). The alpha -subunit alone forms an amiloride-sensitive Na+ channel when expressed in Xenopus oocytes. Coexpression of all three subunits yields a whole cell current ~20-fold larger than that observed with alpha -subunit only (18). The hENaC homologue delta -NaCh, which is expressed mainly in brain, pancreas, testis, and ovary, also produces a small amiloride-blockable conductance in oocytes that is potentiated by coexpression of the beta - and gamma -hENaC subunits. However, the biophysical properties of the delta beta gamma channel are different from those of the alpha beta gamma channel (28). Therefore, it has been proposed that alpha -subunits (or delta -subunits) form the conductive moiety and control the conductive characteristics of the multimeric channel and that the beta - and gamma -subunits are auxiliary proteins that augment channel function (4). The alpha -subunit is also a key target for the channel-blocking drug amiloride. Specific amino acid residues in the predicted extracellular loop of this subunit are important to amiloride binding and block of channel activity (10, 12). One feature of the channel that is not well defined is the conductive pore. By analogy to inwardly rectifying (Kir) and voltage-gated K+ channels, which all share a homologous pore region, it has been postulated that amino acids in specific positions in the extracellular and transmembrane domains of ENaC are important for determination of ion selectivity, permeability, and conductance.

The putative pore region of Kir channels occurs in the small extracellular loop between the two membrane-spanning domains of each subunit in the channel. It contains the P loop, a critical feature of which is the highly conserved K+ channel signature sequence (Gly-Tyr-Gly) that determines ion selectivity. This channel is a tetramer in which the second transmembrane domain (inner helix) of each subunit is arranged symmetrically around the pore. The positioning of these helices, as well as the location of specific residues in the helices, controls the characteristics of ion conduction in the pore (20). Also, P loops have been characterized in voltage-gated K+ channels, where they occur in the segment connecting the fifth and sixth membrane-spanning regions of the constituent subunits (17, 30, 31). In all cases, P loops serve as the selectivity filter that attracts and concentrates K+ (16).

Hydropathy analysis of the cloned members of the ENaC/degenerin superfamily has shown them to be structurally similar to renal outer medulla K+ channel and Kir K+ channels, with two large hydrophobic regions connected by an extracellular segment. Stretches of amino acids within each hydrophobic region are long enough to span the membrane and are predicted to have alpha -helical structure (transmembrane domains M1 and M2). The hydrophobic residues downstream of M1 (H1 domain) and upstream of M2 (pre-M2 or H2 domain) are extracellular and assume beta -sheet or beta -barrel conformations (3). Recent studies with alpha -subunit rat ENaC (alpha -rENaC) support a K+ channel-like P loop model in which the pre-M2 region dips into the membrane, possibly contributing to the pore of the channel (22). Previous studies of alpha -ENaC splice variants and chimeras have indicated that the second transmembrane domain is clearly important for Na+ channel function (15, 26, 29). Schild et al. (24) demonstrated that mutating a serine residue (S583C) within the predicted H2 region of alpha -rENaC (6 residues upstream of the predicted M2) decreases channel affinity for amiloride and confers sensitivity to channel block by the divalent cation Zn2+. They also studied an alpha -rENaC S580D mutation that results in reduced single-channel conductance (to Na+ and Li+) and increased sensitivity to external Ca2+ block. Waldmann et al. (29) identified two serine residues (Ser-588 and Ser-592) in the putative M2 region of alpha -rENaC that are important to channel conductance and gating. An S588I point mutation also alters channel affinity for amiloride.

We have performed alpha -helical wheel analysis of the two hydrophobic domains of alpha -hENaC. The analysis indicated that there are three negatively charged residues that occur on the hydrophilic face of the M2 helix and one such residue in the M1 helix. We hypothesize that these negative charges are part of the conduction pore of the multimeric channel and are therefore critical to channel function. To test this hypothesis, we used site-directed mutagenesis to reverse these charges in alpha -hENaC. We then assessed the effects of such mutations by examining the whole cell and single-channel Na+ current produced by Xenopus oocytes injected with mutant alpha -hENaC subunits along with wild-type (wt) beta - and gamma -hENaC subunits. To determine the localization of wt and mutant hENaC channel proteins in the oocytes, we injected enhanced green fluorescent protein (EGFP)-tagged ENaC constructs and examined their cellular location with confocal laser scanning microscopy.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Preparation of Site-Directed Mutants

The full length alpha -, beta -, and gamma -hENaC cDNAs were a kind gift of Dr. M. J. Welsh (University of Iowa). Site-directed mutants were created using the Quick Change mutagenesis kit (Stratagene, La Jolla, CA). Primers were designed to be complementary to the sense and antisense sequences of a particular region of alpha -hENaC. Each set of primers contained the necessary base changes required to code for an arginine instead of the wt glutamic or aspartic acid. In the cases reported here, two adjacent bases in each primer were altered from the wt sequence. Plasmid DNA was subjected to the following PCR protocol, using one set of mutagenic primers: 1 cycle at 95°C for 1 min to denature the DNA and then 16-17 cycles of 95°C for 30 s, 55°C for 1 min, and 68°C for 12-13 min. Parental (nonmutated) DNA was removed from completed PCR reactions by digestion with Dpn I at 37°C for 1 h. This enzyme is specific for methylated DNA and will not digest the nonmethylated PCR products. These products were then transformed into supercompetent Escherichia coli (XL1 BLUE, Stratagene) and grown on Luria-Bertani (+50 µg/ml ampicillin) agar overnight at 37°C. Colonies were picked and grown up overnight, and the DNA was isolated according to a standard alkaline lysis miniprep procedure. Positives for the specific mutation encoded by the PCR primers were confirmed by dideoxy sequence analysis.

In Vitro Transcription

Mutated DNA samples were in vitro transcribed using the SP6 and T7 mMessage mMachine kits (Ambion, Austin, TX). Briefly, ~1 µg of DNA was combined with appropriate reaction buffer, a mixture of all ribonucleotide triphosphates and m7G(5')ppp(5')G analog, and SP6 or T7 RNA polymerase. Transcription proceeded at 37°C for 5-6 h. Template DNA was digested with DNase at 37°C for 15 min and then extracted and precipitated. The quality and size of the cRNA was confirmed by denaturing formaldehyde-agarose gel electrophoresis. RNA concentration was approximated by ultraviolet spectrophotometric measurement of optical density (lambda  = 260 nm).

Oocyte Preparation and Microinjection

Oocytes were surgically removed from ice/tricaine-anesthetized adult female Xenopus laevis by standard techniques. Surrounding follicle cells were removed by digestion with 3 mg/ml collagenase (Boehringer Mannheim, Indianapolis, IN) in Ca2+-free OR-2 medium (in mM: 82.5 NaCl, 2.4 KCl, 1.8 MgCl2, and 5 HEPES, pH 7.4) for 45-90 min at room temperature with constant agitation. Defolliculated oocytes were washed several times with OR-2 and allowed to recover for 24 h in half-strength Leibovitz medium (0.5× L-15; Sigma, St. Louis, MO) at 18°C. Groups of stage V and VI eggs were injected via a microinjector (World Precision Instruments, Sarasota, FL) with 50 nl (12.5 ng) of the following cRNAs (all subunit mixtures were 1:1:1): 1) wt alpha -hENaC + wt beta -hENaC (wt beta ) + wt gamma -hENaC (wt gamma ); 2) M1 mutant alpha -hENaC (alpha E108R) + wt beta  + wt gamma ; 3) M2 E568R mutant alpha -hENaC (alpha E568R) + wt beta  + wt gamma ; 4) M2 E571R mutant alpha -hENaC (alpha E571R) + wt beta  + wt gamma ; 5) M2 D575R mutant alpha -hENaC (alpha D575R) + wt beta  + wt gamma ; 6) E568R + E571R + D575R mutant alpha -hENaC (alpha  triple mutant) + wt beta  + wt gamma .

When injected oocytes were to be processed for membrane vesicles to be incorporated into planar bilayers, 80-100 eggs were injected with the appropriate cRNA. Otherwise, 10-20 eggs were injected for dual-electrode voltage-clamp recordings. In both cases, injected oocytes were maintained for 2 days in 0.5× L-15 at 18°C before processing or recording.

To demonstrate that the EGFP-rENaC constructs that were used for confocal laser scanning fluorescence microscopy experiments produced whole cell amiloride-sensitive Na+ current similar to that produced by the constructs above, normal (not albino) oocytes were injected with 12.5 ng of the following combinations of cRNAs (in a 1:1:1 ratio): wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC; and D575R alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC.

Oocyte Membrane Vesicle Preparation

Oocytes injected with cRNA were washed three times with 3 ml of high-K+ 300 mM sucrose buffer (in mM: 400 KCl, 5 PIPES, and 300 sucrose), and homogenized in 600 µl of the same buffer, on ice for 5 min. The homogenate was centrifuged through a sucrose gradient (high K+-20% sucrose and high K+-50% sucrose) at 18,500 rpm for 30 min. The resulting interface between the gradients was drawn off, diluted with 3-4 ml of high-K+ buffer, and centrifuged at 23,500 rpm for 45 min. The pellet was dissolved in 200 µl buffer A (in mM: 100 KCl, 5 MOPS, and 300 sucrose), aliquoted, and stored at -20°C until bilayer incorporation experiments were performed.

Electrophysiological Recording

Whole cell. Membrane currents in oocytes were evaluated at 20°C by double-electrode voltage clamp. Oocytes were impaled with two 3 M KCl-filled electrodes with resistances of 0.5-2.0 MOmega , connected to a TEV-200 voltage-clamp system (Dagan, Minneapolis, MN). Two reference electrodes were connected to the bath by 3 M KCl-3% agar bridges. The bathing solution (ND-96; in mM: 96 NaCl, 1 MgCl2, 1.8 CaCl2, 2 KCl, and 5 HEPES, pH 7.4) was perfused by gravity at a rate of 1.5 ml/min. The voltage clamp was controlled by pCLAMP 5.5 software (Axon Instruments, Burlingame, CA), and current was constantly monitored on a strip chart recorder. Oocytes were clamped at a holding potential of 0 mV. Current-voltage (I-V) relations were acquired by stepping the holding potential at 500-ms intervals in 20-mV increments from -100 to +80 mV. I-V data were recorded 4-5 min after impalement of the oocyte and then again 3 min after the addition of 10 µM amiloride to the bath. Data analysis was performed with pCLAMP 5.5 software.

Planar lipid bilayers. Oocytes expressing the different mutant or wt alpha -hENaC cRNAs (along with wt beta - and wt gamma -hENaC) were processed to yield enriched membrane vesicles that were fused with artificial planar lipid bilayers. Bilayers were composed of a phospholipid solution containing a 2:1 mixture of diphytanoyl-phosphatidylethanolamine and diphytanoyl-phosphatidylserine in n-octane. Bilayers were bathed with 100 mM NaCl and 10 mM MOPS-Tris (pH 7.4) solutions. Applied voltage was referred to the virtually grounded trans chamber. Amiloride was added to the trans compartment to give a final concentration of 0.3 µM. Ion selectivity of the channels incorporated into the bilayer was examined by substituting 100 mM KCl for 100 mM NaCl in the cis compartment. Records were digitally filtered at 100 Hz using pCLAMP software, subsequent to acquisition of the analog signal filtered at 300 Hz with an 8-pole Bessel filter before acquisition at 1 ms/point.

Cell-attached patch clamp. Oocytes were shrunken in hypertonic medium, and the vitelline membranes were removed before patch clamping. The cell-attached configuration was used to record single-channel current with an Axopatch 1B amplifier (Axon Instruments). The borosilicate glass pipettes were made with a PP-83 vertical puller (Narishige, Tokyo, Japan), and the tips were polished. The tip resistance was 5-10 MOmega when electrodes were filled with the extracellular medium (100 mM LiCl, 10 mM HEPES, and 2.0 mM CaCl2, pH 7.4). The currents were collected by CLAMPEX 7.0 (Axon Instruments) at the sampling interval of 500 µs. All-point amplitude histograms of recordings >3 min were employed to measure the current level.

Preparation of GFP-rENaC Constructs

pGFP-C1/beta -rENaC was constructed by excising beta -rENaC from pSport/beta -rENaC with Sal I/Kpn I and ligating the excised fragment into Sal I/Kpn I-digested EGFP plasmid (pGFP-C1; Clontech, Palo Alto, CA). To remove two pre-existing stop codons between the Sal I site and an initiator methionine in beta -rENaC, a 563-bp PCR fragment was synthesized using beta -rENaC cDNA as a template with a sense primer (ACGCGTCGACGGTGCCACCATGCCAGTGAAGAAGTA- CCT) corresponding to nucleotides 1-20 of beta -rENaC and an antisense primer (GGTGCTTCCTGGGGCTGGGTTGCTGCTGTT) corresponding to nucleotides 514-543 of beta -rENaC. The sense primer also contained an upstream Sal I restriction site and a Kozak consensus site sequence. The amplified PCR product contained a unique BsmB I restriction site just upstream of the antisense primer sequence. PCR was performed by denaturing the reaction mixture at 94°C for 1 min, followed by 2 cycles of 1 min at 94°C, 1 min at 60°C, and 2 min at 72°C, then 24 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C, and a final extension at 72°C for 10 min. The 563-bp PCR product was isolated, purified (Wizard, Promega, Madison, WI), and subcloned into pcR 2.1 (TA cloning kit, Invitrogen, Carlsbad, CA), and the sequence was verified by ABI PRISM dye terminator cycle sequencing (Perkin-Elmer, Foster City, CA). The fusion cDNA pEGFP-beta -rENaC was constructed by digesting the subcloned PCR product with Sal I/BsmB I and ligating the gel-purified 316-bp PCR fragment into the Sal I/BsmB I-digested pEGFP-beta -rENaC cDNA. EGFP-beta -rENaC was subcloned from pEGFP-beta -rENaC into pcDNA3.1- (Invitrogen) using Nhe I and Kpn I (to generate pcDNA3.1-/EGFP/beta -rENaC). The sequence of both strands was confirmed by ABI PRISM dye terminator cycle sequencing.

pGFP-gamma -rENaC was constructed by excising gamma -rENaC from pSport/gamma -rENaC with Sal I/Kpn I and ligating the excised fragment into Sal I/Kpn I-digested pGFP-C2 (Clontech). GFP-gamma -rENaC was subcloned from pGFP-C2/GFP/gamma -rENaC into pcDNA3.1- (Invitrogen) using Nhe I. pcDNA3.1- was digested with Nhe I and treated with calf intestinal alkaline phosphatase to prevent self-ligation (to generate pcDNA3.1-/GFP/gamma -rENaC). The sequence of both strands was confirmed by ABI PRISM dye terminator cycle sequencing. These GFP constructs are referred to throughout as GFP-beta -rENaC and GFP-gamma -rENaC.

Oocyte Preparation for Confocal Microscopy

Adult female albino X. laevis frogs were obtained from Xenopus I (Dexter, MI) and maintained in the same conditions as normal X. laevis frogs. Stage V and VI oocytes were isolated from an ice/tricaine-anesthetized frog, as described above. Eggs were defolliculated with 3 mg/ml collagenase (Boehringer Mannheim) in Ca2+-free OR-2 medium for 1 h at room temperature with constant agitation. They were washed several times in OR-2 and then stored in 0.5× L-15 at 18°C. Oocytes were injected 24 h postisolation with 12.5 ng (in 50 nl) of the following cRNAs (in a 1:1:1 ratio): wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC; mutant alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC; and GFP-beta -rENaC + GFP-gamma -rENaC.

A group of oocytes was also injected with 50 nl of water, as a control for background fluorescence. alpha -hENaC and EGFP cRNAs were generated with the mMessage mMachine in vitro transcription kits, as described above. Maximum hENaC channel activity was observed in oocytes ~48 h after cRNA injection. Therefore, oocytes were processed for confocal microscopy 2 days postinjection. To identify the plasma membrane, 10 eggs from each injection group were surface biotinylated. The eggs were equilibrated in ND-48 (in mM: 48 NaCl, 48 N-methyl-D-glucamine chloride, 1 MgCl2, 1.8 CaCl2, 2 KCl, and 5 HEPES, pH 7.4). Eggs were incubated twice consecutively in 2 ml of ND-48 containing 1.0 mg/ml EZ-Link Sulfo-NHS-LC-Biotin (Pierce, Rockford, IL) for 30 min at room temperature with gentle agitation. The reaction was stopped by washing the oocytes once with ND-48 and incubating them in 100 mM glycine in ND-48 for 10 min at room temperature with agitation. Each group of eggs was washed once with ND-48 and then transferred to fresh dishes containing 2 ml of 10 µg/ml Texas red-conjugated streptavidin (Molecular Probes, Eugene, OR) in ND-48. Labeling was carried out in the dark at 4°C for 1 h. As a control, a group of 10 wt-injected oocytes that were not biotinylated were treated with the Texas red-streptavidin as above. Eggs were washed several times with ND-48 and stored in the same solution for the duration of the confocal microscopy.

Confocal Microscopy

Images were acquired using an Olympus Fluoview BX50 upright confocal laser scanning microscope, equipped with a UplanF1 ×10, 0.30 numerical aperture air objective and air-cooled krypton and argon lasers. The 488-nm argon laser line and the 568-nm krypton laser line excited the EGFP and Texas red, respectively. EGFP fluorescence was collected through the 510-nm and 550-nm barrier filters and Texas red fluorescence through the 610-nm filter. X-Y scans were obtained at 12-bit resolution at approximately the midsection of each oocyte. Acquired images were imported into Adobe Photoshop 5.0 for processing.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Generation of alpha -hENaC Mutants

Results of the alpha -helical wheel analysis of the M1 and M2 sequences are shown in Fig. 1A, and the residues examined in this study are indicated by gray shading. According to this analysis, these gray residues occur on the hydrophilic sides of the helices. Figure 1B shows sequence alignments of just the second large hydrophobic regions (H2 and M2) of several of the cloned ENaCs. It demonstrates the relative positions and conserved nature of the M2 residues that we have mutated and analyzed. We used site-directed mutagenesis to change these glutamic and aspartic acids to arginines (point mutants alpha E108R, alpha E568R, alpha E571R, and alpha D575R). In this manner, the specific negatively charged amino acids in M1 and M2 were changed to positively charged residues. Additionally, the following combination mutants were generated: E568R + E571R, E568R + D575R, and E568R + E571R + D575R (triple). All mutant constructs were confirmed by sequence analysis.



View larger version (4424K):
[in this window]
[in a new window]
 
Fig. 1.   Models of putative membrane-spanning domains of alpha -subunit of human epithelial Na+ channel (alpha -hENaC). A: alpha -helical wheel analysis of M1 and M2 regions. Residues surrounded by thick circles are generally nonpolar and hydrophobic, whereas those enclosed in thin circles are considered hydrophilic due to their size, polarity, or charge. Acidic residues mutated in this study are shaded gray. These are the only negatively charged amino acids in predicted membrane-spanning regions. B: amino acid alignment of second large hydrophobic regions of ENaC subunits alpha , delta , beta , and gamma . Putative H2 and M2 domains are indicated at bottom. Conserved acidic residues in M2 are boxed, and those focused on in this study are shaded gray. Numbers above boxes refer to alpha -hENaC sequence. Serine residues of alpha -subunit of rat ENaC (alpha -rENaC) enclosed in dashed boxes have been examined by other laboratories and are believed to be part of channel pore. Those in H2 region affect amiloride and divalent cation block of channel and selectivity, whereas those in M2 predominantly affect conductance. bENaC, bovine ENaC; xENaC, Xenopus ENaC; cENaC, chicken ENaC; mENaC, murine ENaC.

Functional Studies With wt and Mutant alpha -hENaCs

Oocytes were injected, as described under Oocyte Preparation and Microinjection, with 12.5 ng of wt alpha beta gamma -hENaC or mutant alpha -hENaC + wt beta -hENaC + wt gamma -hENaC cRNA. Channel activity was recorded 48 h after injection. Channel activity expressed by the M1 mutant alpha -hENaC is seen in Fig. 2A. These results demonstrate a magnitude of whole cell current that was similar to that seen for the wt alpha beta gamma -hENaC channel. The inward Na+ currents recorded during the voltage-clamp protocol, before and after the addition of 10 µM amiloride, for the wt and the mutant were the same. The average amiloride-sensitive component of the whole cell current in both cases was equivalent (Fig. 2B). The I-V curves for the two channels were very similar. The reversal potentials were +15 mV for the wt and +10 mV for the mutant. These data indicate that there was little or no effect of this M1 point mutation on Na+ channel function at the whole cell level. Oocytes injected with these same combinations of alpha beta gamma cRNAs were processed to obtain membrane vesicles that were then fused to an artificial planar lipid bilayer for single-channel analysis. Single-channel records for wt alpha -hENaC and for the M1 mutant alpha -hENaC are shown in Fig. 3A. The apparent unitary conductance of both channels was 13 pS. Their open probabilities (Po) were essentially the same at 0.13 ± 0.02 (n = 3) for wt and 0.15 ± 0.02 (n = 4) for the mutant alpha E108R. The amiloride dose-response curves (Fig. 3B) indicate that the M1 mutation did not alter the amiloride sensitivity of the channel, and the apparent equilibrium dissociation constant of amiloride (Kami) for both channels was 0.2 µM. The wt and alpha E108R channels were recorded in symmetrical 100 mM NaCl solutions, and the plots of the resulting I-V relationships are shown in Fig. 3C. The curves were both linear with reversal potentials of 0 mV. I-V curves for the channels recorded in the bi-ionic conditions of 100 mM NaCl trans and 100 mM KCl cis are also plotted. The wt and mutant channels were both more selective for Na+ over K+ and became slightly inwardly rectified with a reversal potential of +60 mV under the asymmetrical conditions.



View larger version (2354K):
[in this window]
[in a new window]
 
Fig. 2.   Channel activity recorded from Xenopus oocytes expressing wild-type (wt) alpha beta gamma -hENaC or M1 mutant alpha -hENaC (alpha E108R; with wt beta - and gamma -subunits). A: whole cell current traces and current-voltage (I-V) relationships. Each set of traces represents current measured when eggs were clamped from -100 to +80 mV, in 20-mV increments. Recordings were made in 96 mM NaCl solution (ND-96). Top and middle traces depict whole cell currents recorded before and 3-4 min after addition of 10 µM amiloride. Amiloride-sensitive component of whole cell current is shown in bottom sets of traces. I-V relationships plotted below current traces are based on amiloride-sensitive whole cell currents. The wt and M1 mutant proteins produced channels with linear I-V relations and reversal potentials of +15 and +10 mV, respectively. Slopes of two I-V relations are almost identical, indicating that both channels had similar whole cell Na+ conductance. B: average amiloride-sensitive whole cell current measured in wt and M1 mutant-expressing oocytes. Current amplitude was measured 400 ms after eggs were clamped at -100 mV. The wt current was -3,017.6 ± 769.4 nA (n = 8). The alpha  M1 mutant channel displayed an average current of -2,157 ± 465.2 nA (n = 7), which was not significantly different from that for wt channel recorded in same oocytes on same day.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Functional characteristics of M1 mutant alpha -hENaC incorporated into planar lipid bilayers. cRNAs for alpha E108R, wt beta -, and wt gamma -hENaC or cRNAs for wt form of all 3 subunits (12.5 ng total RNA/egg) were injected into Xenopus oocytes. Membrane vesicles were prepared from oocytes 2 days postinjection. Channels were incorporated into bilayers bathed in symmetrical 100 mM NaCl solutions and held at -100 mV. A: representative single-channel records. Open probabilities (Po) for wt and mutant channels were 0.13 ± 0.02 (n = 3) and 0.15 ± 0.02 (n = 4), respectively. Amiloride (0.3 µM; added to trans chamber) reduced Po of both channels by approximately one-half. B: amiloride dose-response curves for normal and mutant channels. M1 and wt channels showed same affinity for amiloride (Kami): 0.2 µM. C: I-V relationships for wt channel and M1 mutant channel reconstituted into planar lipid bilayers under bi-ionic and symmetrical conditions.

When the M2 alpha -hENaC mutant constructs were coinjected with wt beta -hENaC and wt gamma -hENaC into oocytes, the resulting whole cell currents were markedly smaller than those of the wt alpha -hENaC-injected eggs (Figs. 4 and 5). The average amiloride-sensitive current for wt was -3,017.6 ± 769.4 nA (n = 8). The average amiloride-sensitive currents expressed by the M2 mutants were -60.9 ± 17.7 (n = 5), -93.2 ± 26.9 (n = 4), -46.3 ± 7.8 (n = 7), and -22.0 ± 8.1 (n = 5) nA for alpha E568R, alpha E571R, alpha D575R, and the alpha  triple mutant, respectively (Fig. 5). The I-V plots in Fig. 4 demonstrate a significantly smaller amiloride-sensitive current for the M2 mutants than for the wt channel (P < 0.05). They also indicate a slight rectification of the whole cell currents from the mutant-expressing oocytes. The single-channel characteristics of the M2 point mutant, alpha D575R, were examined in the planar lipid bilayer system and also by cell-attached patch clamp of hENaC-expressing oocytes. As seen in Fig. 6A, in the bilayer, the alpha D575R hENaC + wt beta -hENaC + wt gamma -hENaC channel had a smaller unitary conductance (9 pS) than did wt (13 pS). The Po values of the two channels were similar: 0.14 ± 0.02 for wt (n = 3) and 0.13 ± 0.02 for alpha D575R (n = 3). The alpha D575R mutation appeared to have a small effect on the amiloride sensitivity of the channel determined from the amiloride dose-response curves shown in Fig. 6B. The Kami for the mutant channel was twofold greater (0.45 ± 0.035 µM, n = 3) than that of wt (0.20 ± 0.018 µM, n = 3). The I-V relationships plotted in Fig. 6C demonstrate the decreased conductance of the mutant, as well as inward rectification of the single-channel current, under symmetrical NaCl conditions. Conductances of both channels decreased when KCl was substituted for NaCl in the cis chamber. The shift in reversal potential for the alpha D575R mutant in asymmetrical conditions was not significantly different from the shift in the wt curve under the same conditions. These results indicate that the Na+:K+ selectivity of hENaC was not affected by the M2 mutation. The M2 mutants, alpha E568R and alpha E571R, were examined in the same manner in the bilayer and gave identical results (not shown). Additionally, oocyte membrane vesicles containing the triple alpha -hENaC mutant were also incorporated into the planar lipid bilayer. An amiloride-sensitive Na+ conductance could not be measured for this mutant (data not shown).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Dual-electrode voltage-clamp studies of Xenopus oocytes expressing wt or M2 mutant alpha -hENaC cRNAs. Traces represent whole cell amiloride-sensitive current recorded in 96 mM NaCl. Cells were clamped between -100 mV and +80 mV in 20-mV increments. Corresponding I-V relationships for amiloride-sensitive current are plotted to right of wt traces and below mutant traces. Wt alpha beta gamma -hENaC channels had a linear I-V relationship and a reversal potential of +30 mV. Macroscopic amiloride-sensitive current produced by each of alpha  mutants [alpha E568R, alpha E571R, alpha D575R, or E568R + E571R + D575R (triple)] were significantly reduced compared with wt. I-V relationships for these mutant channels demonstrate slight inward rectification, and their reversal potentials were similar to that of wt. However, slopes of curves are almost negligible and indicate a Na+ conductance that was significantly smaller than wt.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Comparison of average amiloride-sensitive whole cell Na+ currents recorded from Xenopus oocytes injected with M2 mutant alpha -hENaCs. Data for each of 3 M2 point mutants and triple mutant are shown along with wt (1st 5 bars, from left). For these experiments, wt-expressing eggs had an average amiloride-sensitive current, at -100 mV, of -3,017 ± 769 nA (n = 8). Compared with this, each of mutant channels produced very low, almost negligible, levels of amiloride-sensitive whole cell current: -61 ± 18 (n = 5), -93 ± 27 (n = 4), -46 ± 8 (n = 7), and -22 ± 8 (n = 5) nA for alpha E568R, alpha E571R, alpha D575R, and triple mutants, respectively. Also shown is average amiloride-sensitive current from oocytes injected with either wt alpha -hENaC + green fluorescent protein (GFP)-beta -rENaC + GFP-gamma -rENaC or alpha D575R + GFP-beta -rENaC + GFP-gamma -rENaC. GFP constructs were utilized for fluorescence experiments shown in Figs. 8-10 (see also Fig. 7). Average wt current amplitude was -2,690 ± 1,262 nA (n = 8), much like that seen for wt alpha beta gamma -hENaC channels in oocytes. Amiloride-sensitive current recorded from oocytes expressing mutant was very small (-24 nA). It was similar to current produced by combination of mutant alpha - and wt beta - and wt gamma -hENaC (-22 ± 8 nA).




View larger version (2213K):
[in this window]
[in a new window]
 
Fig. 6.   Single-channel recordings of wt alpha -hENaC and alpha D575R reconstituted into planar lipid bilayers. A: current traces represent single-channel activity observed after vesicles were incorporated into bilayers bathed in symmetrical 100 mM NaCl solutions and held at -100 mV. Po for wt and mutant channels were 0.14 ± 0.02 (n = 3) and 0.13 ± 0.02 (n = 3), respectively. Unitary conductance of mutant channel (9 pS) was lower than wt conductance (13 pS). Effect of addition of 0.2 µM amiloride to trans compartment of bilayer is shown in bottom set of traces. Similar reduced conductances were observed when other alpha -subunit M2 point mutants (alpha E568R or alpha E571R) were coexpressed in oocytes with wt beta - and gamma -subunits and incorporated into planar lipid bilayers. B: single-channel amiloride dose-response curves for wt and alpha D575R. Holding potential was -100 mV. Mutant channel affinity for amiloride was slightly less (apparent Kami = 0.45 µM) than that of wt channel (apparent Kami = 0.2 µM). C: single-channel I-V relationships of wt and alpha D575R channels incorporated into planar lipid bilayers under bi-ionic and symmetrical conditions. D: cell-attached patch-clamp recordings from oocytes expressing wt or alpha D575R mutant channels. Bathing solution contained 100 mM LiCl, and membrane potential was held at -60 mV. Dashed line represents closed state. Single-channel conductances were 7 and 5 pS for wt (n = 3) and mutant (n = 1) channel, respectively.

As an alternative way of looking at the single-channel nature of the wt and mutant channels, oocytes expressing wt alpha - or alpha D575R hENaC, along with wt beta - and wt gamma -hENaC, were patch clamped 2 days postinjection. Figure 6D shows representative current recorded from cell-attached patches clamped at -60 mV. The mutant channel conductance was 5 pS, which was ~30% smaller than the wt conductance of 7 pS. It was considerably more difficult to find channel-containing patches in the mutant-expressing oocytes (1 out of 6 patches showed mutant channel activity).

Confocal Fluorescence Microscopy of GFP-Injected Oocytes

To visualize the cellular localization of the ENaC proteins, we prepared cDNA constructs with an EGFP sequence subcloned upstream of the start of the beta -rENaC or gamma -rENaC insert. The corresponding cRNAs for these constructs were coinjected with the various alpha -hENaC constructs. We first measured the whole cell current produced by the expression of alpha -hENaC with GFP-tagged beta - and gamma -rENaC subunits. Figure 7 shows that the wt alpha -hENaC combination produced whole cell amiloride-sensitive current that was equivalent to the current shown in Fig. 2A for wt alpha -hENaC + wt beta -hENaC + wt gamma -hENaC. The alpha D575R mutant, coexpressed with GFP-tagged beta - and gamma -subunits, produced the same low-level amiloride-sensitive current that was observed in Fig. 4. Average amiloride-sensitive currents were -2,690.5 ± 1,262.1 (n = 4) and -24.4 nA for the wt and mutant, respectively (Fig. 5). These data established that the channels formed by the GFP-tagged subunits were functionally identical to the channels formed by wt beta - and gamma -hENaC constructs.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Representative current traces and I-V relationships for amiloride-sensitive component of whole cell current recorded from oocytes expressing GFP-tagged beta - and gamma -rENaCs. Traces show amiloride-sensitive current for oocytes injected with cRNAs for wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC or mutant D575R alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC. Whole cell currents in oocytes expressing GFP-rENaC constructs were identical to those of oocytes expressing all hENaC subunits in Fig. 4. I-V curves for wt + GFP and mutant + GFP were similar to their counterparts in Fig. 4, with wt channel displaying a large inward Na+ conductance and linear I-V, and mutant displaying a very small inward conductance.

For confocal laser scanning fluorescence microscopy, oocytes were injected and processed as described under Oocyte Preparation for Confocal Microscopy. As a control, oocytes injected with 50 nl of water and surface labeled were imaged and compared with eggs injected with wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC. Each set of three images in Fig. 8 shows a similar optical section of oocytes obtained by a dual-laser scan at approximately the midpoint of the egg. The biotinylation protocol labeled proteins in the plasma membrane of the eggs with Texas red. As seen in Fig. 8, A1 and B1, the membrane of the cells was clearly defined by a distinct ring of Texas red fluorescence. The compact band of GFP fluorescence seen around the perimeter of the wt alpha beta gamma -injected egg (Fig. 8A2) represents the localization of the ENaC protein. The water-injected oocyte showed no GFP fluorescence (Fig. 8B2) compared with the wt, indicating that the background fluorescence of the oocytes in this emission spectrum was negligible. Figure 8A3 is an overlay of the A1 and A2 images and shows the colocalization of the GFP and Texas red fluorescence, which appears as yellow. This confirms that some of the wt hENaC channel expressed by the oocyte was successfully inserted into the plasma membrane, accounting for the 1-3 µA of whole cell current. Figure 8B3 is the overlay of images B1 and B2; there is no yellow fluorescence, since there was no detectable GFP fluorescence in the water-injected oocyte.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 8.   Laser scanning confocal images of Xenopus oocytes injected with wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC (A) or water (B). Oocyte shown in A was injected with 12.5 ng of wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC cRNA solution, and that in B was injected with 50 nl of water. Eggs were surface labeled with biotin and streptavidin-Texas red, as described in MATERIALS AND METHODS. Each set of micrographs shows oocyte scanned by confocal krypton and argon lasers at approximate midsection of egg, and images 1-3 in each set (A and B) show same scanned section of cell. Texas red fluorescence (seen in column 1) was collected through a 610-nm barrier filter. GFP fluorescence of ENaC protein (column 2) was collected through 510-nm and 550-nm barrier filters. Column 3 images show an overlay of fluorescence seen through both channels. Confocal settings (aperture and laser intensity) and photomultiplier tube voltage and gain were kept same for all scans of both eggs. The wt-injected egg in A showed a distinct band of GFP fluorescence around its periphery, which colocalized with Texas red fluorescence at surface of oocyte: this is seen as yellow fluorescence in A3 (n = 7). Water-injected egg in B demonstrated that background green fluorescence from oocyte was negligible (n = 6). Scale bar, 200 µm.

Oocytes that were injected with a 1:1 mixture of the GFP-beta -rENaC and GFP-gamma -rENaC cRNAs were surface biotinylated 2 days after injection and viewed with the confocal imaging system in the same manner as described for Fig. 8. Figure 9 compares the fluorescence of these oocytes to that of wt hENaC-expressing oocytes. Figure 9, A1 and B1, shows the Texas red-labeled plasma membrane of the two eggs. The alpha beta gamma channel GFP fluorescence is shown in Fig. 9A2, and its localization in the membrane is demonstrated by the yellow fluorescence in Fig. 9A3. The expression of the alpha - and beta -subunits alone produced a pattern of GFP fluorescence that appeared as a diffuse band of green under the plasma membrane (Fig. 9B2). There was negligible colocalization of the beta - and gamma -rENaCs with the red fluorescence at the membrane, as indicated by the absence of yellow in Fig. 9B3. This finding is consistent with previous findings that beta -rENaC and gamma -rENaC are not trafficked to the oocyte plasma membrane without the alpha -subunit (8).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 9.   Laser scanning confocal images of oocytes injected with wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC (A) or GFP-beta -rENaC + GFP-gamma -rENaC (B). Injection, labeling, and microscopy protocols used to acquire these images were same as those described for Fig. 8. Each set of images (in A or B) depicts same laser scanning section of oocyte, which was at approximately middle of egg. Column 1 shows Texas red fluorescence, column 2 shows GFP-ENaC fluorescence, and column 3 shows images in columns 1 and 2 superimposed. Colocalized fluorescence appears yellow. As seen in B3, GFP fluorescence pattern in eggs expressing only beta - and gamma -rENaC subunits was a diffuse band that did not colocalize with red fluorescence at membrane (n = 9). This indicated that most of beta gamma protein was in cytoplasmic compartment of oocytes, as would be expected. Most of GFP fluorescence associated with wt alpha beta gamma channel (A) was localized in plasma membrane of oocyte and not peripheral endoplasmic reticulum (n = 7). Scale bar, 85 µm.

With the same labeling and imaging protocol, we examined the cellular localization of two of the point mutants, alpha E571R and alpha D575R. These constructs were coinjected into oocytes with GFP-beta -rENaC and GFP-gamma -rENaC. Figure 10, A1, B1, and C1, shows the red-labeled plasma membrane of wt-, alpha E571R-, and alpha D575R-expressing oocytes. The GFP fluorescence patterns of the same oocytes are seen in Fig. 10, A2, B2, and C2. Compared with the wt channel (Fig. 10A2), the GFP localization of both mutants was very similar (Fig. 10, B2 and C2). Their tight green bands of fluorescence colocalized with the red fluorescence of the membrane, as seen by the yellow in Fig. 10, B3 and C3. Thus it appears that the mutants were localized in the plasma membrane, just like the wt. On some occasions, when these experiments were repeated, the relative strength of the GFP fluorescence signal at the membrane of the mutant-injected oocytes was weaker than that of the wt GFP fluorescence.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 10.   Laser scanning confocal images of oocytes injected with wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC (A), M2 mutant alpha E571R + GFP-beta -rENaC + GFP-gamma -rENaC (B), or M2 mutant alpha D575R + GFP-beta -rENaC + GFP-gamma -rENaC (C). Experimental conditions were same as described for Fig. 8. B2 and C2 indicate that M2 alpha -hENaC mutant channels had patterns of GFP fluorescence similar to that seen for wt channel (A2). These mutant channels also showed significant colocalization with oocyte plasma membrane, as seen by yellow fluorescence in B3 and C3 (wt, n = 7; alpha E571R, n = 5; alpha D575R, n = 4). alpha E568R mutant gave similar results. GFP-tagged mutant channels consistently produced a pattern of green fluorescence and colocalization that was like wt. If these channels were incorrectly processed or trafficked to membrane, we would expect to see a lack of or significantly less GFP colocalization with Texas red on surface, as was seen in oocytes injected with just GFP-tagged beta - and gamma -subunits (Fig. 9). Scale bar, 200 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The cloning of ENaC has aided the study of the epithelial Na+ channel conductance and gating characteristics, ion selectivity, and inhibition by amiloride. Identification of the conductive pore of the channel will help further the understanding of its functional properties, as well as clarify the nature of the interaction of its constitutive subunits in the membrane. In terms of their location in the transmembrane alpha -helices and their distinct conservation throughout the ENaCs (Fig. 1), we hypothesized that the few charged amino acids in the membrane-spanning domains of alpha -hENaC are potentially important pore residues.

By site-directed mutagenesis, we reversed the charge of Glu-108 in M1, changing the glutamate to arginine. Coexpression of this mutated form of alpha -hENaC with wt beta -hENaC and wt gamma -hENaC in oocytes produced whole cell amiloride-sensitive current of the same magnitude as that seen in oocytes expressing wt alpha -hENaC together with the wt beta - and gamma -subunits. This result indicates that the point mutation did not affect macroscopic channel function. When examined at the single-channel level in the bilayer, the mutant alpha -hENaC had the same unitary conductance (13 pS) as the wt. The mutation did not appear to alter amiloride sensitivity of the channel or Na+:K+ selectivity. The negative results for this point mutant serve as a control to show that the more drastic effects of the M2 mutants on channel function are not a result of the mutagenesis and in vitro transcription procedures or a problem of heterologous expression in the oocyte. These data indicate that the one negatively charged residue in the M1 domain of alpha -hENaC is not critical for movement of Na+ through the channel. In the K+ channels, the second transmembrane domains (the inner helices) of the four subunits that come together to form the channel are oriented to face the center of the pore, whereas the M1 domain of each subunit is situated away from the pore, facing the membrane (6). It is possible that alpha -hENaC orients itself around the conductive pore in a similar fashion. On the other hand, Coscoy et al. (5) recently identified a nine-amino acid region preceding the first transmembrane domain of ASIC2 and its splice variant ASIC2b that affects the ion selectivity and pH dependence of the neuronal channel formed by these ENaC homologues. Thus it seems premature to rule out some role of alpha -hENaC M1 region in the ion pore.

The M2 point mutations alpha E568R, alpha E571R, and alpha D575R had a much more significant effect on the amiloride-sensitive Na+ channel activity. In the oocyte, the mutant channels demonstrated reduced levels (50-100 nA) of amiloride-sensitive whole cell current. This was significantly lower than the 1-3 µA seen in wt alpha beta gamma -hENaC-injected oocytes. Also, the I-V relationships plotted for the mutant channels (Fig. 4) indicate that representative whole cell currents were inwardly rectified. Such inward rectification was seen as well in the single-channel I-V relationship for the point mutant alpha D575R (Fig. 6C). This finding suggests that these specific residues are likely part of the conductive pore of the channel, since alteration of them affects both the magnitude and the voltage dependence of the Na+ conductance. The mechanism by which these charge reversals actually invoke the inward rectification of the current is unknown. The alpha  double mutants, E568R + E571R and E568R + D575R, and the alpha  triple mutant, E568R + E571R + D575R, all produced amiloride-sensitive whole cell current that was at least 20-fold less than wt (data for the double mutants are not shown).

Several laboratories have determined that charged residues in the pore region and inner helix (M2) of various Kir channels are important for channel conductance and/or ion selectivity. Krapivinsky et al. (14) recently cloned a new member of the Kir family, Kir 7.1. This channel demonstrates lower single-channel conductance than the other Kir channels and a decreased sensitivity to block by external Ba2+ and Cs+. There are three amino acids in the pore region of Kir 7.1 that are thought to contribute to the observed functional differences, as they differ from the conserved corresponding residues in the other members of the family. Mutation of one of these, Met-125, to the arginine that is conserved in other Kir channels produced a channel with a much higher conductance than the wt and an increased sensitivity to Ba2+. Studies of IRK1 show that the acidic residue, Asp-172, in the second hydrophobic segment affects channel function and block by internal Mg2+, indicating that it is positioned in the permeation pathway. Additionally, its size and/or charge contribute to channel selectivity (23). Experiments with a different type of channel, the nicotinic ACh receptor, have demonstrated that reversing the negatively charged residues occurring on both sides of the M2 regions of the constituent alpha -, beta -, gamma -, and delta -subunits reduces channel conductance significantly. Proposed explanations for this finding include perturbation of electrostatic forces, charge mutation-induced changes in pore structure, or alteration in ionic energy in the narrow region of the pore (13).

Waldmann et al. (29), who made alpha -rENaC/Mec-4 chimeras to confirm that the M2 region plays an important role in characteristic ENaC function, also demonstrated that the alpha -subunit point mutations S588I and S592I cause an increase in the channel conductance for Na+ and fast voltage-dependent gating. According to alpha -helical wheel analysis, the serines involved in these mutations occur on the same side of the M2 helix as the glutamate and aspartate residues that we examined. These data support the idea that the M2 region of alpha -hENaC is oriented in the membrane such that its hydrophilic face is an integral part of the conductive pore and that certain amino acids along that side of the helix are critical to ion permeation. Whether the size of the residue side chains or their polarity is more important remains to be determined. Interestingly, Waldmann et al. (29) constructed a chimera that exchanged residues 597-602 in alpha -rENaC with the homologous region of Mec-4. This included an E599F switch. Glu-599 in alpha -rENaC corresponds to Asp-571 in alpha -hENaC, which we mutated in these experiments. The properties of the chimera are indistinguishable from wt alpha -rENaC, whereas our alpha -hENaC D571R point mutant demonstrated reduced whole cell and single-channel conductance compared with wt hENaC channels. One explanation for these findings could be that the E599F change is not severe enough to evoke the conductance change that we saw with the D571R change. Alternatively, replacing the other residues around the alpha -rENaC Glu-599 with the corresponding Mec-4 residues could help maintain the channel properties, because it is thought that degenerins may function as channel proteins (7).

Kellenberger et al. (11) analyzed the monovalent and divalent cation permeability of heterotrimeric channels formed with alpha -rENaC Ser-589 mutants and determined that the geometry and size of the pore at the selectivity filter region influence what ions pass through the channel. Their experiments indicate that residue side chains affect the size and shape of the pore and thereby create a "molecular sieving" effect. Similarly, X-ray crystallographic studies of the KcsA K+ channel suggest that the arrangement of residues, specifically the main chain carbonyl oxygen atoms in the selectivity filter of the pore region, creates sites that accommodate K+ in a size-specific manner (6). On the basis of these results and earlier work by Palmer (21), Kellenberger et al. (11) propose a model of the ENaC pore in which the H2 segments of the constituent subunits form a funnel-shaped outer channel vestibule that narrows down to a very constricted selectivity filter that is composed of the conserved serine residues at the start of the M2 region of each subunit. The M2 segments, arranged such that they gradually open up to the cytoplasm, form the intracellular mouth of the pore.

Examination of our alpha -hENaC M2 single point mutants in the planar lipid bilayer revealed that each of the individual charge reversals produced channels with a 30% lower unitary conductance than the wt (9 pS for the mutants vs. 13 pS for the wt). The amiloride sensitivity of the mutant channel was slightly less than the wt, and its selectivity for Na+ over K+ was not altered. According to our analysis, residues 568, 571, and 575 occur in the middle of the M2 helix. On the basis of the model described above and that proposed for the conductive pore of K+ channels, this location is near the inner mouth of the pore, slightly removed from the putative P loop/selectivity filter that lies at the outer mouth. It is also >300 residues downstream from a putative amiloride-binding sequence (10, 12). Thus we predict that the role of these residues in the channel pore would be to attract or bind Na+ and aid in their movement through the pore. A role in selectivity or channel block seems less likely because of their location. They may create electrostatic energy wells for the diffusing ions, or their negative charges may help increase the concentration of cations at the intracellular entryway of the channel. In the case of the KcsA K+ channel, the intracellular and extracellular openings are negatively charged by acidic amino acids (6).

It is interesting that when measured by dual-electrode voltage clamp, our M2 mutant channels produced extremely low amiloride-sensitive whole cell current in the oocytes, and yet when recorded in the planar lipid bilayer the same channels had substantial unitary conductances of 9 pS. One explanation for this apparent discrepancy is that many of the mutant channels expressed at the oocyte plasma membrane were functioning transiently or were nonfunctional due to the mutations in the alpha -subunit. The mutations could have caused enough of a conformational or steric change in the pore-lining M2 domains that, the majority of the time, they created a nonconductive pore. This is despite the fact that the three subunits did associate to the degree required for normal trafficking to the plasma membrane. A phenomenon such as this was observed by Krapivinsky et al. (14), who reported that a point mutation (G129E) in the pore region of Kir 7.1 produced no measurable whole cell current. However, localization of the mutant channel at the plasma membrane was the same as wt.

Regarding the differences in the conductances of the hENaC channels measured in the bilayer and the oocyte, our laboratory has studied the effect of actin on the channel in the bilayer. When actin was added to the cytoplasmic side of the bilayer, the unitary conductance of the wt channel decreased to 6-7 pS (a single-channel conductance consistent with that measured in the cell-attached patch-clamp experiments) and the conductance of the alpha D575R mutant decreased to 4 pS. This conductance is more representative of the channel, since it is expressed in conjunction with the actin cytoskeleton in the oocyte (see Ref. 2).

An obvious explanation for the small macroscopic current observed with the mutant alpha -subunits is that the channels were not processed or trafficked correctly, such that their insertion into the plasma membrane was hindered. To determine whether this was the case, we examined the localization of the hENaCs in live oocytes. We coexpressed our mutant and wt alpha -hENaC subunits with GFP-tagged beta - and gamma -rENaC subunits. Laser scanning confocal sections from the middle of an oocyte injected with wt alpha -hENaC + GFP-beta -rENaC + GFP-gamma -rENaC showed a distinct band of GFP fluorescence that colocalized with the plasma membrane. This same wt channel produced 1-3 µA of whole cell amiloride-sensitive current. Together, these data indicate that the three subunits formed functional channels that were predominantly localized in the plasma membrane of the oocyte.

In contrast, oocytes expressing only the GFP-tagged beta - and gamma -rENaCs showed a pattern of fluorescence that was consistent with previous findings of Firsov et al. (8). They expressed epitope-tagged alpha -, beta -, and gamma -subunits and combinations thereof in oocytes and used antibody binding assays to demonstrate that beta - or gamma -subunits alone are not present at the cell surface. They also found that alpha  + beta , alpha  + gamma , and beta  + gamma  demonstrate no surface antibody binding. These data corroborate our results that the GFP-tagged beta - and gamma -subunits showed intracellular fluorescence, rather than plasma membrane fluorescence, and that the GFP fluorescence in wt alpha beta gamma -expressing oocytes demonstrated the association of the alpha -subunit with the beta - and gamma -subunits in the plasma membrane. Visualizing specific endoplasmic reticulum (ER) localization of our GFP-tagged proteins in whole oocytes was difficult, due to the size of the cell and the limitations of the microscope objective. It is likely that there was GFP fluorescence in the dense ER network surrounding the nucleus and also in the cytoplasmic ER extending to the plasma membrane. Unfortunately, the oocyte is relatively large, and the working distance of the ×10 objective used is relatively short. Consequently, the fluorescence emission from perinuclear regions and cytoplasm was undetectable. This is why the oocytes in Figs. 8-10 showed no GFP fluorescence in the middle. The green fluorescent emission in and proximal to the plasma membrane was much more distinguishable due to the thinness of the membrane and the fact that the fluorophores there were more accessible to direct laser excitation.

The localization of GFP fluorescence in oocytes expressing the alpha -hENaC mutants alpha E571R and alpha D575R was similar to or only slightly less than that observed in wt alpha -hENaC-injected eggs. These results provide strong evidence that the mutant alpha -subunits successfully associated with the beta - and gamma -rENaC subunits and that this complex was trafficked to the plasma membrane. Thus the reduced whole cell current expressed by these point mutants was not solely due to a decrease in channel expression at the cell surface. These data support our single-channel measurements that indicate that a critical effect of reversing any or all of the negatively charged residues in the second transmembrane segment of ENaC alpha -subunit was to reduce channel conductance. These studies thereby demonstrate that the M2 domain forms part of the conductive pore of the channel and that acidic residues near the internal mouth of the pore are important for the movement of Na+ through the channel.


    ACKNOWLEDGEMENTS

We thank Dr. Michael Duvall for initial assistance with oocyte recording and data analysis, Kathy Karlson for technical assistance, Dr. Michael Welsh for the gift of the hENaC cDNAs, and Dr. Bernard Rossier for the gift of the rENaC cDNAs.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-56095 (to D. J. Benos) and DK-34533 (to B. A. Stanton).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: D. J. Benos, Dept. of Physiology and Biophysics, University of Alabama at Birmingham, 1918 University Blvd. MCLM 704, Birmingham, AL 35294-0005 (E-mail: benos{at}physiology.uab.edu).

Received 14 July 1999; accepted in final form 20 September 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Adams, C. M., P. M. Snyder, and M. J. Welsh. Interactions between subunits of the human epithelial sodium channel. J. Biol. Chem. 272: 27295-27300, 1997[Abstract/Free Full Text].

2.   Berdiev, B. K., A. G. Prat, H. F. Cantiello, D. A. Ausiello, C. M. Fuller, B. Jovov, D. J. Benos, and I. I. Ismailov. Regulation of epithelial Na+ channels by short actin filaments. J. Biol. Chem. 271: 17704-17710, 1996[Abstract/Free Full Text].

3.   Canessa, C. M., A.-M. Merillat, and B. C. Rossier. Membrane topology of the epithelial sodium channel in intact cells. Am. J. Physiol. Cell Physiol. 267: C1682-C1690, 1994[Abstract/Free Full Text].

4.   Canessa, C. M., L. Schild, G. Buell, B. Thorens, I. Gautschi, J.-D. Horisberger, and B. C. Rossier. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 367: 463-467, 1994[Medline].

5.   Coscoy, S., J. R. deWeille, E. Lingueglia, and M. Lazdunski. The pre-transmembrane domain of acid-sensing ion channels participates in the ion pore. J. Biol. Chem. 274: 10129-10132, 1999[Abstract/Free Full Text].

6.   Doyle, D. A., J. M. Cabral, R. A. Pfuetzner, A. Kuo, J. M. Gulbis, S. L. Cohen, B. T. Chait, and R. MacKinnon. The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science 280: 69-76, 1998[Abstract/Free Full Text].

7.   Driscoll, M., and M. Chalfie. The mec-4 gene is a member of a family of Caenorhabditis elegans genes that can mutate to induce neuronal degeneration. Nature 349: 588-593, 1991[Medline].

8.   Firsov, D., L. Schild, I. Gautschi, A.-M. Merillat, E. Schneeberger, and B. C. Rossier. Cell surface expression of the epithelial Na+ channel and a mutant causing Liddle syndrome: a quantitative approach. Proc. Natl. Acad. Sci. USA 93: 15370-15373, 1996[Abstract/Free Full Text].

9.   Hartmann, H. A., G. E. Kirsch, J. A. Drewe, M. Taglialatela, R. H. Joho, and A. M. Brown. Exchange of conduction pathways between two related K+ channels. Science 251: 942-944, 1991[Abstract/Free Full Text].

10.   Ismailov, I. I., T. Kieber-Emmons, C. Lin, B. K. Berdiev, V. G. Shlyonsky, H. K. Patton, C. M. Fuller, R. Worrell, J. B. Zuckerman, W. Sun, D. C. Eaton, D. J. Benos, and T. R. Kleyman. Identification of an amiloride-binding domain within the alpha -subunit of the epithelial Na+ channel. J. Biol. Chem. 272: 21075-21083, 1997[Abstract/Free Full Text].

11.   Kellenberger, S., I. Gautschi, and L. Schild. A single point mutation in the pore region of the epithelial Na+ channel changes ion selectivity by modifying molecular sieving. Proc. Natl. Acad. Sci. USA 96: 4170-4175, 1999[Abstract/Free Full Text].

12.   Kieber-Emmons, T., C. Lin, K. V. Prammer, A. Villalobos, F. Kosari, and T. R. Kleyman. Defining topological similarities among ion transport proteins with anti-amiloride antibodies. Kidney Int. 48: 956-964, 1995[Web of Science][Medline].

13.   Kienker, P., G. Tomaselli, M. Jurman, and G. Yellen. Conductance mutations of the nicotinic acetylcholine receptor do not act by a simple electrostatic mechanism. Biophys. J. 66: 325-334, 1994[Web of Science][Medline].

14.   Krapivinsky, G., I. Medina, L. Eng, L. Krapivinsky, Y. Yang, and D. Clapham. A novel inward rectifier K+ channel with unique pore properties. Neuron 20: 995-1005, 1998[Web of Science][Medline].

15.   Li, X.-J., R.-H. Xu, W. B. Guggino, and S. H. Snyder. Alternatively spliced forms of the alpha  subunit of the epithelial sodium channel: distinct sites for amiloride binding and channel pore. Mol. Pharmacol. 47: 1133-1140, 1995[Abstract].

16.   MacKinnon, R. Pore loops: an emerging theme in ion channel structure. Neuron 14: 889-892, 1995[Web of Science][Medline].

17.   MacKinnon, R., and C. Miller. Mutant potassium channels with altered binding of charybdotoxin, a pore-blocking peptide inhibitor. Science 245: 1382-1385, 1989[Abstract/Free Full Text].

18.   McDonald, F. J., M. P. Price, P. M. Snyder, and M. J. Welsh. Cloning and expression of the beta - and gamma -subunits of the human epithelial sodium channel. Am. J. Physiol. Cell Physiol. 268: C1157-C1163, 1995[Abstract/Free Full Text].

19.   McDonald, F. J., P. M. Snyder, P. B. McCray, Jr., and M. J. Welsh. Cloning, expression, and tissue distribution of a human amiloride-sensitive Na+ channel. Am. J. Physiol. Lung Cell Mol. Physiol. 266: L728-L734, 1994[Abstract/Free Full Text].

20.   Nichols, C. G., and A. N. Lopatin. Inward rectifier potassium channels. Annu. Rev. Physiol. 59: 171-191, 1997[Web of Science][Medline].

21.   Palmer, L. G. The epithelial Na channel: inferences about the nature of the conducting pore. Comments Mol. Cell. Biophys. 7: 259-283, 1991.

22.   Renard, S., E. Linguelglia, N. Voilley, M. Lazdunski, and P. Barbry. Biochemical analysis of the membrane topology of the amiloride-sensitive Na+ channel. J. Biol. Chem. 269: 12981-12986, 1994[Abstract/Free Full Text].

23.   Reuveny, E., Y. N. Jan, and L. Y. Jan. Contributions of a negatively charged residue in the hydrophobic domain of the IRK1 inwardly rectifying K+ channel to K+-selective permeation. Biophysical J. 70: 754-761, 1996[Web of Science][Medline].

24.   Schild, L., E. Schneeberger, I. Gautschi, and D. Firsov. Identification of amino acid residues in the alpha , beta  and gamma  subunits of the epithelial sodium channel (ENaC) involved in amiloride block and ion permeation. J. Gen. Phys. 109: 15-26, 1997[Abstract/Free Full Text].

25.   Snyder, P. M., F. J. McDonald, J. B. Stokes, and M. J. Welsh. Membrane topology of the amiloride-sensitive epithelial sodium channel. J. Biol. Chem. 269: 24379-24383, 1994[Abstract/Free Full Text].

26.   Tucker, J. K., K. Tamba, Y.-J. Lee, L.-L. Shen, D. G. Warnock, and Y. Oh. Cloning and functional studies of splice variants of the alpha -subunit of the amiloride-sensitive Na+ channel. Am. J. Physiol. Cell Physiol. 274: C1081-C1089, 1998[Abstract/Free Full Text].

27.   Voilley, N., E. Lingueglia, G. Champigny, M. G. Mattei, R. Waldmann, M. Lazdunski, and P. Barbry. The lung amiloride-sensitive Na+ channel: biophysical properties, pharmacology, ontogenesis, and molecular cloning. Proc. Natl. Acad. Sci. USA 91: 247-251, 1994[Abstract/Free Full Text].

28.   Waldmann, R., G. Champigny, F. Bassilana, N. Voilley, and M. Lazdunski. Molecular cloning and functional expression of a novel amiloride-sensitive Na+ channel. J. Biol. Chem. 270: 27411-27414, 1995[Abstract/Free Full Text].

29.   Waldmann, R., G. Champigny, and M. Lazdunski. Functional degenerin-containing chimeras identify residues essential for amiloride-sensitive Na+ channel function. J. Biol. Chem. 270: 11735-11737, 1995[Abstract/Free Full Text].

30.   Yellen, G., M. Jurman, T. Abramson, and R. MacKinnon. Mutations affecting internal TEA blockade identify the probable pore-forming region of a K+ channel. Science 251: 939-941, 1991[Abstract/Free Full Text].

31.   Yool, A. J., and T. L. Schwarz. Alteration of ion selectivity of a K+ channel by mutation of the H5 region. Nature 349: 700-704, 1991[Medline].


Am J Physiol Cell Physiol 278(2):C277-C291
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Lazrak, I. Nita, D. Subramaniyam, S. Wei, W. Song, H.-L. Ji, S. Janciauskiene, and S. Matalon
{alpha}1-Antitrypsin Inhibits Epithelial Na+ Transport In Vitro and In Vivo
Am. J. Respir. Cell Mol. Biol., September 1, 2009; 41(3): 261 - 270.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H.-L. Ji, W. Song, Z. Gao, X.-F. Su, H.-G. Nie, Y. Jiang, J.-B. Peng, Y.-X. He, Y. Liao, Y.-J. Zhou, et al.
SARS-CoV proteins decrease levels and activity of human ENaC via activation of distinct PKC isoforms
Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L372 - L383.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-L. Ji and D. J. Benos
Degenerin Sites Mediate Proton Activation of {delta}{beta}{gamma}-Epithelial Sodium Channel
J. Biol. Chem., June 25, 2004; 279(26): 26939 - 26947.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. B. Bruns, B. Hu, Y. J. Ahn, S. Sheng, R. P. Hughey, and T. R. Kleyman
Multiple epithelial Na+ channel domains participate in subunit assembly
Am J Physiol Renal Physiol, October 1, 2003; 285(4): F600 - F609.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H.-L. Ji, C. M. Fuller, and D. J. Benos
Intrinsic gating mechanisms of epithelial sodium channels
Am J Physiol Cell Physiol, August 1, 2002; 283(2): C646 - C650.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Sheng, K. A. McNulty, J. M. Harvey, and T. R. Kleyman
Second Transmembrane Domains of ENaC Subunits Contribute to Ion Permeation and Selectivity
J. Biol. Chem., November 16, 2001; 276(47): 44091 - 44098.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. K. Dudeja
A potential second ion permeability barrier of the epithelial Na+ channel: Focus on "Point mutations in the post-M2 region of human {alpha}-ENaC regulate cation selectivity"
Am J Physiol Cell Physiol, July 1, 2001; 281(1): C15 - C16.
[Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H.-L. Ji, S. Parker, A. L. B. Langloh, C. M. Fuller, and D. J. Benos
Point mutations in the post-M2 region of human {alpha}-ENaC regulate cation selectivity
Am J Physiol Cell Physiol, July 1, 2001; 281(1): C64 - C74.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-L. Ji, M. L. Chalfant, B. Jovov, J. P. Lockhart, S. B. Parker, C. M. Fuller, B. A. Stanton, and D. J. Benos
The Cytosolic Termini of the beta - and gamma -ENaC Subunits Are Involved in the Functional Interactions between Cystic Fibrosis Transmembrane Conductance Regulator and Epithelial Sodium Channel
J. Biol. Chem., September 1, 2000; 275(36): 27947 - 27956.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Langloh, A. L. B.
Right arrow Articles by Benos, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Langloh, A. L. B.
Right arrow Articles by Benos, D. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online