Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 277: C1220-C1228, 1999;
0363-6143/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nadler, L. S.
Right arrow Articles by Nathanson, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nadler, L. S.
Right arrow Articles by Nathanson, N. M.
Vol. 277, Issue 6, C1220-C1228, December 1999

EDITORIAL FOCUS
Asymmetric distribution of muscarinic acetylcholine receptors in Madin-Darby canine kidney cells

Laurie S. Nadler, Geetha Kumar, Thomas R. Hinds, Jacques C. Migeon, and Neil M. Nathanson

Department of Pharmacology, University of Washington School of Medicine, Seattle, Washington 98195-7750


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We have characterized the muscarinic ACh receptors (mAChRs) expressed in Madin- Darby canine kidney (MDCK) strain II epithelial cells. Binding studies with the membrane-impermeable antagonist N-[3H]methylscopolamine demonstrated that mAChRs are ~2.5 times more abundant on the basolateral than on the apical surface. Apical, but not basolateral, mAChRs inhibited forskolin-stimulated adenylyl cyclase activity in response to the agonist carbachol. Neither apical nor basolateral mAChRs exhibited detectable carbachol-stimulated phospholipase C activity. Carbachol application to the apical or the basolateral membrane resulted in a threefold increase in intracellular Ca2+ concentration, which was completely inhibited by pertussis toxin on the apical side and partially inhibited on the basolateral side. RT-PCR analysis showed that MDCK cells express the M4 and M5 receptor mRNAs. These data suggest that M4 receptors reside on the apical and basolateral membranes of polarized MDCK strain II cells and that the M5 receptor may reside in the basolateral membrane of a subset of cells.

muscarinic receptor; cell polarity; adenosine triphosphate


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

MUSCARINIC ACETYLCHOLINE receptors (mAChRs) mediate the majority of cholinergic effects in the central and peripheral nervous systems. Muscarinic receptors couple to heterotrimeric GTP-binding proteins (G proteins) to modulate the activity of effector proteins such as adenylyl cyclase, phospholipase C, and ion channels. There are five mAChR subtypes (M1-M5) that are encoded by separate genes and have unique distributions in the central and peripheral nervous systems (4). Furthermore, mAChR subtypes show different biochemical specificities. Although the M1, M3, and M5 receptors preferentially couple to activation of phospholipase C via the Gq/11 family of G proteins, M2 and M4 preferentially mediate inhibition of adenylyl cyclase via the Gi/Go family (38).

Several lines of evidence suggest the asymmetric distribution of mAChRs in multiple types of polarized cells. In pancreatic and lacrimal acinar cells, release of intracellular Ca2+ in response to mAChR stimulation is selectively initiated in the luminal domain (35, 36). mAChR-mediated electrophysiological changes in lingual epithelial cells occur only when agonist is applied to the serosal, but not mucosal, membrane (30). Molecular biological and pharmacological experiments have shown that endogenous M1 and M3 receptors are differentially distributed in Xenopus oocytes (5, 22). In central nervous system neurons the differential localization of mAChR subtypes is demonstrated by pharmacological experiments and by immunohistochemistry. Although the M1 receptor is most commonly found postsynaptically on somata and dendrites, the M2 receptor is thought to be largely presynaptic (14, 20). Although the results suggest that the various mAChR subtypes can be differentially localized within cells, the mechanisms and signals that govern the targeting of mAChRs to the correct subcellular domain are not known.

Madin-Darby canine kidney (MDCK) epithelial cells provide a widely used model system for the study of protein sorting. When grown in confluent monolayers, MDCK cells establish apical and basolateral membrane domains with distinct protein and lipid compositions. Multiple strains of MDCK cells exist, and previous studies have demonstrated the presence of functional receptors for ACh, ATP, bradykinin, and epinephrine in various subclones of MDCK strain I cells (6, 24, 32, 33). However, little is known concerning the molecular identities or apical/basolateral distributions of these receptors in polarized cells. Additionally, the ratio of apical to basolateral membrane surface area differs in strain I and strain II MDCK cells. Whereas the basolateral surface area is four times larger than the apical surface area in MDCK strain I cells, the apical and basolateral membranes have equal surface areas in MDCK strain II cells (3). Thus the use of MDCK strain II cells facilitates comparison of the amounts of protein in the apical and basolateral membranes. Although MDCK strain II cells provide an attractive system for studies of receptor targeting, the expression and polarized distribution of mAChRs in this cell line have not been investigated.

In this report we have characterized the expression and polarized distribution of mAChRs in MDCK strain II cells. Biochemical studies revealed an asymmetric distribution of endogenous mAChRs. Stimulation of apical receptors with the muscarinic agonist carbamylcholine (carbachol) resulted in a pertussis toxin (PTX)-sensitive inhibition of adenylyl cyclase. Neither apical nor basolateral receptors exhibited detectable stimulation of phospholipase C activity in response to carbachol, although increases in intracellular free Ca2+ concentration ([Ca2+]i) were observed on agonist application to the apical or the basolateral cell surface. The apical Ca2+ response was completely blocked by PTX, whereas the basolateral response was partially inhibited. Additionally, MDCK strain II cells were found to express the M4 and M5 mAChR mRNAs. Taken together, the data suggest that M4 receptors are expressed on the apical and basolateral membranes of MDCK strain II cells. M5 receptors may also reside on the basolateral membrane of some cells, suggesting cellular heterogeneity in mAChR expression. These studies are the first to demonstrate the asymmetric apical/basolateral distribution of mAChRs in polarized MDCK cells and the first to identify mAChR subtypes in these cells at the molecular level. This work provides an important foundation for future studies of mAChR targeting in MDCK cells.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. MDCK strain II cells were obtained from Dr. Keith Mostov (University of California, San Francisco, CA) and maintained in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin G, and 0.1 mg/ml streptomycin sulfate (growth medium) at 37°C in a humidified 10% CO2 environment. For biochemical and functional studies, cells were seeded at 1 × 106 cells/well on 24.5-mm polycarbonate Transwell filters (0.4-µm pore size; Costar, Cambridge, MA) and cultured for 5-7 days with medium changes every other day. JEG-3 human choriocarcinoma cells (American Type Culture Collection, Rockville, MD) were maintained in growth medium, as described above.

Receptor binding assays. Binding of the membrane-impermeant muscarinic antagonist N-[3H]methylscopolamine ([3H]NMS) to intact MDCK cells was performed as previously described (9) with minor modifications. Briefly, MDCK strain II cells cultured on Transwell filters for various lengths of time were washed three times on ice with ice-cold PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4) applied to the apical and basolateral chambers. Cells were then incubated with 1 nM [3H]NMS (85 Ci/mmol; Amersham, Arlington Heights, IL) added to 2 ml of PBS on the apical or the basolateral side for 4 h at 4°C, while the opposite side received PBS alone. Assays were carried out in the absence or presence of 1 µM atropine, added to the same side as the radioligand, to determine nonspecific binding. After three washes on ice with ice-cold PBS, cells were scraped in 0.5 ml of 1% (vol/vol) Triton X-100 and transferred to scintillation vials. Before liquid scintillation counting, 0.1 ml of cell lysate was reserved for protein determination (17). Integrity of the MDCK cell monolayers was assessed by measuring the leak of [3H]NMS through each filter culture after the 4-h incubation. Leaks <3% were routinely observed. In preliminary studies the leakage of [3H]NMS was measured after 6 h, 1 day, and 2 days of culture on Transwell filters to determine the time at which confluent monolayers develop. Leaks of 20 ± 4, 5 ± 1, and 3 ± 1% (SD) were observed at 6 h, 1 day, and 2 days, respectively (n = 24). Thus MDCK strain II cells have formed confluent monolayers within 2 days of culture on Transwell filters.

Biotinylation. MDCK strain II cells cultured on Transwell filters for 5-6 days were selectively biotinylated on the apical or the basolateral cell surface with biotin-LC-hydrazide (Pierce, Rockford, IL), as described by Lisanti et al. (16). After biotinylation, crude membranes were prepared (10) and mAChRs were labeled with 2 nM [3H]quinuclidinyl benzilate ([3H]QNB, 47 Ci/mmol; Amersham) for 1 h at room temperature. After solubilization (18), biotinylated receptors were precipitated overnight at 4°C with streptavidin-agarose (Pierce). Precipitated receptors were collected on GF/C filters and subjected to liquid scintillation counting to quantitate the percentage of mAChRs precipitated by streptavidin. Nonspecific mAChR precipitation, obtained from nonbiotinylated cells, was subtracted from the percent precipitation obtained from biotinylated cells to calculate the percentage of radiolabeled mAChRs specifically precipitated by streptavidin from the apical or the basolateral surface. Biotinylation of MDCK cells resulted in a 20-30% decrease in radioligand binding to mAChRs on the apical and basolateral membranes, as determined in [3H]NMS binding assays. However, the apical-to-basolateral ratios of [3H]NMS binding were equivalent in biotinylated and nonbiotinylated cells.

Functional assays. Measurements of cAMP accumulation and phosphoinositide (PI) turnover in response to the muscarinic agonist carbachol were performed essentially as described by Subers and Nathanson (34). For measurements of cAMP accumulation, MDCK strain II cells cultured on Transwell filters for 5 days were washed twice on each side with 2 ml of 37°C Earle's salts (116 mM NaCl, 1.8 mM CaCl2, 1.0 mM NaH2PO4, 5.4 mM KCl, 0.81 mM MgSO4, 5.56 mM glucose, 25 mM HEPES, pH 7.4) and preincubated for 20 min at 37°C with 1.5 ml of DMEM containing 25 mM HEPES, pH 7.4, and 5 mM theophylline, added to each side. Cells were then stimulated with 0.1 mM forskolin and various concentrations of carbachol, added to the apical or the basolateral side, for 5 min at 37°C. Cells were washed twice on each side with 2 ml of ice-cold Earle's salts and scraped in 2 ml of ice-cold 5% (wt/vol) TCA, and cellular cAMP was partially purified and quantitated as previously described (34). To test the involvement of Gi/Go proteins in the cAMP response, cells were incubated overnight with medium containing 300 ng/ml PTX (List Biological Laboratories, Campbell, CA).

For analysis of PI turnover, MDCK strain II cells grown on Transwell filters for 5 days were labeled on the apical and basolateral sides with 1 ml of growth medium containing 1 µCi/ml myo-[2-3H]inositol (16.3 Ci/mmol; Amersham) overnight at 37°C. Cells were washed twice on each side with 2 ml of 37°C physiological saline solution (118 mM NaCl, 4.7 mM KCl, 3 mM CaCl2, 1.2 mM MgSO4, 1.2 mM KH2PO4, 10 mM glucose, 0.5 mM EDTA, 20 mM HEPES, pH 7.4) containing 10 mM LiCl and incubated with 2 ml of the same solution for 30 min at 37°C. Various concentrations of agonist were then added to the apical or the basolateral compartment, and the incubation was continued for an additional 15 min at 37°C. Cells were washed on each side with 2 ml of ice-cold physiological saline solution with 10 mM LiCl, and cells were scraped in 0.5 ml of ice-cold methanol. Total inositol phosphates were purified and quantitated as described previously (34).

Levels of intracellular free Ca2+ in MDCK strain II cells were measured using the Ca2+-sensitive fluorescent dye fura 2. MDCK cells were plated at 2.5 × 105 cells/well on 12-mm polyester Transwell-Clear filters (0.4-µm pore size; Costar) and cultured for 5 days. In experiments testing the involvement of Gi/Go proteins, cells were incubated overnight with medium containing 300 ng/ml PTX. For dye loading, cells were washed three times on each side with 1 ml of loading buffer (137 mM NaCl, 5.4 mM KCl, 4.3 mM Na2HPO4, 1.5 mM KH2PO4, 1.3 mM CaCl2, 0.5 mM MgCl2, 0.8 mM MgSO4, 5 mM glucose, pH 7.4) and incubated for 2 h at room temperature with 0.5 ml of 10 µM fura 2-AM (Molecular Probes, Eugene, OR) in loading buffer supplemented with 1% BSA and 0.1 mM probenecid, added to the apical side only. After three washes with 1 ml of loading buffer on the apical and basolateral sides, cells were incubated with 0.5 ml of loading buffer supplemented with 0.1 mM probenecid until being imaged.

Cells were imaged using a 75-W xenon lamp and a Metaltek filter wheel and shutter separated from a Nikon microscope equipped with a Nikon Fluor 20/1.3-numerical aperture objective. Images were intensified with a GenIIsys image intensifier (Dage-MTI) and acquired with a Dage-MTI CCD-72 series camera. For measurements on the apical side of cell monolayers, intact Transwell chambers were placed on glass coverslips (no. 1, Corning), and solutions were added directly to the well. For measurements on the basolateral side, filters were cut from the chambers and placed on coverslips with the apical side down. To facilitate buffer and agonist additions to the basolateral membrane, a cloning ring was attached to each filter with silicone grease applied to the outside of the ring. For each experiment, carbachol or ATP was added to a final concentration of 1 mM and the ratio of fura 2 fluorescence at 340-nm excitation wavelength to that at 380-nm excitation wavelength in 64 cells was recorded for 8-10 min. Fluorescence ratio measurements were converted to [Ca2+]i, as described by Kao (12). Intracellular calibration was performed each day to facilitate comparison of [Ca2+]i among different experiments. The maximum ratio was determined by incubating cells with 20 µM ionomycin and 10 mM CaCl2 on the apical side; the minimum ratio was determined by washing cells with nominally Ca2+-free buffer (140 mM NaCl, 10 mM HEPES, 5 mM KCl, 0.5 mM MgCl2, 10 mM glucose, 1 mM EGTA, pH 7.4) and incubating with 20 µM ionomycin in the same buffer on the apical side.

RT-PCR. Poly(A)-enriched RNA was isolated from confluent 10-cm dishes of MDCK strain II cells by use of the FastTrack mRNA isolation kit (Invitrogen, San Diego, CA) according to the manufacturer's instructions. For each sample, 0.5 µg of poly(A)+ RNA in 10 mM Tris · HCl, pH 7.5, was mixed with 2 pmol of a single mAChR subtype-specific reverse primer in a final volume of 12 µl of diethylpyrocarbonate-treated H2O and heated at 70°C for 10 min to disrupt RNA secondary structure. Each reaction was then mixed with 50 mM Tris · HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 0.5 mM dNTPs, and 200 U of Superscript II reverse transcriptase (GIBCO BRL, Grand Island, NY) in a final volume of 20 µl, incubated at 42°C for 50 min, then heat inactivated at 70°C for 15 min. Duplicate RNA samples were processed in the absence of reverse transcriptase as negative controls. Nucleic acids were ethanol precipitated overnight and resuspended in 10 µl of H2O. PCR contained 10 µl of resuspended RT reaction, 0.25 mM dNTPs, 1 µg of forward and reverse mAChR subtype-specific primers, 20 mM Tris · HCl, pH 8.8, 2 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 100 µg/ml BSA, and 2.5 U of Pfu DNA polymerase (Stratagene, La Jolla, CA) in a final volume of 100 µl. Reactions were layered with mineral oil and subjected to thermal cycling according to the following program: 1 cycle at 94°C for 5 min, 55°C for 4 min, and 72°C for 5 min and 30 cycles at 94°C for 2 min, 55°C for 2 min, and 72°C for 3.5 min. PCR corresponding to each mAChR subtype were performed in separate tubes. For each set, reactions were also performed using 0.5 µg of genomic DNA from MDCK strain II cells or the appropriate mAChR expression plasmid [mouse M1 (29), porcine M2 (clone Mc7) (27), human M3 (2), human M4 (1), or human M5 (2), all subcloned in the mammalian expression vector pCDPS (2)] as template to serve as positive controls. PCR products were extracted with phenol-chloroform (1:1), ethanol precipitated overnight, and analyzed by agarose gel electrophoresis and ethidium bromide staining.

The subtype-specific primers used for RT-PCR corresponded to the highly divergent third cytoplasmic loop of each receptor sequence. Primer sequences and the resulting amplified receptor sequences are as follows: M1 [forward (+)], 5' AAAGGTGGTGGCAGCAGCAGCAGC 3'; M1 [reverse (-)], 5' TTTCTTGGTGGGCCTCTTGACTGT 3'; nt 697-996 of mouse M1 coding sequence (29); M2 (+), 5' CCTGTGGCCAACCAAGACCCAGTATCT 3'; M2 (-), 5' AACGTTCTGCTTTTCATCCCCACTCTG 3'; nt 670-1080 of rat M2 coding sequence (8); M3 (+), 5' TTCACCACCAAGAGCTGGAAGCCCAGT 3'; M3 (-), 5' CACGGCAGACTCTAACTGGATGGGGAG 3'; nt 940-1302 of rat M3 coding sequence (1); M4 (+), 5' CTGGCTTTCCTCAAGAGCCCTCTGATG 3'; M4 (-), 5' ACCAGCTGGCGTGGCAGGTACGATCTC 3'; nt 721-1098 of mouse M4 coding sequence (37); M5 (+), 5' CAGGCCTCCTGGTCATCCTCCCGTAGA 3'; M5 (-), 5' TACCACCAATCGGAACTTATAGGCAAC 3'; nt 799-1152 of rat M5 coding sequence (15).

Immunoprecipitation and immunocytochemistry. Crude membrane fractions were prepared from MDCK strain II cells grown for 5-7 days postconfluency on 10-cm dishes (10). Solubilized, [3H]QNB-labeled mAChRs were immunoprecipitated as described by McKinnon and Nathanson (23) by use of receptor subtype-specific polyclonal antibodies raised against glutathione S-transferase fusion proteins of the highly divergent third cytoplasmic loops of M1, M2, and M3 (11; unpublished observations). Membranes from JEG-3 human choriocarcinoma cells transiently transfected with the mouse M1, porcine M2, or human M3 expression construct served as controls.

For immunocytochemical analysis, MDCK strain II and JEG-3 cells were seeded onto two-well glass chamber slides (4.2 cm/well; Nunc) and grown to confluency (MDCK) or transiently transfected (JEG-3) with 4 µg of human M4 mAChR expression construct by the calcium phosphate precipitation method (28). Cells were fixed with paraformaldehyde solution [4% (wt/vol) paraformaldehyde, 4% (wt/vol) sucrose in PBS, pH 7.4] for 30 min at room temperature and processed for immunocytochemistry. Fixed cells were rinsed twice with PBST [PBS containing 0.1% (vol/vol) Tween 20], permeabilized with 0.25% (vol/vol) Triton X-100 (in PBS) for 5 min at room temperature, and blocked with 10% (wt/vol) BSA in PBST containing 0.25% Triton X-100 for 2 h at room temperature. After they were blocked, cells were incubated with affinity-purified rabbit anti-M4 antibody (0.5 µg/ml; a gift from Dr. Allan Levey, Emory University, Atlanta, GA) in PBST containing 3% BSA and 0.25% Triton X-100 overnight at 4°C in a humid chamber. After four washes with PBST, cells were incubated with FITC-conjugated goat anti-rabbit secondary antibody (1:250; Cappel Research Products, Durham, NC) in PBST containing 3% BSA and 0.25% Triton X-100 for 2-3 h at room temperature. After four more washes with PBST, slides were coverslipped with Vectashield (Vector Labs, Burlingame, CA) and viewed under ×40 magnification.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Polarized distribution of mAChRs in MDCK strain II cells. Previous studies demonstrated the expression of pharmacologically defined M3 mAChRs in MDCK strain I cells (24). However, the ratio of apical to basolateral membrane surface area differs in strain I and strain II MDCK cells. Whereas the basolateral surface area is four times larger than the apical surface area in MDCK strain I cells, the apical and basolateral membranes have equal surface areas in MDCK strain II cells (3). Thus the use of MDCK strain II cells is advantageous for studies of receptor distribution, inasmuch as it facilitates comparison of the amounts of protein in the apical and basolateral membranes. To examine the apical/basolateral distribution of mAChRs in MDCK strain II cells, the binding of the membrane-impermeant, nonselective muscarinic antagonist [3H]NMS was analyzed as a function of time after cells were plated on Transwell filters. Culture on Transwell filters allows independent access to the apical and basolateral domains of MDCK cell monolayers. These studies demonstrated that mAChRs are asymmetrically distributed in polarized MDCK strain II cell monolayers (Fig. 1A). Two days after the cells were plated, similar levels of [3H]NMS binding were observed on the apical and basolateral cell surfaces (112 ± 19 and 109 ± 42 fmol/mg protein apical and basolateral, respectively, n = 4). By 5 days after the cells were plated, the level of basolateral receptors had risen to 228 ± 30 fmol/mg protein, whereas that of apical receptors decreased slightly (99 ± 6 fmol/mg protein). Receptor levels on both membrane domains then declined gradually for the remainder of the 14-day time course. Thus, in MDCK cells grown on Transwell filters for 5-7 days, mAChRs on the basolateral cell surface are 2.3-2.7 times more abundant than those on the apical surface. Furthermore, these data suggest that MDCK cells acquire a fully polarized distribution of mAChRs after 5-7 days of culture on Transwell filters.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Muscarinic ACh receptors (mAChRs) exhibit a polarized distribution in Madin-Darby canine kidney (MDCK) cell monolayers. A: MDCK strain II cells were cultured on Transwell filters for various lengths of time. Cells were incubated with 1 nM N-[3H]methylscopolamine ([3H]NMS) added to either the apical () or basolateral () side for 4 h at 4°C in the absence or presence of 1 µM atropine to determine nonspecific binding. Data are plotted as specific binding vs. time after plating. Each point represents mean ± SE of 4 separate experiments performed in triplicate. B: MDCK strain II cells were cultured on Transwell filters for 5-6 days and biotinylated on apical or basolateral surface using biotin-LC-hydrazide. Cell membranes were prepared, and mAChRs were labeled with 2 nM [3H]quinuclidinyl benzilate. Biotinylated receptors were precipitated with streptavidin-agarose and quantitated by liquid scintillation counting. Data are presented as percentage of total precipitated mAChRs that were precipitated by streptavidin after biotinylation on apical or basolateral surface. The percentage of total mAChRs that were biotinylated and precipitated by streptavidin was 61 ± 12% (n = 4). Each bar represents mean ± SE of 4 separate experiments performed in duplicate.

The apical/basolateral distribution of mAChRs in polarized MDCK cells was further confirmed in cell surface biotinylation experiments. For these studies, cells cultured on Transwell filters for 5-6 days were biotinylated on the apical or the basolateral cell surface with biotin-LC-hydrazide (16), mAChRs in crude membranes were labeled with the nonselective muscarinic antagonist [3H]QNB and biotinylated, and cell surface mAChRs were precipitated with streptavidin-agarose. After subtraction of receptors nonspecifically precipitated by streptavidin, 33 ± 3% of the total precipitated mAChRs were detected on the apical surface and 67 ± 3% were detected on the basolateral surface (n = 4; Fig. 1B). This observation is consistent with the basolateral enrichment of mAChRs found in the [3H]NMS binding studies outlined above. Taken together, these studies demonstrate that mAChRs are asymmetrically distributed in polarized MDCK strain II cell monolayers.

Functional characterization of mAChRs. Functional studies were performed to examine the physiological responsiveness of the mAChRs expressed on the apical and basolateral surfaces of polarized MDCK strain II cells. Activation of the M1, M3, and M5 receptors preferentially results in increased PI hydrolysis and [Ca2+]i in a variety of systems, whereas activation of the M2 and M4 receptors preferentially results in inhibition of cAMP accumulation (38). Thus determination of agonist-mediated changes in second messenger levels can help discriminate among different mAChR subtypes.

Assays of cAMP levels in response to various concentrations of the agonist carbachol were performed on MDCK strain II cells grown on Transwell filters for 5 days. In the absence of carbachol, the forskolin-stimulated cAMP level was 710 ± 138 pmol/mg cellular protein when forskolin was applied to the apical side of the MDCK cell monolayer and 270 ± 28 pmol/mg protein when forskolin was applied to the basolateral side (n = 3). Carbachol produced a concentration-dependent decrease in forskolin-stimulated cAMP levels when applied to the apical side (Fig. 2; >60% maximal decrease produced by 1-10 mM carbachol). However, carbachol had no significant effect on forskolin-stimulated cAMP levels at any concentration when applied to the basolateral side. Control experiments revealed that basolaterally applied carbachol (1 µM, 0.1 mM, or 1 mM) also has no effect on cAMP levels stimulated by forskolin applied to the apical side. Furthermore, 1 mM carbachol did not increase basal (unstimulated) cAMP levels when applied to the apical or the basolateral side (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   Apical mAChRs couple negatively to adenylyl cyclase in polarized MDCK cells. MDCK strain II cells cultured on Transwell filters for 5 days were stimulated with 0.1 mM forskolin and various concentrations of carbachol on apical () or basolateral () side for 5 min at 37°C. Cellular cAMP was determined as described in METHODS. Data are plotted as amount of cAMP vs. carbachol concentration. Each point represents mean ± SE of 3 separate experiments performed in triplicate.

We then tested the involvement of Gi/Go proteins in the apical mAChR-mediated decrease in cAMP by incubating MDCK strain II cells overnight with PTX, which ADP-ribosylates the Gi and Go alpha -subunits and prevents their coupling with receptors. The carbachol-induced decrease in cAMP on the apical side was completely blocked in PTX-treated cells [585 ± 86, 386 ± 14, and 578 ± 133 (SD) pmol cAMP/mg protein for control, 0.1 mM carbachol, and 0.1 mM carbachol + PTX, respectively; n = 3]. Thus the carbachol-induced inhibition of adenylyl cyclase observed on the apical side of MDCK strain II cell monolayers is mediated by Gi/Go proteins.

To examine carbachol-induced changes in PI turnover, MDCK strain II cells cultured on Transwell filters for 5 days were labeled overnight with myo-2-[3H]inositol and stimulated with various concentrations of carbachol on either the apical or the basolateral side. Carbachol had no detectable effect on PI turnover when applied to the apical or the basolateral side (Fig. 3A). Levels of total inositol phosphates ranged from 157 ± 22 to 301 ± 45 cpm/well on the apical side and from 225 ± 78 to 346 ± 58 cpm/well on the basolateral side (n = 3) at all carbachol concentrations tested. To ensure that MDCK strain II cells were capable of increasing PI hydrolysis in response to agonist stimulation, cells were also stimulated with the purinergic receptor agonist ATP. This agonist has previously been shown to stimulate PI hydrolysis in MDCK strain I cells (26). In the present study, 1 mM ATP elicited a twofold increase in total inositol phosphates when applied to the apical, but not the basolateral, side of MDCK strain II cell monolayers (Fig. 3B). Neither 1 µM ATP (not shown) nor 1 µM or 1 mM carbachol had any detectable effect on PI turnover when applied to the apical or the basolateral side.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   Purinergic receptors, but not mAChRs, stimulate inositol phosphate production in MDCK cells. A: MDCK strain II cells cultured on Transwell filters for 5 days were labeled with 1 µCi/ml myo-2-[3H]inositol overnight and stimulated with various concentrations of carbachol added to apical () or basolateral () side for 15 min at 37°C. [3H]inositol phosphates were determined as described in METHODS. Data are plotted as amount of total inositol phosphates vs. carbachol concentration. Each point represents mean ± SE of 3 separate experiments performed in triplicate. B: MDCK strain II cells were cultured and labeled as described in A. Cells were unstimulated or stimulated with 1 mM carbachol or 1 mM ATP added to apical (filled bars) or basolateral (hatched bars) compartment for 15 min at 37°C. [3H]inositol phosphates were analyzed as described in A. Data are plotted as magnitude stimulation of [3H]inositol phosphate accumulation in treated cells relative to untreated cells vs. agonist. Each point represents mean ± SE of 3 separate experiments performed in triplicate.

The lack of observable stimulation of PI turnover in response to carbachol may be due to insufficient sensitivity of this biochemical assay for the detection of transient increases in second messenger levels. To examine this possibility, we determined [Ca2+]i in polarized MDCK cells grown on Transwell filters and loaded with the Ca2+-sensitive dye fura 2. Application of 1 mM carbachol to the apical or the basolateral membrane resulted in a rapid, threefold stimulation of [Ca2+]i within 20 s, which reached a plateau ~5-6 min after agonist addition (Fig. 4, A and C). Ca2+ concentrations were 83 ± 25, 234 ± 55, and 120 ± 28 (SE) nM (basal, peak, and plateau, respectively; n = 4) for carbachol addition to the apical surface and 120 ± 40, 339 ± 95, and 174 ± 67 (SE) nM (basal, peak, and plateau, respectively; n = 4) for stimulation of the basolateral surface. Similarly, 1 mM ATP elicited a rapid and transient increase in [Ca2+]i when applied to the apical or the basolateral surface (Fig. 4, B and D). Basal, peak, and plateau [Ca2+]i were 70 ± 24, 397 ± 102, and 135 ± 43 (SE) nM, respectively, for ATP addition to the apical side and 130 ± 37, 301 ± 67, and 130 ± 45 (SE) nM, respectively, for ATP application to the basolateral side (n = 4). Thus ATP application resulted in a sixfold stimulation of [Ca2+]i on the apical side and a threefold stimulation on the basolateral side.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   mAChRs and purinergic receptors couple to increases in intracellular Ca2+ concentration ([Ca2+]i) in MDCK cells. MDCK strain II cells cultured on Transwell-Clear filters for 5 days were labeled with fura 2-AM. Cells were stimulated with 1 mM carbachol (A and C) or 1 mM ATP (B and D) added to apical (A and B) or basolateral (C and D) side of cell monolayers. [Ca2+]i was determined as described in METHODS. Data are plotted as average [Ca2+]i vs. time for all 64 cells in a given stimulation. Each graph is representative of duplicate or triplicate stimulations performed in each of 4 separate experiments. Arrows, times of agonist addition.

The increase in [Ca2+]i in response to carbachol could have resulted from several mechanisms. For example, the M2 and M4 receptors can stimulate phospholipase C via the beta gamma -subunits released from Gi/Go, and the M1, M3, and M5 receptors can stimulate phospholipase C directly via the Gq/11 alpha -subunit. To determine the G protein coupling specificity of the Ca2+ response, polarized MDCK cells were treated with PTX overnight. Although ATP stimulation of [Ca2+]i on the apical or the basolateral side was not inhibited by PTX (data not shown), the apical response to carbachol was completely inhibited by the toxin (1.8- and 1.0-fold stimulation of [Ca2+]i for control and PTX-treated cells, respectively, n = 2). Interestingly, the basolateral response to carbachol was only partially inhibited by PTX [2.5 ± 0.8 and 1.4 ± 0.4 (SD) fold stimulation of [Ca2+]i for control and PTX-treated cells, n = 4 and n = 9, respectively, 64 cells/experiment]. This observation could result from partial inhibition of the Ca2+ response in each cell or complete inhibition in some cells but no inhibition in others. Analysis of the Ca2+ response to carbachol in single cells revealed heterogeneity in the inhibition by PTX. Whereas in control conditions 94 ± 6% of the cells responded with >30% increase in [Ca2+]i after carbachol application to the basolateral membrane, 49 ± 20% (SD) of PTX-treated cells still responded to 1 mM carbachol applied to the basolateral side (P < 0.01, n = 4 and n = 9, respectively). These data suggest that although the apical Ca2+ response is entirely mediated through Gi/Go, the basolateral response is mediated through Gi/Go (PTX sensitive) in some cells and through Gq/11 (PTX insensitive) in others.

Molecular identification of mAChR subtypes. The carbachol-induced functional responses observed in polarized MDCK strain II monolayers suggested that multiple mAChR subtypes are expressed in these cells. To identify the mAChR subtypes at the molecular level, immunoprecipitation was initially performed using subtype-specific antisera raised against glutathione S-transferase fusion proteins of the highly divergent third intracellular loops of the receptors (11; unpublished observations). However, neither anti-M1, -M2, nor -M3 antisera immunoprecipitated significant levels of [3H]QNB-labeled mAChRs from MDCK strain II cell membranes, although they did immunoprecipitate the majority of labeled receptors from JEG-3 human choriocarcinoma cells transfected with the appropriate receptor cDNAs (data not shown). Furthermore, an anti-M4 receptor antibody (a gift from Dr. Allan Levey) did not immunostain MDCK strain II cells, whereas significant immunostaining was observed with JEG-3 cells transfected with the M4 receptor cDNA (not shown). Therefore, we concluded that the available antibodies against mammalian mAChR subtypes do not cross-react with the mAChRs found in MDCK strain II cells.

We next investigated mAChR gene expression in MDCK strain II cells using RT-PCR analysis. Reverse-transcribed RNA from MDCK cells was subjected to PCR by using primers that specifically amplify a region from the third intracellular loops of the M1-M5 mAChRs. PCR corresponding to each receptor subtype were performed in separate tubes. MDCK cell genomic DNA and the expression plasmid corresponding to each receptor subtype were also processed for PCR as positive controls. MDCK RNA that had not been reverse transcribed and PCR containing no template served as negative controls. Preliminary experiments showed that each set of primers amplified a PCR product of the expected size only from its specific receptor plasmid; no PCR product was detected when other receptor plasmids were used as templates (data not shown). RT-PCR analysis revealed the presence of a prominent band of 377 bp, corresponding to the M4 receptor mRNA, and a faint but discrete band of 353 bp, corresponding to the M5 receptor mRNA, in MDCK strain II cells (Fig. 5). In contrast, discrete bands corresponding to the M1, M2, and M3 mRNAs were not visible over the level of background staining present in the gel lanes. Discrete PCR products of 299, 410, 363, 377, and 353 bp, indicative of all five receptor subtypes (M1, M2, M3, M4, and M5, respectively), were amplified from MDCK strain II cell genomic DNA and from recombinant mAChR expression constructs, indicating that all five PCR products were capable of being amplified under the conditions employed. No PCR products were observed when reverse transcriptase was omitted, demonstrating that the signals were from expressed mRNA rather than contaminating genomic DNA. Thus MDCK strain II cells express the M4 and M5 mAChR mRNAs. Taken together, the functional and molecular data suggest that the M4 receptor resides on the apical and basolateral membranes of MDCK strain II cells and the M5 receptor is detectable on the basolateral surface of some, but not all, cells.


View larger version (104K):
[in this window]
[in a new window]
 
Fig. 5.   MDCK strain II cells express M4 and M5 mAChR mRNAs. Reverse-transcribed poly(A)+ RNA (0.5 µg/sample) from MDCK strain II cells was processed for PCR using primers specific for regions of 3rd intracellular loops of M1-M5, as indicated at left. Control templates were used in parallel PCR. PCR products were ethanol precipitated and analyzed by ethidium bromide staining of agarose gels. Lane 1, reverse-transcribed RNA; lane 2, genomic DNA from MDCK strain II cells; lane 3, mAChR expression plasmid (pCDM1-pCDM5); lane 4, RNA processed in absence of reverse transcriptase; lane 5, no template. Similar results were obtained in 2 independent experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Although functional receptors for hormones and neurotransmitters such as ACh, bradykinin, epinephrine, and ATP have been detected in MDCK cells (6, 24, 26, 32, 33), the apical/basolateral distributions of these receptors in polarized cell monolayers have not been well characterized. Our results demonstrate that mAChRs in polarized MDCK strain II cells are distributed asymmetrically. In cells cultured on Transwell filters, over twice as many receptors were expressed on the basolateral as on the apical cell surface (Fig. 1). This distribution was achieved 5-7 days after cells were plated on Transwell filters, a time course consistent with that reported in other studies of G protein-coupled receptor distribution in MDCK cells (13). Thus functional receptor characterization studies were performed on cells grown for 5-7 days on Transwell filters.

Investigation of the mAChR subtypes in MDCK strain II cells revealed that apical receptors couple to a decrease in cAMP accumulation (Fig. 2) and an increase in [Ca2+]i (Fig. 4), both of which are PTX sensitive. In contrast, basolateral mAChRs couple to an increase in [Ca2+]i (Fig. 4), which is partially PTX sensitive. Furthermore, MDCK strain II cells were found to express the M4 and M5 receptor mRNAs (Fig. 5). Because the M2 and M4 receptors preferentially couple to the PTX-sensitive G proteins Gi and Go and inhibit adenylyl cyclase in multiple cell types (38), these findings suggest that the M4 receptor is present on the apical and basolateral membranes of MDCK strain II cells. The PTX-insensitive component of the basolateral Ca2+ response is presumably due to activation of M5 receptors, which preferentially couple to Gq/11 (38). Because the PTX-insensitive component was not seen in all cells, the M5 receptor may be present on the basolateral membrane of a subset of MDCK cells. Alternatively, the M5 receptor may be expressed in the basolateral membrane of all cells at a very low level, so that the functional Ca2+ response was only detectable in a subset of cells. These conclusions are consistent with the results of RT-PCR analysis, which demonstrated a strong signal for M4 mRNA and a very weak signal for M5 mRNA (Fig. 5).

Taken together, our functional and molecular studies suggest that the M4 receptor is expressed on both the apical and basolateral surfaces of MDCK strain II cells. However, mAChR-mediated inhibition of adenylyl cyclase was only observed when carbachol was applied to the apical surface. One possibility is that the M4 receptor, G protein, and adenylyl cyclase are not colocalized in the basolateral membrane, which would preclude M4 from coupling to the cyclase after agonist stimulation. Alternatively, different isoforms of adenylyl cyclase may reside in the apical and basolateral membranes. It is known that certain isoforms of adenylyl cyclase are inhibited by Gi/Go, whereas others are not (31). The basolateral membrane of MDCK strain II cells may contain a cyclase isoform that is not inhibited by Gi/Go.

Although neither the apical nor the basolateral mAChRs in MDCK strain II cells appeared to couple to phospholipase C using a biochemical assay, carbachol did stimulate an increase in [Ca2+]i when applied to the apical or the basolateral side. The carbachol-stimulated increase in [Ca2+]i on both sides of MDCK cell monolayers is consistent with an earlier report in which MDCK strain I cells were used (19). One explanation for our results is that our PI turnover assay is not sensitive enough to detect subtle and/or transient changes in inositol phosphate levels on carbachol stimulation. Alternatively, the mAChR-mediated increases in [Ca2+]i may occur by a mechanism other than inositol trisphosphate-stimulated release from intracellular stores. For example, mAChR coupling to plasma membrane Ca2+ channels could account for the observed results.

The mAChR subtypes and functional responses observed here are similar to those previously characterized in MDCK strain I cells. In MDCK strain I cells, carbachol treatment decreased forskolin-stimulated cAMP production, increased PI turnover and [Ca2+]i, and stimulated protein kinase C activity (19, 24, 25; unpublished observations). The PI and cAMP responses were sensitive to PTX (24, 25). In the present study, we observed PTX-sensitive cAMP and Ca2+ responses to mAChR stimulation and have identified the M4 and M5 receptors at the molecular level. Despite these similarities, the previous studies in MDCK strain I cells did not investigate the apical/basolateral distributions or molecular identities of the mAChRs in polarized, filter-grown cells. Because cells in native epithelia exist in the polarized state, the receptor distribution in filter-grown cells would likely mimic their distribution in vivo.

In the kidney the apical surface of epithelial cells faces the lumen of the tubules, whereas the basolateral surface faces the capillary blood supply. This raises the question of the physiological relevance of apical hormone and neurotransmitter receptors, which would presumably be stimulated by ligands in the kidney tubule. Multiple types of G protein-coupled receptors have been found on the apical membrane of polarized MDCK cells, including those for bradykinin, ATP, and ACh (19, 39). It has been postulated that a luminal source of agonist may arise via the release of hormone or neurotransmitter from the epithelial cells in an autocrine/paracrine fashion (7, 39).

In conclusion, the findings presented here represent the first demonstration of the asymmetric distribution of mAChRs and their molecular identification in polarized, filter-grown MDCK cells. MDCK strain II cells are a widely used model system for studies of protein targeting, and the cellular mechanisms and pathways of protein trafficking in these cells have been well characterized (21). The present work represents an important first step toward the future investigation of signals and mechanisms that control the polarized sorting of mAChR subtypes in MDCK cells and neurons.


    ACKNOWLEDGEMENTS

We thank Dr. Steven Carlson, Dr. Susan Hamilton, and Michael Schlador for insightful comments on the manuscript.


    FOOTNOTES

This work was supported by National Institutes of Health Grant NS-26920 (to N. M. Nathanson) and Training Grant DA-07278 (to L. S. Nadler) and by a postdoctoral fellowship in pharmacology/morphology from the Pharmaceutical Research and Manufacturers of America Foundation (to L. S. Nadler).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: N. M. Nathanson, Dept. of Pharmacology, Box 357750, University of Washington, Seattle, WA 98195-7750 (E-mail: nathanso{at}u.washington.edu).

Received 17 December 1998; accepted in final form 18 August 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Bonner, T. I., N. J. Buckley, A. C. Young, and M. R. Brann. Identification of a family of muscarinic acetylcholine receptor genes. Science 237: 527-532, 1987[Abstract/Free Full Text].

2.   Bonner, T. I., A. C. Young, M. R. Brann, and N. J. Buckley. Cloning and expression of the human and rat M5 muscarinic acetylcholine receptor genes. Neuron 1: 403-410, 1988[Medline].

3.   Butor, C., and J. Davoust. Apical-to-basolateral surface area ratio and polarity of MDCK cells grown on different supports. Exp. Cell Res. 203: 115-127, 1992[Medline].

4.   Caulfield, M. P. Muscarinic receptors---characterization, coupling and function. Pharmacol. Ther. 58: 319-379, 1993[Medline].

5.   Davidson, A., G. Mengod, N. Matus-Leibovitch, and Y. Oron. Native Xenopus oocytes express two types of muscarinic receptors. FEBS Lett. 284: 252-256, 1991[Medline].

6.   Firestein, B. L., M. Xing, R. J. Hughes, C. U. Corvera, and P. A. Insel. Heterogeneity of P2u- and P2y-purinergic receptor regulation of phospholipases in MDCK cells. Am. J. Physiol. 271 (Renal Fluid Electrolyte Physiol. 40): F610-F618, 1996[Abstract/Free Full Text].

7.   Garg, L. C. Actions of adrenergic and cholinergic drugs on renal tubular cells. Pharmacol. Rev. 44: 81-102, 1992[Abstract].

8.   Gocayne, J., D. A. Robinson, M. G. Fitzgerald, F.-Z. Chung, A. R. Kerlavage, K.-U. Lentes, J. Lai, C.-D. Wang, C. M. Fraser, and J. C. Venter. Primary structure of rat cardiac beta -adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family. Proc. Natl. Acad. Sci. USA 84: 8296-8300, 1987[Abstract/Free Full Text].

9.   Goldman, P. S., and N. M. Nathanson. Differential role of the carboxyl-terminal tyrosine in down-regulation and sequestration of the M2 muscarinic acetylcholine receptor. J. Biol. Chem. 269: 15640-15645, 1994[Abstract/Free Full Text].

10.   Halvorsen, S. W., and N. M. Nathanson. In vivo regulation of muscarinic acetylcholine receptor number and function in embryonic chick heart. J. Biol. Chem. 250: 7941-7948, 1981.

11.   Hamilton, S. E., M. D. Loose, M. Qi, A. I. Levey, B. Hille, G. S. McKnight, R. L. Idzerda, and N. M. Nathanson. Disruption of the M1 receptor gene ablates muscarinic receptor-dependent M current regulation and seizure activity in mice. Proc. Natl. Acad. Sci. USA 94: 13311-13316, 1997[Abstract/Free Full Text].

12.   Kao, J. P. Y. Practical aspects of measuring [Ca2+] with fluorescent indicators. Methods Cell Biol. 40: 155-181, 1994[Medline].

13.   Keefer, J. R., and L. E. Limbird. The alpha 2A-adrenergic receptor is targeted directly to the basolateral membrane domain of Madin-Darby canine kidney cells independent of coupling to pertussis toxin-sensitive GTP-binding proteins. J. Biol. Chem. 268: 11340-11347, 1993[Abstract/Free Full Text].

14.   Levey, A. I., C. A. Kitt, W. F. Simonds, D. L. Price, and M. R. Brann. Identification and localization of muscarinic acetylcholine receptor proteins in brain with subtype-specific antibodies. J. Neurosci. 11: 3218-3226, 1991[Abstract].

15.   Liao, C.-F., A. P. N. Themmen, R. Joho, C. Barberis, M. Birnbaumer, and L. Birnbaumer. Molecular cloning and expression of a fifth muscarinic acetylcholine receptor. J. Biol. Chem. 264: 7328-7337, 1989[Abstract/Free Full Text].

16.   Lisanti, M. P., A. LeBivic, M. Sargiacomo, and E. Rodriguez-Boulan. Steady-state distribution and biogenesis of endogenous Madin-Darby canine kidney glycoproteins: evidence for intracellular sorting and polarized cell surface delivery. J. Cell Biol. 109: 2117-2127, 1989[Abstract/Free Full Text].

17.   Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193: 265-275, 1951[Free Full Text].

18.   Luetje, C. W., C. Brumwell, M. G. Norman, G. L. Peterson, M. I. Schimerlik, and N. M. Nathanson. Isolation and characterization of monoclonal antibodies specific for the cardiac muscarinic acetylcholine receptor. Biochemistry 26: 6892-6896, 1987[Medline].

19.   Luo, H., R. P. Lindeman, and H. S. Chase. Participation of protein kinase C in desensitization to bradykinin and to carbachol in MDCK cells. Am. J. Physiol. 262 (Renal Fluid Electrolyte Physiol. 31): F499-F506, 1992[Abstract/Free Full Text].

20.   Marchi, M., and M. Raiteri. On the presence in the cerebral cortex of muscarinic receptor subtypes which differ in neuronal localization, function and pharmacological properties. J. Pharmacol. Exp. Ther. 235: 230-233, 1985[Abstract/Free Full Text].

21.   Matter, K., and I. Mellman. Mechanisms of cell polarity: sorting and transport in epithelial cells. Curr. Opin. Cell Biol. 6: 545-554, 1994[Medline].

22.   Matus-Leibovitch, N., M. Lupu-Meiri, and Y. Oron. Two types of intrinsic muscarinic responses in Xenopus oocytes. II. Hemispheric asymmetry of responses and receptor distribution. Pflügers Arch. 417: 194-199, 1990[Medline].

23.   McKinnon, L. A., and N. M. Nathanson. Tissue-specific regulation of muscarinic acetylcholine receptor expression during embryonic development. J. Biol. Chem. 270: 20636-20642, 1995[Abstract/Free Full Text].

24.   Mohuczy-Dominiak, D., and L. C. Garg. Characterization of cholinergic receptors in Madin-Darby canine kidney cells. J. Am. Soc. Nephrol. 3: 170-181, 1992[Abstract].

25.   Mohuczy-Dominiak, D., and L. C. Garg. Muscarinic receptors in MDCK cells are coupled to multiple messenger systems. Am. J. Physiol. 263 (Cell Physiol. 32): C1289-C1294, 1992[Abstract/Free Full Text].

26.   Paulmichl, M., J. Pfeilschifter, E. Wöll, and F. Lang. Cellular mechanisms of ATP-induced hyperpolarization in renal epitheloid MDCK cells. J. Cell. Physiol. 147: 68-75, 1991[Medline].

27.   Peralta, E. G., J. W. Winslow, G. L. Peterson, D. H. Smith, A. Ashkenazi, J. Ramachandran, M. I. Schimerlik, and D. J. Capon. Primary structure and biochemical properties of an M2 muscarinic receptor. Science 236: 600-605, 1987[Abstract/Free Full Text].

28.   Sambrook, J., E. F. Fritsch, and T. Maniatis. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.

29.   Shapiro, R. A., N. M. Scherer, B. A. Habecker, E. M. Subers, and N. M. Nathanson. Isolation, sequence, and functional expression of the mouse M1 muscarinic acetylcholine receptor gene. J. Biol. Chem. 263: 18397-18403, 1988[Abstract/Free Full Text].

30.   Simon, S. A., and H. C. Baggett. Identification of muscarinic acetylcholine receptors in isolated canine lingual epithelia via voltage clamp measurements. Arch. Oral Biol. 37: 685-690, 1992[Medline].

31.   Simonds, W. F. G protein regulation of adenylate cyclase. Trends Pharmacol. Sci. 20: 66-73, 1999[Medline].

32.   Slivka, S. R., and P. A. Insel. alpha 1-Adrenergic receptor-mediated phosphoinositide hydrolysis and prostaglandin E2 formation in Madin-Darby canine kidney cells: possible parallel activation of phospholipase C and phospholipase A2. J. Biol. Chem. 262: 4200-4207, 1987[Abstract/Free Full Text].

33.   Slivka, S. R., and P. A. Insel. Phorbol ester and neomycin dissociate bradykinin receptor-mediated arachidonic acid release and polyphosphoinositide hydrolysis in Madin-Darby canine kidney cells: evidence that bradykinin mediates noninterdependent activation of phospholipases A2 and C. J. Biol. Chem. 263: 14640-14647, 1988[Abstract/Free Full Text].

34.   Subers, E. M., and N. M. Nathanson. Muscarinic acetylcholine receptor function in chick heart cells cultured in serum-free medium. J. Mol. Cell. Cardiol. 20: 131-140, 1988[Medline].

35.   Tan, Y. P., A. Marty, and A. Trautmann. High density of Ca2+-dependent K+ and Cl- channels on the luminal membrane of lacrimal acinar cells. Proc. Natl. Acad. Sci. USA 89: 11229-11233, 1992[Abstract/Free Full Text].

36.   Toescu, E. C., A. M. Lawrie, O. H. Petersen, and D. V. Gallacher. Spatial and temporal distribution of agonist-evoked cytoplasmic Ca2+ signals in exocrine acinar cells analysed by digital image microscopy. EMBO J. 11: 1623-1629, 1992[Medline].

37.   Van Koppen, C. J., W. Lenz, and N. M. Nathanson. Isolation, sequence and functional expression of the mouse M4 muscarinic acetylcholine receptor gene. Biochim. Biophys. Acta 1173: 342-344, 1993[Medline].

38.   Wess, J. Molecular biology of muscarinic acetylcholine receptors. Crit. Rev. Neurobiol. 10: 69-99, 1996[Medline].

39.   Zegarra-Moran, O., G. Romeo, and L. J. V. Galietta. Regulation of transepithelial ion transport by two different purinoceptors in the apical membrane of canine kidney (MDCK) cells. Br. J. Pharmacol. 114: 1052-1056, 1995[Medline].


Am J Physiol Cell Physiol 277(6):C1220-C1228
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. S. Nadler, G. Kumar, and N. M. Nathanson
Identification of a Basolateral Sorting Signal for the M3 Muscarinic Acetylcholine Receptor in Madin-Darby Canine Kidney Cells
J. Biol. Chem., March 23, 2001; 276(13): 10539 - 10547.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nadler, L. S.
Right arrow Articles by Nathanson, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nadler, L. S.
Right arrow Articles by Nathanson, N. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online