|
|
||||||||
-hENaC play a role in
channel conductance
Departments of 1 Physiology and Biophysics and 2 Physiological Optics, University of Alabama at Birmingham, Birmingham, Alabama 35294-0005; and 3 Department of Physiology, Dartmouth Medical School, Hanover, New Hampshire 03755
| |
ABSTRACT |
|---|
|
|
|---|
The epithelial Na+
channel (ENaC) is a low-conductance channel that is highly selective
for Na+ and
Li+ over
K+ and impermeable to
anions. The molecular basis underlying these conduction
properties is not well known. Previous studies with the ENaC subunits
demonstrated that the M2 region of
-ENaC is critical to channel
function. Here we examine the effects of reversing the negative charges
of highly conserved amino acids in
-subunit human ENaC (
-hENaC)
M1 and M2 domains. Whole cell and single-channel current
measurements indicated that the M2 mutations E568R, E571R, and D575R
significantly decreased channel conductance but did not affect
Na+:K+
permeability. We observed no functional perturbations from the M1
mutation E108R. Whole cell amiloride-sensitive current recorded from
oocytes injected with the M2
-hENaC mutants along with wild-type (wt)
- and
-hENaC was low (46-93 nA) compared with the wt
channel (1-3 µA). To determine whether this reduced macroscopic
current resulted from a decreased number of mutant channels at the
plasma membrane, we coexpressed mutant
-hENaC subunits with green
fluorescent protein-tagged
- and
-subunits. Confocal laser
scanning microscopy of oocytes demonstrated that plasma membrane
localization of the mutant channels was the same as that of wt. These
experiments demonstrate that acidic residues in the second
transmembrane domain of
-hENaC affect ion permeation and are thus
critical components of the conductive pore of ENaC.
site-directed mutagenesis; Xenopus oocytes; dual-electrode voltage clamp; planar lipid bilayers; green fluorescent protein; biotinylation; confocal microscopy; channel pore
| |
INTRODUCTION |
|---|
|
|
|---|
SINCE THE CLONING OF THE epithelial amiloride-sensitive
Na+ channel (ENaC), many of its
biochemical and electrophysiological characteristics have been
elucidated. Human ENaC (hENaC), which is predominantly found in the
epithelia of the colon, lung, and kidney, is composed of three
subunits,
,
, and
(18, 19, 27). The
-subunit
alone forms an amiloride-sensitive
Na+ channel when expressed in
Xenopus oocytes. Coexpression of all three subunits yields a whole cell current ~20-fold larger than that
observed with
-subunit only (18). The hENaC homologue
-NaCh,
which is expressed mainly in brain, pancreas, testis, and ovary, also
produces a small amiloride-blockable conductance in oocytes that is
potentiated by coexpression of the
- and
-hENaC subunits.
However, the biophysical properties of the 

channel are
different from those of the 

channel (28). Therefore, it has
been proposed that
-subunits (or
-subunits) form the conductive
moiety and control the conductive characteristics of the multimeric
channel and that the
- and
-subunits are auxiliary proteins that
augment channel function (4). The
-subunit is also a key target for
the channel-blocking drug amiloride. Specific amino acid residues in
the predicted extracellular loop of this subunit are important to
amiloride binding and block of channel activity (10, 12). One feature
of the channel that is not well defined is the conductive pore. By
analogy to inwardly rectifying (Kir) and voltage-gated
K+ channels, which all share a
homologous pore region, it has been postulated that amino acids in
specific positions in the extracellular and transmembrane domains of
ENaC are important for determination of ion selectivity, permeability,
and conductance.
The putative pore region of Kir channels occurs in the small extracellular loop between the two membrane-spanning domains of each subunit in the channel. It contains the P loop, a critical feature of which is the highly conserved K+ channel signature sequence (Gly-Tyr-Gly) that determines ion selectivity. This channel is a tetramer in which the second transmembrane domain (inner helix) of each subunit is arranged symmetrically around the pore. The positioning of these helices, as well as the location of specific residues in the helices, controls the characteristics of ion conduction in the pore (20). Also, P loops have been characterized in voltage-gated K+ channels, where they occur in the segment connecting the fifth and sixth membrane-spanning regions of the constituent subunits (17, 30, 31). In all cases, P loops serve as the selectivity filter that attracts and concentrates K+ (16).
Hydropathy analysis of the cloned members of the
ENaC/degenerin superfamily has shown them to be
structurally similar to renal outer medulla
K+ channel and Kir
K+ channels, with two large
hydrophobic regions connected by an extracellular segment. Stretches of
amino acids within each hydrophobic region are long enough to span the
membrane and are predicted to have
-helical structure (transmembrane
domains M1 and M2). The hydrophobic residues downstream of M1 (H1
domain) and upstream of M2 (pre-M2 or H2 domain) are extracellular and
assume
-sheet or
-barrel conformations (3). Recent studies with
-subunit rat ENaC (
-rENaC) support a
K+ channel-like P loop model in
which the pre-M2 region dips into the membrane, possibly contributing
to the pore of the channel (22). Previous studies of
-ENaC splice
variants and chimeras have indicated that the second transmembrane
domain is clearly important for
Na+ channel function (15, 26, 29).
Schild et al. (24) demonstrated that mutating a serine residue (S583C)
within the predicted H2 region of
-rENaC (6 residues upstream of the
predicted M2) decreases channel affinity for amiloride and confers
sensitivity to channel block by the divalent cation
Zn2+. They also studied an
-rENaC S580D mutation that results in reduced single-channel
conductance (to Na+ and
Li+) and increased sensitivity
to external Ca2+ block. Waldmann
et al. (29) identified two serine residues (Ser-588 and Ser-592) in the
putative M2 region of
-rENaC that are important to channel
conductance and gating. An S588I point mutation also alters channel
affinity for amiloride.
We have performed
-helical wheel analysis of the two hydrophobic
domains of
-hENaC. The analysis indicated that there are three
negatively charged residues that occur on the hydrophilic face of the
M2 helix and one such residue in the M1 helix. We hypothesize
that these negative charges are part of the conduction pore of the
multimeric channel and are therefore critical to channel function. To
test this hypothesis, we used site-directed mutagenesis to reverse
these charges in
-hENaC. We then assessed the effects of such
mutations by examining the whole cell and single-channel Na+ current produced by
Xenopus oocytes injected with mutant
-hENaC subunits along with wild-type (wt)
- and
-hENaC
subunits. To determine the localization of wt and mutant hENaC channel
proteins in the oocytes, we injected enhanced green fluorescent protein (EGFP)-tagged ENaC constructs and examined their cellular location with
confocal laser scanning microscopy.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Preparation of Site-Directed Mutants
The full length
-,
-, and
-hENaC cDNAs were a kind gift of Dr.
M. J. Welsh (University of Iowa). Site-directed mutants were created
using the Quick Change mutagenesis kit (Stratagene, La Jolla, CA).
Primers were designed to be complementary to the sense and antisense
sequences of a particular region of
-hENaC. Each set of primers
contained the necessary base changes required to code for an
arginine instead of the wt glutamic or aspartic acid. In the cases
reported here, two adjacent bases in each primer were altered from the
wt sequence. Plasmid DNA was subjected to the following PCR protocol,
using one set of mutagenic primers: 1 cycle at 95°C for 1 min to
denature the DNA and then 16-17 cycles of 95°C for 30 s,
55°C for 1 min, and 68°C for 12-13 min. Parental (nonmutated) DNA was removed from completed PCR reactions by digestion with Dpn I at 37°C for 1 h. This
enzyme is specific for methylated DNA and will not digest the
nonmethylated PCR products. These products were then transformed into
supercompetent Escherichia coli (XL1 BLUE, Stratagene) and grown
on Luria-Bertani (+50 µg/ml ampicillin) agar overnight
at 37°C. Colonies were picked and grown up overnight, and the DNA
was isolated according to a standard alkaline lysis miniprep procedure.
Positives for the specific mutation encoded by the PCR primers were
confirmed by dideoxy sequence analysis.
In Vitro Transcription
Mutated DNA samples were in vitro transcribed using the SP6 and T7 mMessage mMachine kits (Ambion, Austin, TX). Briefly, ~1 µg of DNA was combined with appropriate reaction buffer, a mixture of all ribonucleotide triphosphates and m7G(5')ppp(5')G analog, and SP6 or T7 RNA polymerase. Transcription proceeded at 37°C for 5-6 h. Template DNA was digested with DNase at 37°C for 15 min and then extracted and precipitated. The quality and size of the cRNA was confirmed by denaturing formaldehyde-agarose gel electrophoresis. RNA concentration was approximated by ultraviolet spectrophotometric measurement of optical density (
= 260 nm).
Oocyte Preparation and Microinjection
Oocytes were surgically removed from ice/tricaine-anesthetized adult female Xenopus laevis by standard techniques. Surrounding follicle cells were removed by digestion with 3 mg/ml collagenase (Boehringer Mannheim, Indianapolis, IN) in Ca2+-free OR-2 medium (in mM: 82.5 NaCl, 2.4 KCl, 1.8 MgCl2, and 5 HEPES, pH 7.4) for 45-90 min at room temperature with constant agitation. Defolliculated oocytes were washed several times with OR-2 and allowed to recover for 24 h in half-strength Leibovitz medium (0.5× L-15; Sigma, St. Louis, MO) at 18°C. Groups of stage V and VI eggs were injected via a microinjector (World Precision Instruments, Sarasota, FL) with 50 nl (12.5 ng) of the following cRNAs (all subunit mixtures were 1:1:1): 1) wt
-hENaC + wt
-hENaC (wt
) + wt
-hENaC (wt
); 2) M1
mutant
-hENaC (
E108R) + wt
+ wt
;
3) M2 E568R mutant
-hENaC
(
E568R) + wt
+ wt
; 4) M2
E571R mutant
-hENaC (
E571R) + wt
+ wt
;
5) M2 D575R mutant
-hENaC
(
D575R) + wt
+ wt
; 6)
E568R + E571R + D575R mutant
-hENaC (
triple mutant) + wt
+ wt
.
When injected oocytes were to be processed for membrane vesicles to be incorporated into planar bilayers, 80-100 eggs were injected with the appropriate cRNA. Otherwise, 10-20 eggs were injected for dual-electrode voltage-clamp recordings. In both cases, injected oocytes were maintained for 2 days in 0.5× L-15 at 18°C before processing or recording.
To demonstrate that the EGFP-rENaC constructs that were used for
confocal laser scanning fluorescence microscopy experiments produced
whole cell amiloride-sensitive Na+
current similar to that produced by the constructs above, normal (not
albino) oocytes were injected with 12.5 ng of the following combinations of cRNAs (in a 1:1:1 ratio): wt
-hENaC + GFP-
-rENaC + GFP-
-rENaC; and D575R
-hENaC + GFP-
-rENaC + GFP-
-rENaC.
Oocyte Membrane Vesicle Preparation
Oocytes injected with cRNA were washed three times with 3 ml of high-K+ 300 mM sucrose buffer (in mM: 400 KCl, 5 PIPES, and 300 sucrose), and homogenized in 600 µl of the same buffer, on ice for 5 min. The homogenate was centrifuged through a sucrose gradient (high K+-20% sucrose and high K+-50% sucrose) at 18,500 rpm for 30 min. The resulting interface between the gradients was drawn off, diluted with 3-4 ml of high-K+ buffer, and centrifuged at 23,500 rpm for 45 min. The pellet was dissolved in 200 µl buffer A (in mM: 100 KCl, 5 MOPS, and 300 sucrose), aliquoted, and stored at
20°C until bilayer
incorporation experiments were performed.
Electrophysiological Recording
Whole cell.
Membrane currents in oocytes were evaluated at 20°C by
double-electrode voltage clamp. Oocytes were impaled with two 3 M
KCl-filled electrodes with resistances of 0.5-2.0 M
, connected
to a TEV-200 voltage-clamp system (Dagan, Minneapolis, MN). Two
reference electrodes were connected to the bath by 3 M KCl-3% agar
bridges. The bathing solution (ND-96; in mM: 96 NaCl, 1 MgCl2, 1.8 CaCl2, 2 KCl, and 5 HEPES, pH 7.4)
was perfused by gravity at a rate of 1.5 ml/min. The voltage clamp was
controlled by pCLAMP 5.5 software (Axon Instruments, Burlingame, CA),
and current was constantly monitored on a strip chart recorder. Oocytes
were clamped at a holding potential of 0 mV. Current-voltage
(I-V)
relations were acquired by stepping the holding potential at 500-ms
intervals in 20-mV increments from
100 to +80 mV.
I-V
data were recorded 4-5 min after impalement of the oocyte and then
again 3 min after the addition of 10 µM amiloride to the bath. Data
analysis was performed with pCLAMP 5.5 software.
Planar lipid bilayers.
Oocytes expressing the different mutant or wt
-hENaC cRNAs (along
with wt
- and wt
-hENaC) were processed to yield enriched membrane vesicles that were fused with artificial planar lipid bilayers. Bilayers were composed of a phospholipid solution containing a 2:1 mixture of diphytanoyl-phosphatidylethanolamine and
diphytanoyl-phosphatidylserine in
n-octane. Bilayers were bathed with
100 mM NaCl and 10 mM MOPS-Tris (pH 7.4) solutions. Applied voltage was
referred to the virtually grounded
trans chamber. Amiloride was added to
the trans compartment to give a final
concentration of 0.3 µM. Ion selectivity of the channels incorporated
into the bilayer was examined by substituting 100 mM KCl for 100 mM
NaCl in the cis compartment. Records
were digitally filtered at 100 Hz using pCLAMP software, subsequent to
acquisition of the analog signal filtered at 300 Hz with an 8-pole
Bessel filter before acquisition at 1 ms/point.
Cell-attached patch clamp.
Oocytes were shrunken in hypertonic medium, and the vitelline membranes
were removed before patch clamping. The cell-attached configuration was
used to record single-channel current with an Axopatch 1B amplifier
(Axon Instruments). The borosilicate glass pipettes were made with a
PP-83 vertical puller (Narishige, Tokyo, Japan), and the tips were
polished. The tip resistance was 5-10 M
when electrodes were
filled with the extracellular medium (100 mM LiCl, 10 mM HEPES, and 2.0 mM CaCl2, pH 7.4). The currents were collected by CLAMPEX 7.0 (Axon Instruments) at the sampling interval of 500 µs. All-point amplitude histograms of recordings >3
min were employed to measure the current level.
Preparation of GFP-rENaC Constructs
pGFP-C1/
-rENaC was constructed by excising
-rENaC from
pSport/
-rENaC with Sal
I/Kpn I and ligating the excised
fragment into Sal
I/Kpn I-digested EGFP plasmid
(pGFP-C1; Clontech, Palo Alto, CA). To remove two pre-existing stop
codons between the Sal I site and an
initiator methionine in
-rENaC, a 563-bp PCR fragment was
synthesized using
-rENaC cDNA as a template with a sense primer
(ACGCGTCGACGGTGCCACCATGCCAGTGAAGAAGTA- CCT) corresponding to
nucleotides 1-20 of
-rENaC and an antisense primer
(GGTGCTTCCTGGGGCTGGGTTGCTGCTGTT) corresponding to nucleotides
514-543 of
-rENaC. The sense primer also contained an upstream
Sal I restriction site and a Kozak consensus site sequence. The amplified PCR product contained a unique
BsmB I restriction site just upstream
of the antisense primer sequence. PCR was performed by denaturing the
reaction mixture at 94°C for 1 min, followed by 2 cycles of 1 min
at 94°C, 1 min at 60°C, and 2 min at 72°C, then 24 cycles
of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C, and a
final extension at 72°C for 10 min. The 563-bp PCR product was
isolated, purified (Wizard, Promega, Madison, WI), and subcloned into
pcR 2.1 (TA cloning kit, Invitrogen, Carlsbad, CA), and the sequence
was verified by ABI PRISM dye terminator cycle sequencing
(Perkin-Elmer, Foster City, CA). The fusion cDNA pEGFP-
-rENaC was
constructed by digesting the subcloned PCR product with
Sal
I/BsmB I and ligating the gel-purified 316-bp PCR fragment into the Sal
I/BsmB I-digested pEGFP-
-rENaC cDNA. EGFP-
-rENaC was subcloned from pEGFP-
-rENaC into
pcDNA3.1
(Invitrogen) using
Nhe I and
Kpn I (to generate
pcDNA3.1
/EGFP/
-rENaC).
The sequence of both strands was confirmed by ABI PRISM dye terminator
cycle sequencing.
pGFP-
-rENaC was constructed by excising
-rENaC from
pSport/
-rENaC with Sal
I/Kpn I and ligating the excised
fragment into Sal
I/Kpn I-digested pGFP-C2 (Clontech).
GFP-
-rENaC was subcloned from pGFP-C2/GFP/
-rENaC into
pcDNA3.1
(Invitrogen) using
Nhe I. pcDNA3.1
was digested with
Nhe I and treated with calf intestinal
alkaline phosphatase to prevent self-ligation (to generate
pcDNA3.1
/GFP/
-rENaC).
The sequence of both strands was confirmed by ABI PRISM dye terminator
cycle sequencing. These GFP constructs are referred to throughout as
GFP-
-rENaC and GFP-
-rENaC.
Oocyte Preparation for Confocal Microscopy
Adult female albino X. laevis frogs were obtained from Xenopus I (Dexter, MI) and maintained in the same conditions as normal X. laevis frogs. Stage V and VI oocytes were isolated from an ice/tricaine-anesthetized frog, as described above. Eggs were defolliculated with 3 mg/ml collagenase (Boehringer Mannheim) in Ca2+-free OR-2 medium for 1 h at room temperature with constant agitation. They were washed several times in OR-2 and then stored in 0.5× L-15 at 18°C. Oocytes were injected 24 h postisolation with 12.5 ng (in 50 nl) of the following cRNAs (in a 1:1:1 ratio): wt
-hENaC + GFP-
-rENaC + GFP-
-rENaC; mutant
-hENaC + GFP-
-rENaC + GFP-
-rENaC; and GFP-
-rENaC + GFP-
-rENaC.
A group of oocytes was also injected with 50 nl of water, as a control
for background fluorescence.
-hENaC and EGFP cRNAs were generated
with the mMessage mMachine in vitro transcription kits, as described
above. Maximum hENaC channel activity was observed in oocytes ~48 h
after cRNA injection. Therefore, oocytes were processed for confocal
microscopy 2 days postinjection. To identify the plasma membrane, 10 eggs from each injection group were surface biotinylated. The eggs were
equilibrated in ND-48 (in mM: 48 NaCl, 48 N-methyl-D-glucamine chloride, 1 MgCl2, 1.8 CaCl2, 2 KCl, and 5 HEPES, pH
7.4). Eggs were incubated twice consecutively in 2 ml of ND-48
containing 1.0 mg/ml EZ-Link Sulfo-NHS-LC-Biotin (Pierce, Rockford, IL)
for 30 min at room temperature with gentle agitation. The reaction was
stopped by washing the oocytes once with ND-48 and incubating them in
100 mM glycine in ND-48 for 10 min at room temperature with agitation.
Each group of eggs was washed once with ND-48 and then
transferred to fresh dishes containing 2 ml of 10 µg/ml Texas
red-conjugated streptavidin (Molecular Probes, Eugene, OR) in ND-48.
Labeling was carried out in the dark at 4°C for 1 h. As a control,
a group of 10 wt-injected oocytes that were not biotinylated were
treated with the Texas red-streptavidin as above. Eggs were washed
several times with ND-48 and stored in the same solution for the
duration of the confocal microscopy.
Confocal Microscopy
Images were acquired using an Olympus Fluoview BX50 upright confocal laser scanning microscope, equipped with a UplanF1 ×10, 0.30 numerical aperture air objective and air-cooled krypton and argon lasers. The 488-nm argon laser line and the 568-nm krypton laser line excited the EGFP and Texas red, respectively. EGFP fluorescence was collected through the 510-nm and 550-nm barrier filters and Texas red fluorescence through the 610-nm filter. X-Y scans were obtained at 12-bit resolution at approximately the midsection of each oocyte. Acquired images were imported into Adobe Photoshop 5.0 for processing.| |
RESULTS |
|---|
|
|
|---|
Generation of
-hENaC Mutants
-helical wheel analysis of the M1 and M2 sequences
are shown in Fig.
1A,
and the residues examined in this study are indicated by gray shading.
According to this analysis, these gray residues occur on the
hydrophilic sides of the helices. Figure
1B shows sequence alignments of just
the second large hydrophobic regions (H2 and M2) of several of the
cloned ENaCs. It demonstrates the relative positions and
conserved nature of the M2 residues that we have mutated and analyzed.
We used site-directed mutagenesis to change these glutamic and aspartic
acids to arginines (point mutants
E108R,
E568R,
E571R, and
D575R). In this manner, the specific negatively charged amino acids
in M1 and M2 were changed to positively charged residues.
Additionally, the following combination mutants were generated: E568R + E571R, E568R + D575R, and E568R + E571R + D575R (triple). All mutant
constructs were confirmed by sequence analysis.
|
Functional Studies With wt and Mutant
-hENaCs


-hENaC or mutant
-hENaC + wt
-hENaC + wt
-hENaC cRNA. Channel activity was recorded 48 h after injection.
Channel activity expressed by the M1 mutant
-hENaC is seen in Fig.
2A. These
results demonstrate a magnitude of whole cell current that was similar
to that seen for the wt 

-hENaC channel. The inward
Na+ currents recorded during the
voltage-clamp protocol, before and after the addition of 10 µM
amiloride, for the wt and the mutant were the same. The average
amiloride-sensitive component of the whole cell current in both cases
was equivalent (Fig. 2B). The I-V
curves for the two channels were very similar. The reversal potentials
were +15 mV for the wt and +10 mV for the mutant. These data indicate
that there was little or no effect of this M1 point mutation on
Na+ channel function at the whole
cell level. Oocytes injected with these same combinations of 

cRNAs were processed to obtain membrane vesicles that were then fused
to an artificial planar lipid bilayer for single-channel analysis.
Single-channel records for wt
-hENaC and for the M1 mutant
-hENaC
are shown in Fig. 3A.
The apparent unitary conductance of both channels was 13 pS. Their open
probabilities
(Po) were
essentially the same at 0.13 ± 0.02 (n = 3) for wt and 0.15 ± 0.02 (n = 4) for the mutant
E108R. The
amiloride dose-response curves (Fig.
3B) indicate that the M1 mutation
did not alter the amiloride sensitivity of the channel, and the
apparent equilibrium dissociation constant of amiloride (Kami) for both channels was
0.2 µM. The wt and
E108R channels were recorded in symmetrical 100 mM NaCl solutions, and the plots of the resulting
I-V
relationships are shown in Fig. 3C.
The curves were both linear with reversal potentials of 0 mV.
I-V
curves for the channels recorded in the bi-ionic conditions of 100 mM
NaCl trans and 100 mM KCl
cis are also plotted. The wt and
mutant channels were both more selective for
Na+ over
K+ and became slightly inwardly
rectified with a reversal potential of +60 mV under the asymmetrical
conditions.
|
|
When the M2
-hENaC mutant constructs were coinjected with wt
-hENaC and wt
-hENaC into oocytes, the resulting whole cell currents were markedly smaller than those of the wt
-hENaC-injected eggs (Figs. 4 and
5). The average amiloride-sensitive current for wt was
3,017.6 ± 769.4 nA
(n = 8). The average
amiloride-sensitive currents expressed by the M2 mutants were
60.9 ± 17.7 (n = 5),
93.2 ± 26.9 (n = 4),
46.3 ± 7.8 (n = 7), and
22.0 ± 8.1 (n = 5) nA for
E568R,
E571R,
D575R, and the
triple mutant, respectively (Fig. 5). The
I-V
plots in Fig. 4 demonstrate a significantly smaller amiloride-sensitive
current for the M2 mutants than for the wt channel (P < 0.05).
They also indicate a slight rectification of the whole cell currents
from the mutant-expressing oocytes. The single-channel characteristics
of the M2 point mutant,
D575R, were examined in the planar lipid
bilayer system and also by cell-attached patch clamp of
hENaC-expressing oocytes. As seen in Fig.
6A, in the
bilayer, the
D575R hENaC + wt
-hENaC + wt
-hENaC channel had a
smaller unitary conductance (9 pS) than did wt (13 pS). The
Po values of the
two channels were similar: 0.14 ± 0.02 for wt
(n = 3) and 0.13 ± 0.02 for
D575R (n = 3). The
D575R
mutation appeared to have a small effect on the amiloride sensitivity
of the channel determined from the amiloride dose-response curves shown
in Fig. 6B. The
Kami for the mutant channel
was twofold greater (0.45 ± 0.035 µM,
n = 3) than that of wt (0.20 ± 0.018 µM, n = 3). The
I-V
relationships plotted in Fig. 6C
demonstrate the decreased conductance of the mutant, as well as inward
rectification of the single-channel current, under symmetrical NaCl
conditions. Conductances of both channels decreased when KCl was
substituted for NaCl in the cis
chamber. The shift in reversal potential for the
D575R mutant in
asymmetrical conditions was not significantly different from the shift
in the wt curve under the same conditions. These results indicate that the
Na+:K+
selectivity of hENaC was not affected by the M2 mutation. The M2
mutants,
E568R and
E571R, were examined in the same manner in the
bilayer and gave identical results (not shown). Additionally, oocyte
membrane vesicles containing the triple
-hENaC mutant were also
incorporated into the planar lipid bilayer. An amiloride-sensitive Na+ conductance could not be
measured for this mutant (data not shown).
|
|
|
As an alternative way of looking at the single-channel nature of the wt
and mutant channels, oocytes expressing wt
- or
D575R hENaC,
along with wt
- and wt
-hENaC, were patch clamped 2 days postinjection. Figure 6D shows
representative current recorded from cell-attached patches clamped at
60 mV. The mutant channel conductance was 5 pS, which was
~30% smaller than the wt conductance of 7 pS. It was considerably
more difficult to find channel-containing patches in the
mutant-expressing oocytes (1 out of 6 patches showed mutant channel activity).
Confocal Fluorescence Microscopy of GFP-Injected Oocytes
To visualize the cellular localization of the ENaC proteins, we prepared cDNA constructs with an EGFP sequence subcloned upstream of the start of the
-rENaC or
-rENaC insert. The corresponding cRNAs for these constructs were coinjected with the various
-hENaC constructs. We first measured the whole cell current produced by the expression of
-hENaC with GFP-tagged
- and
-rENaC
subunits. Figure 7 shows that the wt
-hENaC combination produced whole cell amiloride-sensitive current
that was equivalent to the current shown in Fig.
2A for wt
-hENaC + wt
-hENaC + wt
-hENaC. The
D575R mutant, coexpressed with
GFP-tagged
- and
-subunits, produced the same low-level
amiloride-sensitive current that was observed in Fig. 4. Average
amiloride-sensitive currents were
2,690.5 ± 1,262.1 (n = 4) and
24.4 nA for the wt
and mutant, respectively (Fig. 5). These data established that the
channels formed by the GFP-tagged subunits were functionally
identical to the channels formed by wt
- and
-hENaC constructs.
|
For confocal laser scanning fluorescence microscopy, oocytes were
injected and processed as described under Oocyte
Preparation for Confocal Microscopy. As a
control, oocytes injected with 50 nl of water and surface labeled were
imaged and compared with eggs injected with wt
-hENaC + GFP-
-rENaC + GFP-
-rENaC. Each set of three images in Fig.
8 shows a similar optical section of
oocytes obtained by a dual-laser scan at approximately the midpoint of
the egg. The biotinylation protocol labeled proteins in the plasma
membrane of the eggs with Texas red. As seen in Fig. 8,
A1 and
B1, the membrane of the cells was
clearly defined by a distinct ring of Texas red fluorescence. The
compact band of GFP fluorescence seen around the perimeter of the wt


-injected egg (Fig. 8A2)
represents the localization of the ENaC protein. The water-injected
oocyte showed no GFP fluorescence (Fig.
8B2) compared with the wt,
indicating that the background fluorescence of the oocytes in this
emission spectrum was negligible. Figure 8A3 is an overlay of the
A1 and
A2 images and shows the colocalization of the GFP and Texas red fluorescence, which appears as yellow. This
confirms that some of the wt hENaC channel expressed by the oocyte was
successfully inserted into the plasma membrane, accounting for the
1-3 µA of whole cell current. Figure
8B3 is the overlay of images
B1 and
B2; there is no yellow fluorescence,
since there was no detectable GFP fluorescence in the water-injected
oocyte.
|
Oocytes that were injected with a 1:1 mixture of the GFP-
-rENaC and
GFP-
-rENaC cRNAs were surface biotinylated 2 days after injection
and viewed with the confocal imaging system in the same manner as
described for Fig. 8. Figure 9 compares the
fluorescence of these oocytes to that of wt hENaC-expressing oocytes.
Figure 9, A1 and
B1, shows the Texas red-labeled plasma
membrane of the two eggs. The 

channel GFP fluorescence is
shown in Fig. 9A2, and its
localization in the membrane is demonstrated by the yellow fluorescence
in Fig. 9A3. The expression of the
- and
-subunits alone produced a pattern of GFP fluorescence that
appeared as a diffuse band of green under the plasma membrane (Fig.
9B2). There was negligible
colocalization of the
- and
-rENaCs with the red fluorescence at
the membrane, as indicated by the absence of yellow in Fig.
9B3. This finding is consistent with
previous findings that
-rENaC and
-rENaC are not trafficked to
the oocyte plasma membrane without the
-subunit (8).
|
With the same labeling and imaging protocol, we examined the cellular
localization of two of the point mutants,
E571R and
D575R. These
constructs were coinjected into oocytes with GFP-
-rENaC and
GFP-
-rENaC. Figure 10,
A1,
B1, and
C1, shows the red-labeled plasma
membrane of wt-,
E571R-, and
D575R-expressing oocytes. The GFP
fluorescence patterns of the same oocytes are seen in Fig. 10,
A2,
B2, and
C2. Compared with the wt channel (Fig.
10A2), the GFP localization of both
mutants was very similar (Fig. 10, B2
and C2). Their tight green bands of
fluorescence colocalized with the red fluorescence of the membrane, as
seen by the yellow in Fig. 10, B3 and
C3. Thus it appears that the mutants
were localized in the plasma membrane, just like the wt. On some
occasions, when these experiments were repeated, the relative strength
of the GFP fluorescence signal at the membrane of the mutant-injected oocytes was weaker than that of the wt GFP fluorescence.
|
| |
DISCUSSION |
|---|
|
|
|---|
The cloning of ENaC has aided the study of the epithelial
Na+ channel conductance and gating
characteristics, ion selectivity, and inhibition by amiloride.
Identification of the conductive pore of the channel will help further
the understanding of its functional properties, as well as clarify the
nature of the interaction of its constitutive subunits in the membrane.
In terms of their location in the transmembrane
-helices and their
distinct conservation throughout the ENaCs (Fig. 1), we hypothesized
that the few charged amino acids in the membrane-spanning domains of
-hENaC are potentially important pore residues.
By site-directed mutagenesis, we reversed the charge of Glu-108 in M1,
changing the glutamate to arginine. Coexpression of this mutated form
of
-hENaC with wt
-hENaC and wt
-hENaC in oocytes produced
whole cell amiloride-sensitive current of the same magnitude as that
seen in oocytes expressing wt
-hENaC together with the wt
- and
-subunits. This result indicates that the point mutation did not
affect macroscopic channel function. When examined at the
single-channel level in the bilayer, the mutant
-hENaC had the same
unitary conductance (13 pS) as the wt. The mutation did not appear to
alter amiloride sensitivity of the channel or
Na+:K+
selectivity. The negative results for this point mutant serve as a
control to show that the more drastic effects of the M2 mutants on
channel function are not a result of the mutagenesis and in vitro
transcription procedures or a problem of heterologous expression in the
oocyte. These data indicate that the one negatively charged residue in
the M1 domain of
-hENaC is not critical for movement of
Na+ through the channel. In the
K+ channels, the second
transmembrane domains (the inner helices) of the four subunits that
come together to form the channel are oriented to face the center of
the pore, whereas the M1 domain of each subunit is situated away from
the pore, facing the membrane (6). It is possible that
-hENaC
orients itself around the conductive pore in a similar fashion. On the
other hand, Coscoy et al. (5) recently identified a nine-amino acid
region preceding the first transmembrane domain of ASIC2 and its splice
variant ASIC2b that affects the ion selectivity and pH dependence of
the neuronal channel formed by these ENaC homologues. Thus it seems premature to rule out some role of
-hENaC M1 region in the ion pore.
The M2 point mutations
E568R,
E571R, and
D575R had a much more
significant effect on the amiloride-sensitive
Na+ channel activity. In the
oocyte, the mutant channels demonstrated reduced levels (50-100
nA) of amiloride-sensitive whole cell current. This was significantly
lower than the 1-3 µA seen in wt 

-hENaC-injected oocytes. Also, the
I-V
relationships plotted for the mutant channels (Fig. 4) indicate that
representative whole cell currents were inwardly rectified. Such inward
rectification was seen as well in the single-channel
I-V
relationship for the point mutant
D575R (Fig.
6C). This finding suggests that
these specific residues are likely part of the conductive pore of the
channel, since alteration of them affects both the magnitude and the
voltage dependence of the Na+
conductance. The mechanism by which these charge reversals actually invoke the inward rectification of the current is unknown. The
double mutants, E568R + E571R and E568R + D575R, and the
triple mutant, E568R + E571R + D575R, all produced amiloride-sensitive whole
cell current that was at least 20-fold less than wt (data for the
double mutants are not shown).
Several laboratories have determined that charged residues in the pore
region and inner helix (M2) of various Kir channels are important for
channel conductance and/or ion selectivity. Krapivinsky et al. (14)
recently cloned a new member of the Kir family, Kir 7.1. This channel
demonstrates lower single-channel conductance than the other Kir
channels and a decreased sensitivity to block by external
Ba2+ and
Cs+. There are three amino acids
in the pore region of Kir 7.1 that are thought to contribute to the
observed functional differences, as they differ from the conserved
corresponding residues in the other members of the family. Mutation of
one of these, Met-125, to the arginine that is conserved in other Kir
channels produced a channel with a much higher conductance than the wt
and an increased sensitivity to
Ba2+. Studies of IRK1 show that
the acidic residue, Asp-172, in the second hydrophobic segment affects
channel function and block by internal
Mg2+, indicating that it is
positioned in the permeation pathway. Additionally, its size and/or
charge contribute to channel selectivity (23). Experiments with a
different type of channel, the nicotinic ACh receptor, have
demonstrated that reversing the negatively charged residues occurring
on both sides of the M2 regions of the constituent
-,
-,
-,
and
-subunits reduces channel conductance significantly. Proposed
explanations for this finding include perturbation of electrostatic
forces, charge mutation-induced changes in pore structure, or
alteration in ionic energy in the narrow region of the pore (13).
Waldmann et al. (29), who made
-rENaC/Mec-4 chimeras to confirm that
the M2 region plays an important role in characteristic ENaC function,
also demonstrated that the
-subunit point mutations S588I and S592I
cause an increase in the channel conductance for Na+ and fast voltage-dependent
gating. According to
-helical wheel analysis, the serines involved
in these mutations occur on the same side of the M2 helix as the
glutamate and aspartate residues that we examined. These data support
the idea that the M2 region of
-hENaC is oriented in the membrane
such that its hydrophilic face is an integral part of the conductive
pore and that certain amino acids along that side of the helix are
critical to ion permeation. Whether the size of the residue side chains
or their polarity is more important remains to be determined.
Interestingly, Waldmann et al. (29) constructed a chimera
that exchanged residues 597-602 in
-rENaC with the homologous
region of Mec-4. This included an E599F switch. Glu-599 in
-rENaC
corresponds to Asp-571 in
-hENaC, which we mutated in these
experiments. The properties of the chimera are
indistinguishable from wt
-rENaC, whereas our
-hENaC D571R point
mutant demonstrated reduced whole cell and single-channel conductance
compared with wt hENaC channels. One explanation for these findings
could be that the E599F change is not severe enough to evoke the
conductance change that we saw with the D571R change. Alternatively,
replacing the other residues around the
-rENaC Glu-599 with the
corresponding Mec-4 residues could help maintain the channel
properties, because it is thought that degenerins may function as
channel proteins (7).
Kellenberger et al. (11) analyzed the monovalent and divalent cation
permeability of heterotrimeric channels formed with
-rENaC Ser-589
mutants and determined that the geometry and size of the pore at the
selectivity filter region influence what ions pass through the channel.
Their experiments indicate that residue side chains affect the size and
shape of the pore and thereby create a "molecular sieving"
effect. Similarly, X-ray crystallographic studies of the
KcsA K+ channel
suggest that the arrangement of residues, specifically the main chain
carbonyl oxygen atoms in the selectivity filter of the pore region,
creates sites that accommodate K+
in a size-specific manner (6). On the basis of these results and
earlier work by Palmer (21), Kellenberger et al. (11) propose a model
of the ENaC pore in which the H2 segments of the constituent subunits
form a funnel-shaped outer channel vestibule that narrows down to a
very constricted selectivity filter that is composed of the conserved
serine residues at the start of the M2 region of each subunit. The M2
segments, arranged such that they gradually open up to the cytoplasm,
form the intracellular mouth of the pore.
Examination of our
-hENaC M2 single point mutants in the planar
lipid bilayer revealed that each of the individual charge reversals
produced channels with a 30% lower unitary conductance than the wt (9 pS for the mutants vs. 13 pS for the wt). The amiloride sensitivity of
the mutant channel was slightly less than the wt, and its selectivity
for Na+ over
K+ was not altered. According to
our analysis, residues 568, 571, and 575 occur in the middle of the M2
helix. On the basis of the model described above and that proposed for
the conductive pore of K+
channels, this location is near the inner mouth of the pore, slightly
removed from the putative P loop/selectivity filter that lies at the
outer mouth. It is also >300 residues downstream from a putative
amiloride-binding sequence (10, 12). Thus we predict that the role of
these residues in the channel pore would be to attract or bind
Na+ and aid in their movement
through the pore. A role in selectivity or channel block seems less
likely because of their location. They may create electrostatic energy
wells for the diffusing ions, or their negative charges may help
increase the concentration of cations at the intracellular entryway of
the channel. In the case of the KcsA
K+ channel, the intracellular and
extracellular openings are negatively charged by acidic amino acids
(6).
It is interesting that when measured by dual-electrode voltage clamp,
our M2 mutant channels produced extremely low amiloride-sensitive whole
cell current in the oocytes, and yet when recorded in the planar lipid
bilayer the same channels had substantial unitary conductances of 9 pS.
One explanation for this apparent discrepancy is that many of the
mutant channels expressed at the oocyte plasma membrane were
functioning transiently or were nonfunctional due to the mutations in
the
-subunit. The mutations could have caused enough of a
conformational or steric change in the pore-lining M2 domains that, the
majority of the time, they created a nonconductive pore. This is
despite the fact that the three subunits did associate to the degree
required for normal trafficking to the plasma membrane. A phenomenon
such as this was observed by Krapivinsky et al. (14), who reported that
a point mutation (G129E) in the pore region of Kir 7.1 produced no
measurable whole cell current. However, localization of the mutant
channel at the plasma membrane was the same as wt.
Regarding the differences in the conductances of the hENaC channels
measured in the bilayer and the oocyte, our laboratory has studied the
effect of actin on the channel in the bilayer. When actin was added to
the cytoplasmic side of the bilayer, the unitary conductance of the wt
channel decreased to 6-7 pS (a single-channel conductance
consistent with that measured in the cell-attached patch-clamp
experiments) and the conductance of the
D575R mutant decreased to 4 pS. This conductance is more representative of the channel, since it is
expressed in conjunction with the actin cytoskeleton in the oocyte (see
Ref. 2).
An obvious explanation for the small macroscopic current observed with
the mutant
-subunits is that the channels were not processed or
trafficked correctly, such that their insertion into the plasma
membrane was hindered. To determine whether this was the case, we
examined the localization of the hENaCs in live oocytes. We coexpressed
our mutant and wt
-hENaC subunits with GFP-tagged
- and
-rENaC
subunits. Laser scanning confocal sections from the middle of an oocyte
injected with wt
-hENaC + GFP-
-rENaC + GFP-
-rENaC showed a
distinct band of GFP fluorescence that colocalized with the plasma
membrane. This same wt channel produced 1-3 µA of whole cell
amiloride-sensitive current. Together, these data indicate that the
three subunits formed functional channels that were predominantly
localized in the plasma membrane of the oocyte.
In contrast, oocytes expressing only the GFP-tagged
- and
-rENaCs
showed a pattern of fluorescence that was consistent with previous
findings of Firsov et al. (8). They expressed epitope-tagged
-,
-, and
-subunits and combinations thereof in oocytes and used
antibody binding assays to demonstrate that
- or
-subunits alone
are not present at the cell surface. They also found that
+
,
+
, and
+
demonstrate no surface antibody binding. These
data corroborate our results that the GFP-tagged
- and
-subunits
showed intracellular fluorescence, rather than plasma membrane
fluorescence, and that the GFP fluorescence in wt 

-expressing oocytes demonstrated the association of the
-subunit with the
-
and
-subunits in the plasma membrane. Visualizing specific endoplasmic reticulum (ER) localization of our GFP-tagged proteins in
whole oocytes was difficult, due to the size of the cell and the
limitations of the microscope objective. It is likely that there was
GFP fluorescence in the dense ER network surrounding the nucleus and
also in the cytoplasmic ER extending to the plasma membrane.
Unfortunately, the oocyte is relatively large, and the working distance
of the ×10 objective used is relatively short. Consequently, the
fluorescence emission from perinuclear regions and cytoplasm was
undetectable. This is why the oocytes in Figs. 8-10 showed no GFP
fluorescence in the middle. The green fluorescent emission in and
proximal to the plasma membrane was much more distinguishable due to
the thinness of the membrane and the fact that the fluorophores there
were more accessible to direct laser excitation.
The localization of GFP fluorescence in oocytes expressing the
-hENaC mutants
E571R and
D575R was similar to or only slightly less than that observed in wt
-hENaC-injected eggs. These results provide strong evidence that the mutant
-subunits successfully associated with the
- and
-rENaC subunits and that this complex was trafficked to the plasma membrane. Thus the reduced whole cell
current expressed by these point mutants was not solely due to a
decrease in channel expression at the cell surface. These data support
our single-channel measurements that indicate that a critical effect of
reversing any or all of the negatively charged residues in the second
transmembrane segment of ENaC
-subunit was to reduce channel
conductance. These studies thereby demonstrate that the M2 domain forms
part of the conductive pore of the channel and that acidic residues
near the internal mouth of the pore are important for the movement of
Na+ through the channel.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Michael Duvall for initial assistance with oocyte recording and data analysis, Kathy Karlson for technical assistance, Dr. Michael Welsh for the gift of the hENaC cDNAs, and Dr. Bernard Rossier for the gift of the rENaC cDNAs.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-56095 (to D. J. Benos) and DK-34533 (to B. A. Stanton).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: D. J. Benos, Dept. of Physiology and Biophysics, University of Alabama at Birmingham, 1918 University Blvd. MCLM 704, Birmingham, AL 35294-0005 (E-mail: benos{at}physiology.uab.edu).
Received 14 July 1999; accepted in final form 20 September 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adams, C. M.,
P. M. Snyder,
and
M. J. Welsh.
Interactions between subunits of the human epithelial sodium channel.
J. Biol. Chem.
272:
27295-27300,
1997
2.
Berdiev, B. K.,
A. G. Prat,
H. F. Cantiello,
D. A. Ausiello,
C. M. Fuller,
B. Jovov,
D. J. Benos,
and
I. I. Ismailov.
Regulation of epithelial Na+ channels by short actin filaments.
J. Biol. Chem.
271:
17704-17710,
1996
3.
Canessa, C. M.,
A.-M. Merillat,
and
B. C. Rossier.
Membrane topology of the epithelial sodium channel in intact cells.
Am. J. Physiol. Cell Physiol.
267:
C1682-C1690,
1994
4.
Canessa, C. M.,
L. Schild,
G. Buell,
B. Thorens,
I. Gautschi,
J.-D. Horisberger,
and
B. C. Rossier.
Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits.
Nature
367:
463-467,
1994[Medline].
5.
Coscoy, S.,
J. R. deWeille,
E. Lingueglia,
and
M. Lazdunski.
The pre-transmembrane domain of acid-sensing ion channels participates in the ion pore.
J. Biol. Chem.
274:
10129-10132,
1999
6.
Doyle, D. A.,
J. M. Cabral,
R. A. Pfuetzner,
A. Kuo,
J. M. Gulbis,
S. L. Cohen,
B. T. Chait,
and
R. MacKinnon.
The structure of the potassium channel: molecular basis of K+ conduction and selectivity.
Science
280:
69-76,
1998
7.
Driscoll, M.,
and
M. Chalfie.
The mec-4 gene is a member of a family of Caenorhabditis elegans genes that can mutate to induce neuronal degeneration.
Nature
349:
588-593,
1991[Medline].
8.
Firsov, D.,
L. Schild,
I. Gautschi,
A.-M. Merillat,
E. Schneeberger,
and
B. C. Rossier.
Cell surface expression of the epithelial Na+ channel and a mutant causing Liddle syndrome: a quantitative approach.
Proc. Natl. Acad. Sci. USA
93:
15370-15373,
1996
9.
Hartmann, H. A.,
G. E. Kirsch,
J. A. Drewe,
M. Taglialatela,
R. H. Joho,
and
A. M. Brown.
Exchange of conduction pathways between two related K+ channels.
Science
251:
942-944,
1991
10.
Ismailov, I. I.,
T. Kieber-Emmons,
C. Lin,
B. K. Berdiev,
V. G. Shlyonsky,
H. K. Patton,
C. M. Fuller,
R. Worrell,
J. B. Zuckerman,
W. Sun,
D. C. Eaton,
D. J. Benos,
and
T. R. Kleyman.
Identification of an amiloride-binding domain within the
-subunit of the epithelial Na+ channel.
J. Biol. Chem.
272:
21075-21083,
1997
11.
Kellenberger, S.,
I. Gautschi,
and
L. Schild.
A single point mutation in the pore region of the epithelial Na+ channel changes ion selectivity by modifying molecular sieving.
Proc. Natl. Acad. Sci. USA
96:
4170-4175,
1999
12.
Kieber-Emmons, T.,
C. Lin,
K. V. Prammer,
A. Villalobos,
F. Kosari,
and
T. R. Kleyman.
Defining topological similarities among ion transport proteins with anti-amiloride antibodies.
Kidney Int.
48:
956-964,
1995[Web of Science][Medline].
13.
Kienker, P.,
G. Tomaselli,
M. Jurman,
and
G. Yellen.
Conductance mutations of the nicotinic acetylcholine receptor do not act by a simple electrostatic mechanism.
Biophys. J.
66:
325-334,
1994[Web of Science][Medline].
14.
Krapivinsky, G.,
I. Medina,
L. Eng,
L. Krapivinsky,
Y. Yang,
and
D. Clapham.
A novel inward rectifier K+ channel with unique pore properties.
Neuron
20:
995-1005,
1998[Web of Science][Medline].
15.
Li, X.-J.,
R.-H. Xu,
W. B. Guggino,
and
S. H. Snyder.
Alternatively spliced forms of the
subunit of the epithelial sodium channel: distinct sites for amiloride binding and channel pore.
Mol. Pharmacol.
47:
1133-1140,
1995[Abstract].
16.
MacKinnon, R.
Pore loops: an emerging theme in ion channel structure.
Neuron
14:
889-892,
1995[Web of Science][Medline].
17.
MacKinnon, R.,
and
C. Miller.
Mutant potassium channels with altered binding of charybdotoxin, a pore-blocking peptide inhibitor.
Science
245:
1382-1385,
1989
18.
McDonald, F. J.,
M. P. Price,
P. M. Snyder,
and
M. J. Welsh.
Cloning and expression of the
- and
-subunits of the human epithelial sodium channel.
Am. J. Physiol. Cell Physiol.
268:
C1157-C1163,
1995
19.
McDonald, F. J.,
P. M. Snyder,
P. B. McCray, Jr.,
and
M. J. Welsh.
Cloning, expression, and tissue distribution of a human amiloride-sensitive Na+ channel.
Am. J. Physiol. Lung Cell Mol. Physiol.
266:
L728-L734,
1994
20.
Nichols, C. G.,
and
A. N. Lopatin.
Inward rectifier potassium channels.
Annu. Rev. Physiol.
59:
171-191,
1997[Web of Science][Medline].
21.
Palmer, L. G.
The epithelial Na channel: inferences about the nature of the conducting pore.
Comments Mol. Cell. Biophys.
7:
259-283,
1991.
22.
Renard, S.,
E. Linguelglia,
N. Voilley,
M. Lazdunski,
and
P. Barbry.
Biochemical analysis of the membrane topology of the amiloride-sensitive Na+ channel.
J. Biol. Chem.
269:
12981-12986,
1994
23.
Reuveny, E.,
Y. N. Jan,
and
L. Y. Jan.
Contributions of a negatively charged residue in the hydrophobic domain of the IRK1 inwardly rectifying K+ channel to K+-selective permeation.
Biophysical J.
70:
754-761,
1996[Web of Science][Medline].
24.
Schild, L.,
E. Schneeberger,
I. Gautschi,
and
D. Firsov.
Identification of amino acid residues in the
,
and
subunits of the epithelial sodium channel (ENaC) involved in amiloride block and ion permeation.
J. Gen. Phys.
109:
15-26,
1997
25.
Snyder, P. M.,
F. J. McDonald,
J. B. Stokes,
and
M. J. Welsh.
Membrane topology of the amiloride-sensitive epithelial sodium channel.
J. Biol. Chem.
269:
24379-24383,
1994
26.
Tucker, J. K.,
K. Tamba,
Y.-J. Lee,
L.-L. Shen,
D. G. Warnock,
and
Y. Oh.
Cloning and functional studies of splice variants of the
-subunit of the amiloride-sensitive Na+ channel.
Am. J. Physiol. Cell Physiol.
274:
C1081-C1089,
1998
27.
Voilley, N.,
E. Lingueglia,
G. Champigny,
M. G. Mattei,
R. Waldmann,
M. Lazdunski,
and
P. Barbry.
The lung amiloride-sensitive Na+ channel: biophysical properties, pharmacology, ontogenesis, and molecular cloning.
Proc. Natl. Acad. Sci. USA
91:
247-251,
1994
28.
Waldmann, R.,
G. Champigny,
F. Bassilana,
N. Voilley,
and
M. Lazdunski.
Molecular cloning and functional expression of a novel amiloride-sensitive Na+ channel.
J. Biol. Chem.
270:
27411-27414,
1995
29.
Waldmann, R.,
G. Champigny,
and
M. Lazdunski.
Functional degenerin-containing chimeras identify residues essential for amiloride-sensitive Na+ channel function.
J. Biol. Chem.
270:
11735-11737,
1995
30.
Yellen, G.,
M. Jurman,
T. Abramson,
and
R. MacKinnon.
Mutations affecting internal TEA blockade identify the probable pore-forming region of a K+ channel.
Science
251:
939-941,
1991
31.
Yool, A. J.,
and
T. L. Schwarz.
Alteration of ion selectivity of a K+ channel by mutation of the H5 region.
Nature
349:
700-704,
1991[Medline].
This article has been cited by other articles:
![]() |
H.-L. Ji, W. Song, Z. Gao, X.-F. Su, H.-G. Nie, Y. Jiang, J.-B. Peng, Y.-X. He, Y. Liao, Y.-J. Zhou, et al. SARS-CoV proteins decrease levels and activity of human ENaC via activation of distinct PKC isoforms Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L372 - L383. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Ji and D. J. Benos Degenerin Sites Mediate Proton Activation of {delta}{beta}{gamma}-Epithelial Sodium Channel J. Biol. Chem., June 25, 2004; 279(26): 26939 - 26947. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Bruns, B. Hu, Y. J. Ahn, S. Sheng, R. P. Hughey, and T. R. Kleyman Multiple epithelial Na+ channel domains participate in subunit assembly Am J Physiol Renal Physiol, October 1, 2003; 285(4): F600 - F609. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Ji, C. M. Fuller, and D. J. Benos Intrinsic gating mechanisms of epithelial sodium channels Am J Physiol Cell Physiol, August 1, 2002; 283(2): C646 - C650. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sheng, K. A. McNulty, J. M. Harvey, and T. R. Kleyman Second Transmembrane Domains of ENaC Subunits Contribute to Ion Permeation and Selectivity J. Biol. Chem., November 16, 2001; 276(47): 44091 - 44098. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Dudeja A potential second ion permeability barrier of the epithelial Na+ channel: Focus on "Point mutations in the post-M2 region of human {alpha}-ENaC regulate cation selectivity" Am J Physiol Cell Physiol, July 1, 2001; 281(1): C15 - C16. [Full Text] [PDF] |
||||
![]() |
H.-L. Ji, S. Parker, A. L. B. Langloh, C. M. Fuller, and D. J. Benos Point mutations in the post-M2 region of human {alpha}-ENaC regulate cation selectivity Am J Physiol Cell Physiol, July 1, 2001; 281(1): C64 - C74. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Ji, M. L. Chalfant, B. Jovov, J. P. Lockhart, S. B. Parker, C. M. Fuller, B. A. Stanton, and D. J. Benos The Cytosolic Termini of the beta - and gamma -ENaC Subunits Are Involved in the Functional Interactions between Cystic Fibrosis Transmembrane Conductance Regulator and Epithelial Sodium Channel J. Biol. Chem., September 1, 2000; 275(36): 27947 - 27956. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |