Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 277: C974-C981, 1999;
0363-6143/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nori, A.
Right arrow Articles by Volpe, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nori, A.
Right arrow Articles by Volpe, P.
Vol. 277, Issue 5, C974-C981, November 1999

Targeting of calsequestrin to sarcoplasmic reticulum after deletions of its acidic carboxy terminus

Alessandra Nori, Eleonora Gola, Stefano Tosato, Marcello Cantini, and Pompeo Volpe

Centro di Studio per la Biologia e la Fisiopatologia Muscolare del Consiglio Nazionale delle Ricerche, Dipartimento di Scienze Biomediche Sperimentali dell'Università di Padova, 35121 Padua, Italy


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Calsequestrin (CS) is the Ca2+ binding protein of the junctional sarcoplasmic reticulum (jSR) lumen. Recently, a chimeric CS-HA1, obtained by adding the nine-amino-acid viral epitope hemagglutinin (HA1) to the COOH terminus of CS, was shown to be correctly segregated to the sarcoplasmic reticulum [A. Nori, K. A. Nadalini, A. Martini, R. Rizzuto, A. Villa, and P. Volpe. Am. J. Physiol. 272 (Cell Physiol. 41): C1420-C1428, 1997]. A putative targeting mechanism of CS to jSR implies electrostatic interactions between negative charges on CS and positive charges on intraluminal domains of jSR integral proteins, such as triadin and junctin. To test this hypothesis, 2 deletion mutants of chimeric CS were engineered: CS-HA1Delta Glu-Asp, in which the 14 acidic residues [-Glu-(Asp)5-Glu-(Asp)7-] of the COOH-terminal tail were removed, and CS-HA1Delta 49COOH, in which the last, mostly acidic, 49 residues of the COOH terminus were removed. Both mutant cDNAs were transiently transfected in HeLa cells, myoblasts of rat skeletal muscle primary cultures, or regenerating soleus muscle fibers of adult rats. The expression and intracellular localization of CS-HA1 mutants were studied by epifluorescence microscopy with use of antibodies against CS or HA1. CS-HA1 mutants were shown to be expressed, sorted, and correctly segregated to jSR. Thus short or long deletions of the COOH-terminal acidic tail do not influence the targeting mechanism of CS.

calcium binding protein; protein targeting


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE SARCOPLASMIC RETICULUM (SR) of skeletal muscle, a network of tubules and cisternae devoted to intracellular Ca2+ homeostasis, is composed of two continuous compartments: the nonjunctional SR, enriched in Ca2+ pump molecules, and the junctional SR (jSR), juxtaposed to the transverse tubules (TT) and enriched in Ca2+ release channels [also known as ryanodine receptors (RyR)] and calsequestrin (CS).

The SR is a subcompartment of the endoplasmic reticulum (ER), as indicated by the coexistence of ER general markers, such as BiP, calnexin, and PDI, with specific molecular components of Ca2+ stores, e.g., CS, Ca2+ pump, and RyR (26). The molecular differentiation of SR appears to occur from a wide-mesh ER membrane network, to include at an early stage the concentration of CS within membrane-bound structures also containing general ER markers, and progressively to evolve into the establishment of triad couplings between terminal cisternae (TC) and TT (4, 14, 24).

CS is an acidic (3, 22), low-affinity (dissociation constant ~1 mM), high-capacity (40-50 mol/mol) Ca2+ binding protein, the atomic resolution structure of which has been recently described (27). CS segregates to the jSR lumen, where it has been detected as electron-dense material, aggregates, paracrystalline arrays, or fiberlike network (5, 12), and plays a crucial role in the storage of Ca2+ between uptake and release cycles (16). CS lacks the characteristic COOH-terminal sequence KDEL (3) that ensures luminal retention, without segregation, to several ER proteins (e.g., BiP and PDI) through continuous recycling from pre-Golgi and Golgi compartments. Although a stage through the Golgi complex seems well established for CS (25), subsequent routes of intracellular trafficking are not yet clear. In particular, it is not known whether CS reaches SR via clathrin-coated cis/medial Golgi-derived vesicles (23) or whether it travels back to the ER, diffuses intraluminally to SR via ER/SR continuities (24, 26), and segregates to the jSR (5, 12). The presence of CS in the ER lumen and nonjunctional SR during early postnatal development (24) as well as in ER subdomains of transfected L6 myoblasts (6) would support the latter possibility.

We have developed a cellular and molecular biology approach to investigate the targeting mechanisms (sorting, retention, and segregation) of CS. A first accomplishment was the characterization of a chimeric cDNA, CS-HA1 cDNA (18): a DNA fragment coding for the nine amino acids of the influenza virus hemagglutinin (HA1) was added at the 3' terminus of the whole cDNA of rabbit skeletal muscle CS by PCR cloning. The complete construct was transiently transfected in nonmuscle recipient (HeLa) cells, myoblasts isolated from 0- to 3-day-old rat skeletal muscle, and regenerating skeletal muscles of adult rats. Expression and intracellular localization of CS-HA1 were monitored with anti-CS and anti-HA1 antibodies and revealed that 1) chimeric CS-HA1 is correctly sorted to ER/SR compartments in muscle and nonmuscle systems, 2) the HA1 epitope does not alter the structure and/or the sequence of the signal(s) involved in CS retention, 3) the free COOH terminus is not required for targeting of CS, and 4) CS-HA1 segregates to the jSR of regenerating skeletal muscle fibers of adult rats after in vivo transfection of CS-HA1 cDNA (20). Thus CS-HA1 lends itself as a powerful tool for the identification of targeting sequences of CS by site-directed mutagenesis.

CS segregation to the jSR can be hypothetically accounted for by integral proteins, restricted in their expression to the jSR (8, 11, 13, 29) and able to bind CS [CS-binding protein(s)] with their luminal, mostly basic domain. Triadin (TD) and junctin (JC), both integral membrane proteins, are putative CS-binding proteins and have been recently cloned and sequenced (11, 13); moreover, the RyR can also form complexes with CS (17, 29). CS segregation to the jSR might also be accounted for by specific recognition sites on mostly acidic domains of CS, for interaction with TD and/or JC, and, possibly, with RyR. Given the known primary sequences of CS and of the luminal domains of TD, JC, and RyR, electrostatic interactions are likely. It is not known, however, which and where such putative CS domains might be.

In a first attempt to identify such domains, we have thus engineered two CS-HA1 deletion mutants, CS-HA1Delta Glu-Asp and CS-HA1Delta 49COOH. In the first case, we have removed the COOH-terminal acidic tail (Glu354-Asp367) made of 14 amino acids [-Glu-(Asp)5-Glu-(Asp)7-] and, in the second case, the 49 residues at the COOH terminus, which are mostly acidic (42% Glu + Asp) (3). The results reported here show that the mostly acidic COOH terminus of CS, irrespective of length of deletion, appears not to be needed for sorting, retention, and segregation of CS to the jSR. The results are also interpreted in the framework of knowledge derived from the crystal structure of CS (27).


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Generation of CS-HA1Delta Glu-Asp cDNA and CS-HA1Delta 49COOH cDNA

The CS-HA1Delta Glu-Asp cDNA was generated as follows: the 948-bp BamH 1-EcoR 1 cDNA fragment, encoding 291 amino acids of rabbit skeletal muscle CS and containing 75 bp of the 5' untranslated end (3), was isolated from the original plasmid and ligated to the pBSK+ vector (Stratagene) precleaved with BamH 1 and EcoR 1. Modification of the 3' cDNA end with deletion of the last 42 bp and addition of 27 bases coding for 9 amino acids of HA1 (3) was performed by PCR. The following PCR primers were used: 1) forward primer consisting of 5'-GAATTCTTAGAGATTCTCAAGTCT-3' and 2) reverse primer consisting of 5'-CTA<OVL>GAGGCTAGCATAAT</OVL>- <OVL>CAGGAACATCATA</OVL>TGTGTTGATCTCACCCTCCAGCAC-3'. For the reverse primer, underlined nucleotides represent the coding sequence of the HA1 tag (28), whereas the stop codon is indicated by characters in small capitals. PCR amplification was performed over 30 cycles (2 min at 95°C, 30 s at 61°C, 30 s at 50°C, and 2 min at 72°C). The PCR-generated fragment was initially inserted with blunt ends into Sma I-cut pBS+ (Stratagene), excised by EcoR I-Sal I, and fused to the BamH I-EcoR I fragment to create the pBSK+CS-HA1Delta Glu-Asp plasmid. For expression in eucaryotic systems, the chimeric cDNA was isolated and inserted into Not I-Xho I sites of the expression vector pcDNA3 (InVitrogen, San Diego, CA) downstream from the CMV promoter; the final construct was called pCS-HA1Delta Glu-Asp.

The CS-HA1Delta 49COOH was developed using an identical cloning strategy with the same forward primer and a different reverse primer: 5'-CTA<OVL>GAGGCTAGCATAATCAGGAACAT</OVL>- <OVL>CATA</OVL>AGTAACATTGACGACTCCTATTTG-3', with underlined nucleotides being the coding sequence of the HA1 tag (28) and the stop codon being represented by characters in small capitals. The final construct, devoid of 147 bp at the 3' end, was called pCS-HA1Delta 49COOH.

Orientation and correct sequence of chimeric mutants were checked by restriction assays, and sequence of the synthetic region was obtained by the dideoxy chain termination method (21) with use of modified T7 DNA polymerase.

Cell Cultures

HeLa cells. HeLa cells were grown in DMEM containing 2 mM glutamine and 10% FCS.

Primary cultures of skeletal muscle rat myoblasts and differentiation into myotubes. Primary myoblasts were isolated from hindlimb skeletal muscles of 0- to 3-day-old rats. After the isolated muscles were washed several times in 125 mM PBS, pH 7.4, and subjected to three 20-min stages of trypsinization (2.5% trypsin in PBS) at 37°C and mixing with a vortex every 4 min, supernatants were collected and trypsin was inhibited by addition of 2% horse serum (HS). Cells were then collected by centrifugation and preplated in 9-cm-diameter plates for 1 h at 37°C. The myoblast-enriched supernatant was centrifuged, and cells were finally resuspended in DMEM supplemented with 20% FCS and 20 mM glucose, counted, and plated. Differentiation was obtained by changing the medium to DMEM with 10-20% HS and subsequently DMEM with 2% HS. A few nonmuscle cells were occasionally transfected (see Fig. 2D).

Bupivacaine-Induced Necrosis and Regeneration of Adult Rat Skeletal Muscle

Male adult Wistar rats (~250 g body wt) were anesthetized with ketamine (1.5 mg/100 g body wt). The right soleus muscles were exposed and injected with 0.4 ml of 0.5% bupivacaine, as described previously (18). Muscles were removed 3 or 10 days later and frozen in liquid nitrogen. In agreement with previous reports (9, 25), the local anesthetic bupivacaine induced almost complete necrosis of the whole soleus by day 3. Regeneration started by day 3 and was completed by day 10.

Generation of Transient Transfectants

Twenty-four hours before transfection, HeLa cells or primary myoblasts were seeded onto 25-mm-diameter wells of a 24-well Corning plate containing a 13-mm-diameter round coverslip with a cell density suitable to obtain 50% confluence at the moment of transfection. pCS-HA1Delta Glu-Asp, pCS-HA1Delta 49COOH, or the control pcDNA3 vector (4 µg/well) was transfected by the calcium phosphate precipitation method (7), as previously described (18). Forty-eight hours after transfection, cells were fixed for immunofluorescence; incubation of myoblasts was prolonged, and the medium was changed for differentiation.

Adult rat soleus muscles were exposed 3 days after bupivacaine injection under ketamine anesthesia and injected with 100 µg of plasmid DNA in 20% sucrose. Rats were killed 7 days later, and transfected and mock-transfected, contralateral muscles were excised, frozen, and processed for immunocytochemistry.

Immunofluorescence

Cells were fixed in 4% paraformaldehyde and 0.25% glutaraldehyde in PBS for 15 min and permeabilized with 0.3% Triton X-100, 20 mM phosphate buffer, pH 7.4, 0.45 M NaCl, and 15% goat serum (buffer A) for 30 min. Incubation with polyclonal anti-CS (24, 26) and monoclonal anti-CS (Affinity Bioreagents) or monoclonal and polyclonal anti-HA1 antibodies (BabCO and Santa Cruz Biotechnology, respectively) was performed at room temperature for 1.5 h in buffer A. After they were washed for 1 h, cells were incubated for 30 min with rhodamine isothiocyanate or fluorescein-conjugated anti-mouse or anti-rabbit antibodies (DAKO). Images were obtained with a Zeiss Axioplan microscope or a Leica DMRB microscope. Transverse 9-µm and longitudinal 6-µm sections were obtained for soleus muscles, as described previously (24, 26).

Preparation of Homogenates From HeLa Cells and Myotubes and of SR Vesicles From Rabbit Skeletal Muscles

HeLa cells and myotubes were cultured as described above, transiently transfected with pCS-HA1Delta Glu-Asp for 2 and 4 days, respectively, harvested in PBS, pH 7.4, rinsed, and lysed in 1 ml of 150 mM NaCl, 15 mM MgCl2, 1 mM EGTA, 1 mM PMSF, 50 mM HEPES, pH 7.5, 10% glycerol, and 1% Triton X-100 for 30 min at 0°C under shaking. The lysate was kept at -20°C until use.

Purified SR vesicles referable to terminal cisternae enriched in CS were prepared as described previously (26) from rabbit skeletal muscles. Protein concentration was determined according to Lowry et al. (15).

SDS-PAGE and Western Blot

SDS-PAGE on 10% acrylamide gels and immunoblot, with anti-CS or anti-HA1 antibodies, were carried out as previously described (19).

Materials

DMEM and complements were purchased from Technogenetics (Milan, Italy), Waymouth's MB from ICN, and DNA modification and restriction enzymes from Boehringer Mannheim and New England Biolabs, except T7 DNA polymerase, which was purchased from Pharmacia. All other chemicals were obtained from Sigma Chemical.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of the CS-HA1Delta Glu-Asp cDNA

To obtain a mutant chimeric CS cDNA (CS-HA1Delta Glu-Asp cDNA), encoding for a CS immunologically distinguishable from endogenous CS and lacking the acidic tail at the COOH terminus, the 3' end of the coding region of rabbit skeletal muscle CS cDNA was modified by 1) deletion of the last 42 bp coding for 14 amino acids [-Glu-(Asp)5-Glu-(Asp)7-] and 2) addition of a 27-bp fragment coding for 9 amino acids of the influenza virus HA1, as detailed in MATERIALS AND METHODS.

Orientation, sequence, and restriction map of the "synthetic" part of the cDNA were determined by sequencing. Sequence experiments indicate that 1) the synthetic CS cDNA fragment was correctly fused to the EcoR I site and the whole cDNA was an uninterrupted open reading frame, 2) no additional restriction sites were created by the procedure (e.g., due to partial digestion with EcoR I), 3) the sequence of the CS cDNA corresponded to the original skeletal muscle CS cDNA sequence, and 4) the 3' end of the CS cDNA had been modified by addition of the tag (HA1) coding sequence and by deletion of the last 14 amino acid residues. The complete cDNA was transferred, by directional cloning, downstream from the CMV promoter of the eucaryotic expression vector pcDNA3, suitable for transient and stable transfection in eucaryotic cells. The resulting construct (called pCS-HA1Delta Glu-Asp) included the coding regions for the leader sequence, the COOH-terminal-deleted CS, the HA1 tag, and the final stop codon.

Thus the construct was useful for transfection and expression of a mutant chimeric CS, immunologically distinguishable from endogenous CS, and suitable to test the role of the COOH-terminal acidic tail in the segregation mechanism of CS.

CS-HA1Delta Glu-Asp Expression in Transiently Transfected HeLa Cells: Recognition by Anti-CS and Anti-HA1 Antibodies

After transfection of HeLa cells, expression of the mutant chimeric CS-HA1Delta Glu-Asp was studied in immunofluorescence experiments with anti-CS antibodies or anti-HA1 antibodies (Fig. 1, A and B, respectively). About 30% of transfected cells were strongly CS positive, and no differences were detected when the reactivity patterns with the two antibodies were compared; thus identification by anti-HA1 monoclonal antibodies was not affected by the overall steric conformation of the mutant protein that could hide the epitope itself. On the contrary, control cells transfected with the empty pcDNA3 vector (mock-transfected cells) were CS negative (Fig. 1C), as expected from the lack of expression of endogenous CS in HeLa cells, nor did they immunostain with anti-HA1 antibodies (Fig. 1D).


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 1.   Immunofluorescence pattern of HeLa cells transiently transfected with CS-HA1Delta Glu-Asp cDNA. Two days after transfection with pCS-HA1Delta Glu-Asp (A and B) or pcDNA3 (C and D), cells were fixed and decorated with monoclonal anti-HA1 (B and D) or polyclonal anti-CS (A and C) antibodies. Eight different preparations of HeLa cells were analyzed. HA, hemagglutinin; CS, calsequestrin. Scale bar, 5 µm.

The epifluorescence pattern obtained with both antibodies demonstrated that CS-HA1Delta Glu-Asp was retained into the endomembrane network of HeLa cells (Fig. 1, A and B) and did not have a cytoplasmic distribution.

Compartmentalization of CS-HA1Delta Glu-Asp in SR/ER Membranes of Rat Myotubes in Double-Labeling Experiments

The possible effects of COOH-terminal deletion were initially studied on transfection of CS-HA1Delta Glu-Asp cDNA in myoblasts. Myoblasts from 0- to 3-day-old rat hindlimb skeletal muscles were cultured in vitro, induced to differentiate into myotubes (18; see MATERIALS AND METHODS), and harvested 4 days after induction. "Transfected myotubes," thus, indicate myotubes obtained from transfected myoblasts by this procedure.

Expression of CS-HA1Delta Glu-Asp was detected in ~20% of rat myotubes by anti-HA1 antibodies, whereas almost all myotubes are CS positive, as indicated by reactivity with anti-CS antibodies. The immunofluoresence pattern was similar with anti-CS antibodies or anti-HA1 antibodies, i.e., fluorescent strands running parallel to the longitudinal axis of the myotubes, suggesting the longitudinal arrangement of the ER/SR membrane network (cf. Ref. 13). Under the prevailing experimental conditions, discrete CS foci were rarely observed.

Double-labeled transfected myotubes were observed by immunofluoresence: similar patterns of fluorescence were obtained with anti-CS or anti-HA1 antibodies (cf. Fig. 2, A and B). Merge of the two images showed overlap of the antibody reactivity (Fig. 2C); on the contrary, no red regions (corresponding to the HA1 epitope) were observed. Thus transfected myotubes display complete colocalization of recombinant CS-HA1Delta Glu-Asp with endogenous CS, whereas nontransfected myotubes express only endogenous CS (green myotubes in Fig. 2, C and D).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Immunofluorescence of double-labeled rat skeletal muscle myotubes differentiated from myoblasts transiently transfected with CS-HA1Delta Glu-Asp cDNA. Transfection was carried out with pCS-HA1Delta Glu-Asp (A-D) or pcDNA3 (not shown), and fixed myotubes were sequentially decorated with monoclonal anti-CS (A) or polyclonal anti-HA1 (B) antibodies. Distribution of HA1 epitope (red) was detected with anti-HA1 antibodies and rhodamine-conjugated anti-rabbit antibodies; distribution of CS (green) was detected with anti-CS antibodies and fluorescein-conjugated anti-mouse antibodies. C: merge of A and B. Green, multinucleated myotubes in C and D represent nontransfected myotubes expressing endogenous CS. Six different preparations of myotubes were analyzed. Scale bar, 10 µm.

Detection of CS-HA1Delta Glu-Asp in Homogenates Derived From HeLa Cells or Rat Myotubes

The expression of recombinant CS was assayed by Western blots. Transfected HeLa cells or transfected myotubes were cultured as described above, lysed, and analyzed by SDS-PAGE. Western blots of HeLa cell and myotube homogenates with anti-HA1 antibodies show that the pCS-HA1Delta Glu-Asp construct yielded a single protein band with an apparent molecular weight of ~63,000 (Fig. 3, lanes b-f ), comparable to that of the CS isoform from rabbit skeletal muscle SR (Fig. 3, top band, CSSK, in lanes c and g). The deduced molecular weight of the mutant CS (41,776) is, in fact, very close to that of skeletal muscle CS (41,630) (3), since the net difference is given by five amino acids. SR vesicles (Fig. 3, bottom band, CSC, in lanes c and g) and myotubes (Fig. 3, bottom band, CSC, in lane h) display, as expected, the minor cardiac CS isoform (1, 22, 26).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3.   Western blot of homogenates from HeLa cells (b and d) and rat myotubes (f and h) transfected with CS-HA1Delta Glu-Asp cDNA and of purified sarcoplasmic reticulum (SR) vesicles (a, c, e, and g). Purified SR vesicles (10 µg) and homogenates (80 µg) were separated on 10% polyacrylamide gels and transferred to nitrocellulose. Immunostaining was carried out with monoclonal anti-HA1 (a, b, e, and f) or polyclonal anti-CS (c, d, g, and h) antibodies. Apparent molecular weight of CS-HA1 (lanes b and f) and of skeletal muscle CS (top band, CSSK, lanes c, g, and h) is ~63,000, as determined from a graph of relative mobilities vs. logarithm of Bio-Rad molecular weight standards. Bottom band, CSC, in lanes c, g, and h is cardiac CS isoform, known to be present in minor amount in SR fractions derived from skeletal muscles and in differentiating myotubes.

The results also indicate that the epitope(s) recognized by either antibody was within the recombinant protein. Moreover, no proteolytic breakdown products could be detected, and this rules out the possibility that the chimeric protein, as it may happen (6, 20), undergoes accelerated or altered turnover, which, in turn, may result in misleading interpretation of immunofluorescence data.

Targeting of CS-HA1Delta Glu-Asp in Regenerating Skeletal Muscle Fibers of Adult Rats

The last experimental approach relies on knowledge that 1) bupivacaine injected into the soleus muscle of adult rats (9) causes complete necrosis within 3 days and regeneration in the following 7 days and 2) regenerating muscle fibers display a higher efficiency of transfection (25). Thus transfection of CS-HA1Delta Glu-Asp cDNA in soleus muscle allows us to determine whether and where the mutant chimeric CS-HA1Delta Glu-Asp is targeted in vivo, in particular, whether it segregates to the jSR, at the completion of the regeneration process (18).

Figure 4 shows that, 10 days after bupivacaine treatment, all skeletal muscle fibers were labeled with anti-CS antibodies (Fig. 4A), whereas only a few fibers, as expected, were labeled with anti-HA1 antibodies (Fig. 4B), as judged, in both cases, by immunofluorescence of transverse sections. Thus a few fibers express the recombinant CS-HA1Delta Glu-Asp.


View larger version (86K):
[in this window]
[in a new window]
 
Fig. 4.   Immunofluorescence of soleus muscle fibers after bupivacaine treatment. All sections were obtained 10 days after bupivacaine treatment, i.e., when muscle regeneration is deemed complete (9), and 7 days after transfection with CS-HA1Delta Glu-Asp cDNA. A: transverse section labeled with polyclonal anti-CS antibodies. B: transverse section labeled with monoclonal anti-HA1 antibodies. Scale bar, 16 µm.

Localization of CS-HA1Delta Glu-Asp was thoroughly investigated by immunofluorescence of double-labeled longitudinal sections of soleus muscle fibers. Figure 5, A (anti-CS antibodies) and B (anti-HA1 antibodies), shows that CS-HA1Delta Glu-Asp was indeed localized at the A-I interface, as indicated by the typical, regular banding pattern of punctate fluorescence, i.e., two rows of triads on either side of the Z line. Merge images (Fig. 5C) clearly indicate colocalization of endogenous and recombinant CS-HA1Delta Glu-Asp at the TC level.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 5.   Immunofluorescence of soleus muscle fibers after bupivacaine treatment and transfection with CS-HA1Delta Glu-Asp cDNA. Double-labeled, longitudinal sections were stained sequentially with monoclonal anti-CS antibodies (green in A) and polyclonal anti-HA1 antibodies (red in B). Note 2 rows of punctate labeling on either side of Z lines corresponding to terminal cisternae. C: merge of A and B, at higher magnification. Six different muscle preparations were examined. Scale bars, 10 µm in A and B and 5 µm in C.

Targeting of CS-HA1Delta 49COOH in Regenerating Skeletal Muscle Fibers of Adult Rats

Glu and Asp residues are clustered along the last 49 amino acids of the CS COOH terminus and make up 42% of it (3). To further examine the role of negatively charged residues at the COOH terminus in the segregation mechanism of CS, we next studied expression and subcellular localization of a second deletion mutant, CS-HA1Delta 49COOH. In preliminary experiments, CS-HA1Delta 49COOH cDNA was transfected in HeLa cells, and expression of mutant CS-HA1 was studied by immunofluorescence with anti-CS antibodies or anti-HA1 antibodies; ~30% of transfected cells were strongly CS positive, and no differences were detected in the reactivity patterns of the two antibodies (not shown).

Localization of CS-HA1Delta 49COOH was investigated by immunofluorescence of double-labeled longitudinal sections of regenerating and transfected soleus muscle fibers. Figure 6, A (anti-CS antibodies) and B (anti-HA1 antibodies), clearly shows that CS-HA1Delta 49COOH displayed a regular pattern of punctate fluorescence, as implied by two contiguous bands of punctate labeling localized at the A-I interface.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6.   Immunofluorescence of soleus muscle fibers after bupivacaine treatment and transfection with CS-HA1Delta 49COOH cDNA. Double-labeled, longitudinal sections were stained sequentially with monoclonal anti-CS antibodies (green in A) and polyclonal anti-HA1 antibodies (red in B). Four different muscle preparations were examined. Scale bar, 5 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Targeting of CS includes sorting, retention to the SR, and segregation to the jSR of skeletal muscle. The rationale of experiments reported here is that by comparing the intracellular routing and subcellular localization of wild, chimeric, or mutant/chimeric CSs that can be secreted, retained but not segregated, or retained and segregated to restricted membrane compartments, i.e., jSR, information is gathered regarding the intrinsic targeting mechanism(s) of CS.

Two deletion mutant cDNA clones, CS-HA1Delta Glu-Asp and CS-HA1Delta 49COOH, have been designed and characterized to verify one of the putative targeting mechanisms of CS to the jSR; such a mechanism would involve electrostatic interactions between acidic domains of CS and basic luminal domains of jSR integral proteins, e.g., TD, JC, and possibly RyR. The two deletion mutants differ in the extent of deletion at the COOH terminus, 14 vs. 49 amino acid residues.

The first recombinant CS, CS-HA1Delta Glu-Asp, was engineered so that 1) intracellular routing and subcellular localization could be monitored by specific antibodies directed to the chimeric tag HA1 and 2) a 42-bp fragment was deleted at the 3' end of the coding region to investigate the specific role of the COOH-terminal tail, made of 14 acidic amino acids [-Glu-(Asp)5-Glu-(Asp)7-], in the electrostatic interaction(s) with intraluminal basic domains of jSR proteins.

The present results show that the mutant CS-HA1Delta Glu-Asp is 1) sorted to endomembrane compartments in HeLa cells (Fig. 1), 2) sorted and retained to the SR of differentiating rat myotubes (Fig. 2), and 3) segregated to the jSR of skeletal muscle fibers (Fig. 5) after in vivo transfection of the recombinant cDNA.

Clear-cut data are derived from in vivo transfection of CS-HA1Delta Glu-Asp cDNA into regenerating skeletal muscle fibers of adult rats (Figs. 4 and 5): mutant CS is not only sorted and retained to the SR but, more importantly, also segregates to TC. Expression of CS-HA1Delta Glu-Asp during muscle regeneration, i.e., during SR biogenesis, TC development, and triad formation, indicates that deletion of the COOH-terminal acidic tail does not affect CS segregation to the jSR. Thus not only is the free COOH terminus of CS not required for sorting, retention, and segregation to the jSR (18), but also the COOH-terminal acidic tail is not, apparently, involved in protein-protein electrostatic interactions.

Franzini-Armstrong et al. (5), on the basis of freeze-fracture studies of skeletal muscle triads, described a network of CS aggregates in the jSR lumen as being constituted by long fiber structures, which are fully compatible with the Ca2+-induced linear polymers or multimer of dimers of CS recently described by Wang et al. (27). The present results indicate that deletion of the CS tail does not appear to interfere with dimerization and polymerization of CS, in agreement with crystal structure data (27).

If multiple protein-protein interactions were envisioned to account for CS targeting and if the CS COOH terminus were indeed involved, one alternative interpretation of our results would be that CS-HA1Delta Glu-Asp segregates, despite the "short" CS tail deletion. Because the last 49 amino acid residues of the COOH terminus are mostly acidic, i.e., 42% Glu-Asp (3), it might be that the short deletion is not sufficient to abolish the interaction of CS with the anchoring protein(s). To test the effects of a longer deletion at the COOH terminus, a second deletion mutant CS cDNA, CS-HA1Delta 49COOH cDNA, was developed and transfected in vivo into regenerating skeletal muscle fibers of adult rats. Because CS-HA1Delta 49COOH is segregated to TC (Fig. 6), it might be safely concluded that the acid COOH terminus, as a whole, does not affect CS targeting.

Segregation of CS to jSR may be a complex mechanism and entail docking, i.e., heterologous protein-protein interactions, and self-aggregation of CS, i.e., homologous protein-protein interactions. Intra- and/or intermolecular interactions between the SAH and DBH sites on CS have been proposed as crucial for Ca2+-induced folding (10) and self-aggregation (10, 27). If we assume, despite evidence to the contrary (present results and Ref. 27), that the COOH-terminal acidic tail were essential for segregation to the jSR, the presence of endogenous CS (wtCS) in myotubes and regenerating muscle fibers (Figs. 2, 5, and 6) might lead to erroneous interpretations. Mixed (CS-HA1Delta Glu-Asp/wtCS or CS-HA1Delta 49COOH/wtCS) aggregates could still form, whereas the acidic tails of wtCS might interact with jSR anchoring proteins. In vitro and in vivo experimental systems are being developed to address directly the latter issue.

Overall, the present results are in agreement with recent crystal structure data (27): Ca2+-induced CS "dimerization interface forms a large pocket lined with many acidic residues. The disordered C-terminal segments" (residues 352-367) "create a very electronegative enclosure within this pocket." Thus it appears that the mostly acidic COOH terminus, on the basis of not only present data with two different deletion mutants but also distinct structural considerations (27), is not involved in homologous and heterologous protein-protein interaction but in Ca2+ binding.

Finally, we note that the targeting mechanism of CS, based on electrostatic interactions, may still hold true: it is entirely plausible that other CS domains are involved, and among them are to be listed acidic stretches located on the surface of each of the three topological domains (2, 27), the switch points of domain II and III (around residues 228-229), rich in acidic amino acids (27), and the NH2 terminus of CS (8, 27, 29).


    ACKNOWLEDGEMENTS

We thank Dr. F. Patiri for help in some immunofluorescence experiments.


    FOOTNOTES

This work was supported by Telethon, Italy, Grant 669 and by funds from the Ministero dell'Università e della Ricerca Scientifica e Tecnologica (1997, Programma di ricerca di rilevante interesse nazionale on "Biopatologia della fibra muscolare scheletrica").

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: P. Volpe, Dept. di Scienze Biomediche Sperimentali, Università degli Studi di Padova, viale G. Colombo 3, 35121 Padua, Italy (E-mail: volpe{at}civ.bio.unipd.it).

Received 28 December 1998; accepted in final form 16 July 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Cala, S. E., J. J. O'Brian, A. I. Daud, and L. R. Jones. Phosphorylation of cardiac calsequestrin in atrial tumor cells and transfected COS-1 cells (Abstract). Biophys. J. 64: A194, 1993.

2.   Collins, J. H., A. Tarcsafalvi, and N. Ikemoto. Identification of a region of calsequestrin that binds to the junctional face membrane of sarcoplasmic reticulum. Biochem. Biophys. Res. Commun. 167: 189-193, 1990[Medline].

3.   Fliegel, L., M. Ohnishi, M. R. Carpenter, V. K. Khanna, R. A. F. Reithmeier, and D. H. MacLennan. Amino acid sequence of rabbit fast-twitch skeletal muscle calsequestrin deduced from cDNA and peptide sequence. Proc. Natl. Acad. Sci. USA 84: 1167-1171, 1987[Abstract/Free Full Text].

4.   Flucher, B. E. Structural analysis of muscle development: transverse tubules, sarcoplasmic reticulum and the triad. Dev. Biol. 154: 245-260, 1992[Medline].

5.   Franzini-Armstrong, C., L. J. Kenney, and M. Varriano-Marston. The structure of calsequestrin in triads of vertebrate skeletal muscle: a deep-etch study. J. Cell Biol. 105: 49-56, 1987[Abstract/Free Full Text].

6.   Gatti, G., P. Podini, and J. Meldolesi. Overexpression of calsequestrin in L6 myoblasts: formation of endoplasmic reticulum subdomains and their evolution into discrete vacuoles where aggregates of the protein are specifically accumulated. Mol. Biol. Cell 8: 1789-1803, 1997[Abstract].

7.   Graham, F. L., and A. J. Van der Ed. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52: 456-467, 1973[Medline].

8.   Guo, W., and K. P. Campbell. Association of triadin with the ryanodine receptor and calsequestrin in the lumen of the sarcoplasmic reticulum. J. Biol. Chem. 270: 9027-9030, 1995[Abstract/Free Full Text].

9.   Hall-Graggs, E. C. B. Rapid degeneration and regeneration of a whole skeletal muscle following treatment with bupivacaine (marcaine). Exp. Neurol. 43: 349-358, 1974[Medline].

10.   He, Z., A. K. Dunker, C. R. Wesson, and W. R. Trumble. Ca2+-induced folding and aggregation of skeletal muscle sarcoplasmic reticulum calsequestrin. J. Biol. Chem. 260: 24635-24641, 1993.

11.   Jones, L. R., L. Zhang, K. Sanborn, A. O. Jorgensen, and J. Kelley. Purification, primary structure, and immunological characterization of the 26-kDa calsequestrin binding protein (junctin) from cardiac junctional sarcoplasmic reticulum. J. Biol. Chem. 270: 30787-30796, 1995[Abstract/Free Full Text].

12.   Jorgensen, A. O., V. I. Kalnins, E. Zubrzycka, and D. H. MacLennan. Assembly of the sarcoplasmic reticulum proteins in differentiating rat skeletal muscle cell cultures. J. Cell Biol. 74: 287-298, 1977[Abstract/Free Full Text].

13.   Knudson, C. M., K. J. Stang, C. R. Moomaw, C. A. Slaughter, and K. P. Campbell. Primary structure and topological analysis of a skeletal muscle-specific junctional sarcoplasmic reticulum glycoprotein (triadin). J. Biol. Chem. 268: 12646-12654, 1993[Abstract/Free Full Text].

14.   Koyabu, S., I. Y. Kyoko, S. O. Ioshii, T. Nakano, and T. Yoshida. Switching of the dominant calcium sequestering protein during skeletal muscle differentiation. Cell Motil. Cytoskeleton 29: 259-270, 1994[Medline].

15.   Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 266: 9453-9459, 1951[Abstract/Free Full Text].

16.   Lytton, J., and S. K. Nigam. Intracellular calcium: molecules and pools. Curr. Opin. Cell Biol. 4: 220-226, 1992[Medline].

17.   Murray, B. E., and K. Ohlendieck. Complex formation between calsequestrin and the ryanodine receptor in fast- and slow-twitch rabbit skeletal muscle. FEBS Lett. 429: 317-322, 1998[Medline].

18.   Nori, A., K. A. Nadalini, A. Martini, R. Rizzuto, A. Villa, and P. Volpe. Chimeric calsequestrin and its targeting to the junctional sarcoplasmic reticulum of skeletal muscle. Am. J. Physiol. 272 (Cell Physiol. 41): C1420-C1428, 1997[Abstract/Free Full Text].

19.   Nori, A., A. Villa, P. Podini, D. R. Witcher, and P. Volpe. Intracellular Ca2+ stores of rat cerebellum: heterogeneity within and distinction from endoplasmic reticulum. Biochem. J. 291: 199-204, 1993.

20.   Raichman, M., M. C. Panzeri, E. Clementi, P. Papazafiri, M. Eckley, D. O. Clegg, A. Villa, and J. Meldolesi. Differential localization and functional role of calsequestrin in growing and differentiated myoblasts. J. Cell Biol. 128: 341-354, 1995[Abstract/Free Full Text].

21.   Sanger, F., F. Nicklen, and A. R. Coulson. DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA 74: 5463-5467, 1997.

22.   Scott, B. J., H. K. B. Simmermann, J. H. Collins, B. Nadal-Ginard, and L. R. Jones. Complete amino acid sequence of canine cardiac calsequestrin deduced by cDNA cloning. J. Biol. Chem. 263: 8958-8964, 1988[Abstract/Free Full Text].

23.   Thomas, K., J. Navarro, R. J. J. Benson, K. P. Campbell, R. L. Rotundo, and R. E. Fine. Newly synthesized calsequestrin, destined for the sarcoplasmic reticulum, is contained in early/intermediate Golgi-derived clathrin-coated vesicles. J. Biol. Chem. 264: 3140-3145, 1989[Abstract/Free Full Text].

24.   Villa, A., P. Podini, A. Nori, C. Panzeri, A. Martini, J. Meldolesi, and P. Volpe. The endoplasmic reticulum-sarcoplasmic reticulum connection. II. Postnatal differentiation of the sarcoplasmic reticulum in skeletal muscle fibers. Exp. Cell Res. 209: 140-148, 1993[Medline].

25.   Vitadello, M., M. V. Schiaffino, A. Picard, M. Scarpa, and S. Schiaffino. Gene transfer in regenerating muscle. Hum. Gene Ther. 5: 11-18, 1994[Medline].

26.   Volpe, P., A. Villa, P. Podini, A. Martini, A. Nori, M. C. Panzeri, and J. Meldolesi. The endoplasmic reticulum-sarcoplasmic reticulum connection: distribution of endoplasmic reticulum markers in the sarcoplasmic reticulum of skeletal muscle fibers. Proc. Natl. Acad. Sci. USA 89: 6142-6146, 1992[Abstract/Free Full Text].

27.   Wang, S., W. R. Trumble, H. Liao, C. R. Wesson, A. K. Dunker, and C.-H. Kang. Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat. Struct. Biol. 5: 476-483, 1998[Medline].

28.   Wilson, I. A., H. L. Niman, R. A. Houghten, A. R. Cherenson, M. L. Connolly, and R. A. Lerner. The structure of an antigenic determinant in a protein. Cell 37: 767-778, 1984[Medline].

29.   Zhang, L., J. Kelley, G. Schmeisser, Y. M. Kobayashi, and L. R. Jones. Complex formation between junctin, triadin, calsequestrin, and the ryanodine receptor. J. Biol. Chem. 272: 23389-23397, 1997[Abstract/Free Full Text].


Am J Physiol Cell Physiol 277(5):C974-C981
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
A. Nori, G. Valle, E. Bortoloso, F. Turcato, and P. Volpe
Calsequestrin targeting to sarcoplasmic reticulum of skeletal muscle fibers
Am J Physiol Cell Physiol, August 1, 2006; 291(2): C245 - C253.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
K. Culligan, N. Banville, P. Dowling, and K. Ohlendieck
Drastic reduction of calsequestrin-like proteins and impaired calcium binding in dystrophic mdx muscle
J Appl Physiol, February 1, 2002; 92(2): 435 - 445.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nori, A.
Right arrow Articles by Volpe, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nori, A.
Right arrow Articles by Volpe, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online