Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 276: C1154-C1161, 1999;
0363-6143/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spindler, B.
Right arrow Articles by Verrey, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spindler, B.
Right arrow Articles by Verrey, F.
Vol. 276, Issue 5, C1154-C1161, May 1999

Aldosterone action: induction of p21ras and fra-2 and transcription-independent decrease in myc, jun, and fos

Benjamin Spindler and François Verrey

Institute of Physiology, University of Zürich, CH-8057 Zürich, Switzerland


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Adrenal steroids induce an increase in transcellular Na+ reabsorption across Xenopus laevis A6 cell epithelia that requires the action of transcriptionally regulated gene products. In a previous study we identified K-ras2 as an aldosterone-upregulated mRNA in A6 epithelia. Here, we show that in vivo injection of aldosterone in Xenopus (2.5 h) increases K-ras2 mRNA specifically in the kidney (2.5-fold) and that in A6 epithelia aldosterone (2.5 h) increases Ras protein synthesis (~6-fold). Xl-ras, another ras mRNA expressed at a low level in A6 cells, was also induced (2-fold). Aldosterone was shown to regulate the mRNA levels of several transcription factors as well. After 2 h of aldosterone treatment, fra-2 mRNA was upregulated by 130%, whereas c-myc, c-jun, c-fos, and glucocorticoid receptor mRNAs were downregulated by 23-43%. After 16 h, c-fos and GR mRNAs were further decreased, whereas levels of fra-2, c-jun, and c-myc began to return to control levels. Interestingly, the downregulation of the protooncogene mRNAs was independent of transcription. These results support the view that aldosterone exerts complex pleiotropic transcriptional and nontranscriptional actions that involve the regulation of signaling cascade elements (i.e., K-Ras2) as well as that of transcription factors.

epithelial sodium transport; K-Ras; glucocorticoid receptor; mineralocorticoid receptor; messenger ribonucleic acid stability


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ALDOSTERONE STIMULATES Na+ reabsorption across tight epithelia, a two-step mechanism involving the apical amiloride-sensitive Na+ channel and the basolateral Na+ pump (Na+-K+-ATPase). As shown in amphibian model epithelia, the early phase of Na+ transport increase starts after a lag period of ~45 min and is characterized by an activation of preexisting Na+ channels and pumps. The late phase starts ~3 h after aldosterone addition and is characterized by an accumulation of these Na+-transporting proteins (for review see Refs. 27, 36, and 37).

The transcription- and translation-dependent early activation of Na+ channels and Na+ pumps has been postulated to be mediated via aldosterone-induced proteins that could directly or indirectly act on epithelial Na+ channels and/or Na+ pumps (12, 36). To identify aldosterone-regulated mRNAs that are increased or repressed early enough to possibly account for the early physiological effect, we performed differential-display PCR with A6 epithelia and identified the first early adrenal-steroid-upregulated RNAs (ASURs) (30). Among them, ASUR5 encodes the Xenopus homolog of mammalian K-Ras2. We recently showed by coexpressing constitutively active XK-Ras2 with Xenopus epithelial Na+ channels in Xenopus oocytes that a Ras pathway(s) can modulate the activity of the epithelial Na+ channel. Indeed, constitutively active XK-Ras2A had a dual action, reducing the number of Na+ channels expressed at the cell surface but increasing their activity (19).

Here we report that, in parallel with the early upregulation of K-ras2 (and Xl-ras) mRNA, aldosterone (2.5 h) induces the synthesis of Ras protein (p21ras) in A6 epithelia and that it also significantly induces K-ras2 mRNA in vivo in X. laevis kidney. These data support the hypothesis that p21ras plays a role in the mediation of the early aldosterone action.

Because K-Ras2 is a protooncogene and steroids in many systems rapidly induce or repress the synthesis of nuclear protooncogenes (for review see Ref. 16), we further analyzed the mRNA levels of several (protooncogenic) transcription factors in response to aldosterone. Aldosterone stimulation of Na+ transport in A6 cells is mediated via a glucocorticoid receptor (GR) (6, 28), and there is evidence from other cellular systems that the signaling pathway of the GR interacts with activator protein-1 (AP-1) transcription factors (Jun and Fos dimers) (5, 22). Here we show that, in the A6 epithelium, GR, c-jun, and c-fos mRNAs are downregulated by aldosterone as well as the mRNA of the proliferation- and differentiation-controlling Myc protein, whereas fra-2 (Fos-related antigen 2) mRNA is upregulated. These findings demonstrate that short-term aldosterone treatment profoundly changes the genetic program of A6 epithelia, leading to a complex pleiotropic response. Interestingly, the downregulation of c-fos, c-jun, and c-myc mRNAs could not be blocked by actinomycin D or cycloheximide, which suggests a GR-mediated, transcription- and translation-independent mode of mRNA stability regulation.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and cell culture. For RNA isolation from X. laevis tissues, X. laevis females were kept for 2 days in 50 mM NaCl and injected intramuscularly with 300 or 1,000 nmol aldosterone/kg body wt (aldosterone condition) or with an equivalent amount of carrier (control condition). After injection, frogs were kept for 2.5 h either in 50 mM NaCl (control condition) or in tap water (aldosterone condition) and anesthetized for 15 min in 8 mM 3-aminobenzoic acid ethyl ester (MS-222; Sigma). Blood samples were taken by heart puncture, and plasma aldosterone was measured by RIA.

A6 cells from the A6-C1 subclone were cultured on permeable supports as previously described (4). RNA was prepared from epithelia cultured for 15-18 days, 10 days in bicarbonate-buffered medium supplemented with 10% FCS and then in serum-free HEPES-buffered medium. Aldosterone [or vehicle (0.01% ethanol)] was added at a final concentration of 10-6 M to both compartments as indicated on Figs. 1 and 4. Actinomycin D (5 mg/ml) and cycloheximide [20 µg/ml, a concentration that has previously been shown to block 97% of the protein synthesis in A6 epithelia (39)] were given 5 min before aldosterone. Control experiments showed that the aldosterone treatment increased Na+ transport by two- to fivefold within 3 h, as reported previously (4).

RNA isolation and Northern blot analysis. Tissues were cut into small pieces, directly frozen in liquid nitrogen, and pulverized with a pestle without melting. Total cellular RNA was isolated by the Chomczynski and Sacchi procedure (7). Poly(A) RNA was separated from cellular RNA by affinity chromatography on oligo(dT) cellulose according to standard procedures. For Northern blots, total RNA (5 µg) or poly(A) RNA (1.5 µg A6 and 0.75 µg tissue RNA) and RNA standards (Promega) were run on 1% agarose-formaldehyde gels, transferred to Genescreen membranes (Dupont NEN), and immobilized with 1.8 × 105 µJ ultraviolet light according to standard protocols. Probes labeled with [alpha -32P]dCTP to a specific activity of 1-2 × 109 cpm/µg DNA were generated by random priming. Hybridization and washes were performed according to standard protocols. Phosphor screens were exposed to membranes for 4 days and scanned with a PhosphorImager, and signals were quantified with Imagequant software (Molecular Dynamics). Mean fractional changes of signal intensity [relative to the actin control for "time course" and "inhibitor" blots or relative to cytochrome-c oxidase subunit I (COI) control for tissue blots] were determined for n blots made with RNA prepared from different experiments. Actin and COI gave parallel signal intensities for the aldosterone and control situations in A6 cells (30) and in intestine, lung, kidney, liver, and skin tissue (data not shown). Standard errors were calculated if n was >= 3. The time-dependent effect of aldosterone, as well as the influence of cycloheximide and actinomycin D, was tested on two blots with RNA derived from different experiments. The in vivo effect of aldosterone on X. laevis tissues was tested on four blots representing eight frogs. Statistical analysis was performed by using a one-way ANOVA test. P < 0.05 was considered significant.

Cloning of RT-PCR products. Reverse transcription was performed with the reverse transcription system of Promega. The reaction was carried out with 0.5 µg of denatured total RNA in a final volume of 10 µl. On the basis of the nucleotide sequences of database entries, primers xcfosfwd (CAGCTGCAAGTCTCTGTGGA), xcfosrev (AGTGGTCAGATTCTGGGTATG), xfra2fwd (TGTCGTCATGTCATCAACGC), xfra2rev (GGCGAGTTCAAGGAATCAGA), xMRfwd (CTTGAGCTGGAGATCTTATA), and xMRrev (ATGCAGCCTGGCATTTAAGTC) were used to amplify c-fos, fra-2, and mineralocorticoid receptor (MR) cDNA fragments, respectively. PCR was performed according to standard procedures. Samples of the PCR product were size-fractionated by agarose gel electrophoresis, extracted, cloned, and sequenced. Sequences of the cloned cDNA fragments were deposited in the European Molecular Biology Laboratories database under accession numbers AJ224511 (c-fos), Y15804 (fra-2), and Y15803 (MR).

Biosynthetic labeling and immunoprecipitation of Ras. Filter-grown A6 monolayers were depleted of methionine by two washes with methionine-free medium [0.8× DMEM (Sigma; D3916) supplemented with 50 mg/l L-cysteine and 4.77 g/l HEPES] followed by a 30-min incubation. The medium was aspirated, and filter supports were inverted. A volume of 200 ml of methionine-free medium including 1 mCi/ml [35S]methionine was placed on the basolateral surfaces of the filters and incubated for 15 min at 28°C. Cells were washed twice with 0.8× PBS including 0.1 mM CaCl2 and 1 mM MgCl2 and were directly scraped into ice-cold lysis buffer containing 50 mM Tris (pH 8.0), 120 mM NaCl, 0.5% Nonidet P-40 (NP-40), 0.2 mM phenylmethylsulfonyl fluoride, and 10 µl/ml protease inhibitor cocktail (Sigma; P8340). Cell extracts were vortexed for 20 s, aspirated 10 times through a 0.45 × 25 mm hypodermic needle, and spun for 5 min at 12,000 g and 4°C. The supernatant was frozen in liquid nitrogen and stored at -70°C. [35S]methionine incorporation was determined for an aliquot of the supernatant by TCA precipitation and liquid scintillation. Equal numbers of counts (1-4 × 107 cpm) were used for parallel immunoprecipitations with anti-Ras antibody Y13-259 (Oncogene Research Products). Y13-259 is a rat monoclonal antibody that reacts with the p21 translational products of H-, K-, and N-ras human oncogenes (10). One microgram of the antibody was added to 250 µl of lysis buffer (without protease inhibitors) including 30 µl of 30% (vol/vol) BSA-blocked protein G Plus/protein A-agarose (Calbiochem) and rotated for 2 h at room temperature. Agarose beads were spun down, and the supernatant was discarded. Beads with bound antibody were resuspended in protein supernatant that had been precleared twice with protein G Plus/protein A-agarose. After 3 h of rotation at 4°C the beads were washed six times with 20 mM Tris (pH 8.0), 100 mM NaCl, 1 mM EDTA, 0.5% NP-40, and 0.5 M LiCl and six times with 20 mM Tris (pH 8.0), 100 mM NaCl, 1 mM EDTA, and 0.5% NP-40. The resulting immunoprecipitates were boiled for 5 min in sample buffer, and SDS-PAGE analysis was performed according to standard procedures.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Xenopus K-ras2 was cloned by differential-display PCR and was shown to be rapidly induced by aldosterone in A6 epithelia (170% after 1 h and 420% after 2 h; see Fig. 4B and Table 1; Ref. 30). This induction was independent of protein synthesis (not inhibited by cycloheximide) but was blocked by the transcription inhibitor actinomycin D (Fig. 1A). To test the impact of the mRNA increase on p21ras protein synthesis, A6 kidney epithelia were pulse-labeled and p21ras was immunoprecipitated with rat monoclonal anti-Ras antibody Y13-259, which reacts with H-, K-, and N-Ras oncoproteins (10). An analysis of the immunoprecipitated product was performed by SDS-PAGE. The p21ras was detected in the lanes representing control cells and A6 cells treated with aldosterone for 2.5 h (Fig. 1B). The Ras-specific signal (normalized to the individual lane-specific background) was 5.8-fold higher for the aldosterone-treated condition (mean of 4 independent experiments; Fig. 1C). A parallel immunoprecipitation experiment, performed with one-third of the labeled material used for the aldosterone-treated condition, demonstrated the quantitative character of this technique (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Mean fractional change in protooncogene and GR mRNA levels (relative to actin) after a 2-h aldosterone (10-6 M) treatment of A6 epithelia




View larger version (58K):
[in this window]
[in a new window]
 
Fig. 1.   Regulation of K-ras2 mRNA and p21ras by aldosterone in A6 epithelia. A: Northern blot analysis of K-ras2 mRNA expression on total RNA of control and aldosterone-treated (aldo 2h) A6 epithelia, each in presence of cycloheximide (chx), actinomycin D (actD), or carrier. B: immunoprecipitates of p21ras from pulse-labeled A6 epithelia were separated on 15% SDS gel. Molecular mass markers (kDa) and aldosterone treatment (10-6 M, 2.5 h) are indicated. C: mean fractional changes ± SE in K-ras2 mRNA [n = 8; shown for comparison (30)] and in p21ras protein synthesis (n = 4) induced by aldosterone.

To determine the effects of aldosterone in the intestine, kidney, liver, lung, and skin on K-ras2 mRNA expression, we prepared RNA from X. laevis females that had been injected with aldosterone (300-1,000 nmol/kg body weight) or vehicle 2.5 h before RNA extraction. This treatment produced an ~10-fold increase in the plasma aldosterone level (Fig. 2).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2.   Mean fractional changes + SE of plasma aldosterone concentrations for 4 Xenopus laevis female pairs, which were compared on a Northern blot. Pairs represent control and aldosterone-treated (aldo; 2.5 h, 300 or 1,000 nmol aldosterone/kg body wt) conditions. Mean plasma aldosterone concentration ± SE in control animals was 9.4 ± 4.4 nM; n = 4.

K-ras2 mRNA was detected by Northern blotting in all tested tissues. The results show that 2.5 h after hormone addition the expression level was not modulated in the intestine, lung, skin, and liver, whereas a statistically significant 2.5-fold increase in kidney K-ras mRNA could be observed (Fig. 3). After having demonstrated the relevance of this tissue-specific hormone effect on K-ras2 expression in the whole animal, we similarly examined alpha 1 and beta 1 Na+-K+-ATPase mRNA expression by using the corresponding cDNAs (38) as probes. Aldosterone treatment for 2.5 h did not modulate alpha 1 mRNA expression in lung tissue, whereas expression in the skin and intestine was found to be slightly decreased. The expression of the beta 1 mRNA was not affected in the intestine, lung, and skin. For both the alpha 1 and beta 1 subunit mRNAs, a tendency toward upregulation in kidney tissue was detectable; this upregulation was, however, not significant (unpublished results). This is in accordance with the induction levels of Na+-K+-ATPase mRNAs observed at similar time points in A6 epithelia (27, 30, 36, 39).


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3.   In vivo effect of aldosterone on K-ras2 mRNA in X. laevis intestine, kidney, lung, skin, and liver. A: mean fractional changes + SE of K-ras2 in X. laevis tissues for aldosterone-treated (aldo) vs. control condition. Normalized K-ras2 signal intensities [K-ras2/ cytochrome-c oxidase subunit I (COX I)] were used to determine fractional changes on Northern blots of tissue RNA from pairs of X. laevis (n = 4). * P < 0.05. B: Northern blot analysis of K-ras2 expression for control (-) and aldosterone-treated (+; 2.5 h, 300 or 1,000 nmol aldosterone/kg body wt) situation.

Because the protooncogene K-ras2 is an early adrenal steroid-upregulated RNA (30) and because in many systems steroids rapidly induce or repress the synthesis of transcription factors such as nuclear protooncogenes (for review see Ref. 16) and nuclear receptors (for review see Ref. 29), the mRNAs Xl-ras, c-jun, c-fos, fra-2, and c-myc, as well as those of the steroid receptors MR and GR, were tested for their potential aldosterone response in A6 kidney epithelia. The effect of aldosterone in the presence and absence of transcription and translation inhibitors on the corresponding mRNAs was tested on Northern blots made with RNA prepared from filter-cultured A6 cells by using X. laevis-specific probes (Fig. 4).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of aldosterone (10-6 M) on mRNAs of K-ras2, Xl-ras, fra-2, c-jun, c-myc, c-fos, glucocorticoid receptor (GR), and actin in A6 kidney epithelia analyzed by Northern blotting. Data for K-ras2 were published in Ref. 30 and are shown for comparison. A: representative autoradiographic signals obtained by Northern blotting. Corresponding probe and molecular size markers (in kb) are indicated. B: mean fractional changes in signal intensity relative to the actin control from 2-4 independent RNA extractions (error bars, SE for n >=  3 or minimum and maximum values for n = 2; actin values are not normalized). Times of aldosterone (aldo) treatment and presence of cycloheximide (chx) or actinomycin D (actD) are indicated; n.d., not determined. Mean values of the fractional change after 2 h of aldosterone, pooled from time course and inhibitor experiments, are summarized in Table 1.

As shown above, K-ras2 mRNA was induced by aldosterone at a direct transcriptional level (Figs. 1A and 4B). Another ras mRNA, Xl-ras (1), whose coding region is 73.5% identical to that of the human K-ras2 gene and 78% identical to that of the Xenopus K-ras2B gene, was also tested. To generate an Xl-ras-specific probe, a cDNA fragment of the 5' untranslated region that does not show any similarity to the corresponding parts of human and Xenopus K-ras2 was used. On Northern blots, Xl-ras mRNA appeared as a single band of 1.3 kb (in contrast to K-ras2 with 2.6 kb; Fig. 4A) and was also upregulated after 1 h of aldosterone treatment. The increase was 90% and remained at this level for up to 16 h (Fig. 4B).

To examine the effect of aldosterone on the mRNA expression of (protooncogenic) transcription factors, we obtained c-myc (33) and c-jun (18) probes and generated RT-PCR-cloned c-fos (accession no. AJ224511) and fra-2 (accession no. Y15804) cDNA fragments. Aldosterone had similar early effects on the expression of c-myc, c-jun, and c-fos. These three oncogenic mRNAs were rapidly and significantly downregulated (23-43% within 2 h; see Table 1). When the transcription inhibitor actinomycin D was present, the aldosterone-induced downregulation of these three mRNAs was fully maintained or even more pronounced. The translation inhibitor cycloheximide augmented the mRNA of these three protooncogenes. In this case also, aldosterone induced a similar downregulation, which represented, however, a small fractional change. The aldosterone-induced downregulation of c-myc and c-jun was only transient, whereas that of c-fos continued beyond 4 h of treatment (~50% after 16 h of aldosterone). In contrast, the mRNA encoding Fos-related antigen 2 (fra-2) was rapidly upregulated, by 25 and 130% after 1 and 2 h of aldosterone, respectively. This transient increase (back to the control level after 4-16 h) appeared, in contrast to the downregulation of the protooncogenic mRNAs, to be mediated by a direct transcriptional effect, because it was prevented by actinomycin D and not by cycloheximide.

For the detection of GR mRNA, a Xenopus GR cDNA (11) served as the probe. Several transcripts were revealed, with a major one of ~5 kb (Fig. 4A). By 1 h after hormone addition, the GR mRNAs had already decreased by 25%, and they were further downregulated to ~40% of the control level after 16 h (Fig. 4B). When the RT-PCR-cloned MR cDNA fragment (accession no. Y15803) was used as the probe, no signal was obtained, probably because of the small amounts of MR mRNA. Cytoskeletal actin type 8 (20) was not modified during the 16-h aldosterone treatment and was therefore used for the normalization of this Northern blot analysis.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The early aldosterone-induced activation of Na+ channels and Na+ pumps in A6 cells, which precedes the late "anabolic" action characterized by the accumulation of new transport proteins, is dependent on ongoing transcription and translation. Hence it has been postulated that this early action would be mediated by early aldosterone-induced proteins, which directly or indirectly act at the level of epithelial Na+ channels and Na+ pumps (12, 35). As yet, this regulatory pathway leading from transcriptional regulation to channel and pump activation has not been elucidated.

Early K-ras mRNA induction by aldosterone in vivo and increase in Ras protein synthesis in A6 epithelia. Using differential-display PCR, we have previously identified several early ASURs in A6 kidney cell epithelia, and ASUR5 was shown to encode the Xenopus homolog of K-Ras2. Here we show that this induction of K-Ras is not a cell culture artifact of A6 epithelia but that it may play a role in vivo in the response of target epithelia to aldosterone. Indeed the analysis of K-ras2 mRNA expression in tissues of control and aldosterone-treated frogs (2.5 h) showed that it is also rapidly induced in the kidney, but not in the intestine, skin, lung, and liver (Fig. 3). The fact that the level of induction (2.5-fold) was lower in Xenopus kidney than in A6 epithelia could be due to a tubular segment-specific action of the hormone. Thus a larger increase of K-ras mRNA in aldosterone target epithelia could have been masked by unmodified expression in other nephron segments and/or cell types.

In addition, we show in A6 epithelia that the aldosterone-induced increase in K-ras2 mRNA (4.2-fold) correlates with an increase in Ras protein (p21ras) synthesis (5.8-fold). The mRNA of another Ras expressed in A6 cells, Xl-ras mRNA (1), was also upregulated after 1 h of aldosterone treatment, but only by approximately twofold (Fig. 4B). Because this second ras mRNA is expressed only at low levels, it appears that the increase in p21ras synthesis can be accounted for by the increase in the corresponding mRNAs and that thus no translational regulation of K-Ras by aldosterone has to be postulated.

We have, in a previous study (19), addressed the question of whether an increase in K-Ras2 activity could act on the function of epithelial Na+ channels by performing coexpression experiments with Xenopus oocytes. XK-Ras2 rendered constitutively active by the G12V mutation was shown to induce oocyte maturation and thus to promote endocytosis of surface transporters, including endogenous Na+ pumps and exogenous Na+ channels. More importantly, and in accordance with the hypothesis that K-Ras2 has a stimulatory action on Na+ transport, the activity of the surface-expressed channels was increased fourfold relative to that of the channels expressed at the surface of control oocytes. However, it remains to be investigated whether K-Ras2 exerts a similar effect on the function of Na+ channels expressed in aldosterone target cells. It has also to be mentioned that an increase in K-Ras expression, such as the one induced by aldosterone in A6 epithelia, is expected to activate downstream effectors, and possibly Na+ channels, only if it is itself activated by upstream regulators. This suggests that other regulators must also play an important role in the mediation of Na+ transport stimulation by aldosterone. In any case, Ras induction by aldosterone in A6 epithelia takes place in the context of a physiological action (i.e., Na+ transport) that is a function of highly differentiated mineralocorticoid target epithelial cells. This stands in contrast to its proliferation-promoting action in other cells.

In conclusion, together with the functional results obtained with Xenopus oocytes, the fact that the regulation of Ras was verified at the protein level in A6 epithelia and was shown to take place in vivo also supports the hypothesis that K-Ras induction could play a role in the control of transepithelial Na+ transport by aldosterone.

Early differential regulation of transcription factor mRNAs by aldosterone. In view of the apparently "differentiation-promoting" action of the protooncogene product K-Ras in the context of the aldosterone response, we asked whether nuclear protooncogenes and other transcription factors might be regulated by the primary (transcriptional) action of aldosterone as well. In such a case, the regulated transcription factor could contribute to the complex action of aldosterone by inducing a secondary transcriptional response. Interestingly, the mRNAs of the three protooncogene products c-Myc, c-Jun, and c-Fos were found to be downregulated by aldosterone in A6 epithelia, an effect of aldosterone that can be seen in the context of its differentiating anabolic action (Fig. 4). Indeed, Myc expression is known to inhibit terminal differentiation and to potentiate cell cycle progression (15). Corticosteroids have previously been shown to decrease Myc expression in other cell types such as lymphocytes, an effect similar to the downregulatory effect of aldosterone on Myc in A6 epithelia. The two other downregulated protooncogene products, Jun and Fos, also play essential roles in the control of cellular growth and differentiation as elements of the dimeric transcription factor AP-1 (Jun dimers or Jun/Fos heterodimers), which controls the basal and/or inducible transcription of numerous genes. For both Jun and Fos, glucocorticoids are known to have cell-specific effects, either increasing or decreasing their expression (2, 16, 31). In contrast to Jun and Fos, Fra-2 (9, 21) was upregulated by aldosterone. Again, this effect can be understood as promoting the differentiation of the target epithelium because Fra-2, which, similar to Fos, can associate with Jun to form an AP-1 complex, has been shown to mediate suppression rather than transactivation (as would Fos), for instance, on the collagenase gene (32).

Because various members of the ligand-activated receptor superfamily are known to be autoregulated, we addressed the question of whether the levels of MR and GR mRNAs are affected by an aldosterone treatment as well. For MR, we did not obtain a signal on Northern blots, because of the small amounts of mRNA. In this respect, it has to be mentioned that A6 cells have been shown to express relatively low levels of typical MRs (8), which do not appear to mediate a significant transcriptional action (6). This is consistent with the fact that aldosterone stimulation of Na+ transport in A6 is mediated by the GR (28). To what extent the response of tight epithelia to corticosteroids is affected by the nature and ratio of activated corticosteroid receptors (MR and/or GR) is not yet clear (17).

The multiple transcripts encoding GR (11) were coordinately downregulated by aldosterone in A6 epithelia, an effect measurable already after 1 h, and the level of transcripts reached ~40% of the control value after 16 h of aldosterone treatment (Fig. 4B). Agonist-induced downregulation of GR mRNA levels is a known pattern, although examples of upregulation have also been reported (for review see Ref. 29). In A6 cells, Hagley and Watlington (14) have examined the effect of androgen, estrogen, and mineralo- and glucocorticoids on the binding capacity of the MR. Interestingly, they observed a downregulation of MR that was specific for a GR agonist. Together with our data, this suggests that both corticosteroid receptors are downregulated via activation of the GR.

In the present study, we demonstrate that in A6 epithelia aldosterone regulates GR and c-jun mRNA expression levels similarly. Coupled GR and Jun expression has been reported by several other groups (3). Furthermore, intricate interactions of GR and AP-1 signaling pathways at the level of complex regulatory cis-acting elements of promoters, as well as interactions due to protein-protein binding ("transcriptional cross talk"), have been reported (13, 22, 40).

Here, we report a possible third mode for the interaction of these pathways. Our results suggest that the adrenal-steroid-mediated decrease in c-fos and c-jun (and c-myc) mRNA levels in A6 cells takes place via a transcription- and translation-independent mechanism, possibly a destabilization of the corresponding transcripts. The possibility that mRNA stability plays an important role is supported by the fact that the inhibition of translation by cycloheximide drastically increases the level of c-myc, c-jun, and c-fos mRNAs (Fig. 4B), probably by preventing the synthesis of a short-lived RNase (25), as previously suggested for other cellular systems (24). Surprisingly, c-fos, c-jun, and c-myc mRNA levels were decreased by aldosterone even in the presence of either a translation or transcription blocker (Fig. 4B). This observation can solely be explained by a transcription- and translation-independent effect of aldosterone on mRNA stability (for review see Ref. 26). In this respect, it has to be emphasized that these three protooncogenic mRNAs contain AU-rich elements (AUREs) that are known to mediate mRNA destabilization. Peppel et al. (23) made the interesting finding that in the presence of glucocorticoids, AURE-containing mRNAs decline whereas AURE-free mRNAs are unchanged, suggesting that glucocorticoids activate an AURE-specific RNase. It would be interesting to test whether such a regulated AURE-specific RNase activity is indeed stimulated in A6 cells by the presence of aldosterone, independent of transcription and translation.

Our results do not allow us to conclude on a mechanism by which aldosterone, independent of its action as a transcription regulator by activating MR and GR and possibly by activating and/or stabilizing an AURE-specific RNase (see above), acts on mRNA stability. Such a transcription-independent effect could be mediated by ligand-activated classical receptors (MR or GR), which would interact directly or indirectly with such an AURE-specific RNase. Alternatively, the heat shock protein complex, which is released from the nuclear receptor during its ligand-induced activation, could mediate this action, as previously shown for the activation of calcineurin in the cortical collecting duct (34). Yet another possibility is that the effect on mRNA stability is mediated via a pathway independent of MR and GR. Such MR- and GR-independent effects could be mediated by a hypothetical membrane receptor or directly by the steroid hormone.

In conclusion, aldosterone induces K-ras mRNA in vivo, and this induction translates in A6 epithelia into an increase in Ras protein synthesis. Together with functional results obtained with Xenopus oocytes (16), these observations support the hypothesis that K-Ras, in contrast to its proliferation-stimulating action in other contexts, plays a role in the activation of Na+ transport, a function of differentiated aldosterone target cells. The downregulation of the mRNAs of transcription factors known to stimulate proliferation as well as the upregulation of the mRNA of Fra-2, a factor that has been shown to antagonize this action, underlines the fact that aldosterone also modulates the genetic program toward differentiation in target cells. This can be understood as part of the late aldosterone action, which leads in target cells to a state of larger Na+ transport capacity. It could also be that the secondary action of aldosterone via the regulation of other transcription factors affects the function of the Na+ transport machinery in the course of the early and late responses. The fact that the downregulation of protooncogene mRNAs by aldosterone is not inhibited by actinomycin D supports the hypothesis that transcription-independent actions of corticosteroids are an integral part of their pleiotropic action in epithelial target cells.


    ACKNOWLEDGEMENTS

We thank B. Küffer and Prof. W. Vetter (University Hospital Zürich) for the plasma aldosterone determination, J. M. Lemaitre for Xenopus c-myc and Xl-ras cDNAs, O. H. J. Destrée for Xenopus GR cDNA, P. Lazarus for Xenopus c-jun cDNA, T. Mohun for Xenopus actin type 8 cDNA, and D. Bogenhagen for Xenopus mitochondrial DNA.


    FOOTNOTES

This work was supported by Swiss National Science Foundation Grant 31-49727.96 and the Olga Mayenfisch Stiftung, Zürich, Switzerland.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: F. Verrey, Inst. of Physiology, Univ. of Zürich, Winterthurerstrasse 190, CH-8057 Zürich, Switzerland (E-mail: verrey{at}physiol.unizh.ch).

Received 7 December 1998; accepted in final form 11 February 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Andeol, Y., M. Gusse, and M. Mechali. Characterization and expression of a Xenopus ras during oogenesis and development. Dev. Biol. 139: 24-34, 1990[Medline].

2.   Autelitano, D. J. Glucocorticoid regulation of c-fos, c-jun and transcription factor AP-1 in the AtT-20 corticotrope cell. J. Neuroendocrinol. 6: 627-637, 1994[Medline].

3.   Barrett, T. J., E. Vig, and W. V. Vedeckis. Coordinate regulation of glucocorticoid receptor and c-jun gene expression is cell type-specific and exhibits differential hormonal sensitivity for down- and up-regulation. Biochemistry 35: 9746-9753, 1996[Medline].

4.   Beron, J., and F. Verrey. Aldosterone induces early activation and late accumulation of Na-K-ATPase at surface of A6 cells. Am. J. Physiol. 266 (Cell Physiol. 35): C1278-C1290, 1994[Abstract/Free Full Text].

5.   Cato, A. C., and E. Wade. Molecular mechanisms of anti-inflammatory action of glucocorticoids. Bioessays 18: 371-378, 1996[Medline].

6.   Chen, S. Y., J. Wang, W. H. Liu, and D. Pearce. Aldosterone responsiveness of A6 cells is restored by cloned rat mineralocorticoid receptor. Am. J. Physiol. 274 (Cell Physiol. 43): C39-C46, 1998[Abstract/Free Full Text].

7.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

8.   Claire, M., B. Machard, M. Lombes, M. E. Oblin, J. P. Bonvalet, and N. Farman. Aldosterone receptors in A6 cells: physicochemical characterization and autoradiographic study. Am. J. Physiol. 257 (Cell Physiol. 26): C665-C677, 1989[Abstract/Free Full Text].

9.   Foletta, V. C. Transcription factor AP-1, and the role of Fra-2. Immunol. Cell Biol. 74: 121-133, 1996[Medline].

10.   Furth, M. E., T. H. Aldrich, and C. Cordon-Cardo. Expression of ras proto-oncogene proteins in normal human tissues. Oncogene 1: 47-58, 1987[Medline].

11.   Gao, X., E. Kalkhoven, J. Peterson-Maduro, B. van der Burg, and O. H. Destree. Expression of the glucocorticoid receptor gene is regulated during early embryogenesis of Xenopus laevis. Biochim. Biophys. Acta 1218: 194-198, 1994[Medline].

12.   Garty, H. Molecular properties of epithelial, amiloride-blockable Na+ channels. FASEB J. 8: 522-528, 1994[Abstract].

13.   Gottlicher, M., S. Heck, and P. Herrlich. Transcriptional cross-talk, the second mode of steroid hormone receptor action. J. Mol. Med. 76: 480-489, 1998[Medline].

14.   Hagley, R. D., and C. O. Watlington. Down-regulation of the mineralocorticoid receptor by dexamethasone in an amphibian kidney cell line (A6). Endocr. Res. 22: 221-235, 1996[Medline].

15.   Henriksson, M., and B. Luscher. Proteins of the Myc network: essential regulators of cell growth and differentiation. Adv. Cancer Res. 68: 109-182, 1996[Medline].

16.   Hyder, S. M., G. M. Stancel, and D. S. Loose-Mitchell. Steroid hormone-induced expression of oncogene-encoded nuclear proteins. Crit. Rev. Eukaryot. Gene Expr. 4: 55-116, 1994[Medline].

17.   Laplace, J. R., R. F. Husted, and J. B. Stokes. Cellular responses to steroids in the enhancement of Na+ transport by rat collecting duct cells in culture. Differences between glucocorticoid and mineralocorticoid hormones. J. Clin. Invest. 90: 1370-1378, 1992.

18.   Lazarus, P., and A. Calcagnotto. Identification and partial characterization of the c-jun oncogene in Xenopus laevis. Cancer Lett. 86: 201-208, 1994[Medline].

19.   Mastroberardino, L., B. Spindler, I. Forster, L. Loffing, R. Assandri, A. May, and F. Verrey. Ras pathway activates epithelial Na+ channel and decreases its surface expression in Xenopus oocytes. Mol. Biol. Cell 9: 3417-3427, 1998[Abstract/Free Full Text].

20.   Mohun, T. J., S. Brennan, N. Dathan, S. Fairman, and J. B. Gurdon. Cell type-specific activation of actin genes in the early amphibian embryo. Nature 311: 716-721, 1984[Medline].

21.   Nishina, H., H. Sato, T. Suzuki, M. Sato, and H. Iba. Isolation and characterization of fra-2, an additional member of the fos gene family. Proc. Natl. Acad. Sci. USA 87: 3619-3623, 1990[Abstract/Free Full Text].

22.   Pearce, D., and K. R. Yamamoto. Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element. Science 259: 1161-1165, 1993[Abstract/Free Full Text].

23.   Peppel, K., J. M. Vinci, and C. Baglioni. The AU-rich sequences in the 3' untranslated region mediate the increased turnover of interferon mRNA induced by glucocorticoids. J. Exp. Med. 173: 349-355, 1991[Abstract/Free Full Text].

24.   Rosenwald, I. B., N. A. Setkov, V. N. Kazakov, J. J. Chen, A. G. Ryazanov, I. M. London, and O. I. Epifanova. Transient inhibition of protein synthesis induces expression of proto-oncogenes and stimulates resting cells to enter the cell cycle. Cell Prolif. 28: 631-644, 1995[Medline].

25.   Ross, J. A hypothesis to explain why translation inhibitors stabilize mRNAs in mammalian cells: mRNA stability and mitosis. Bioessays 19: 527-529, 1997[Medline].

26.   Ross, J. mRNA stability in mammalian cells. Microbiol. Rev. 59: 423-450, 1995[Abstract/Free Full Text].

27.   Rossier, B. C., and L. G. Palmer. Mechanisms of aldosterone action on sodium and potassium transport. In: The Kidney: Physiology and Pathophysiology (2nd ed.), edited by D. W. Seldin, and G. Giebisch. New York: Raven, 1992, p. 1373-1409.

28.   Schmidt, T. J., R. F. Husted, and J. B. Stokes. Steroid hormone stimulation of Na+ transport in A6 cells is mediated via glucocorticoid receptors. Am. J. Physiol. 264 (Cell Physiol. 33): C875-C884, 1993[Abstract/Free Full Text].

29.   Schmidt, T. J., and A. S. Meyer. Autoregulation of corticosteroid receptors. How, when, where, and why? Receptors Channels 4: 229-257, 1994.

30.   Spindler, B., L. Mastroberardino, M. Custer, and F. Verrey. Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflügers Arch. 434: 323-331, 1997[Medline].

31.   Subramaniam, M., D. Colvard, P. E. Keeting, K. Rasmussen, B. L. Riggs, and T. C. Spelsberg. Glucocorticoid regulation of alkaline phosphatase, osteocalcin, and proto-oncogenes in normal human osteoblast-like cells. J. Cell. Biochem. 50: 411-424, 1992[Medline].

32.   Suzuki, T., H. Okuno, T. Yoshida, T. Endo, H. Nishina, and H. Iba. Difference in transcriptional regulatory function between c-Fos and Fra-2. Nucleic Acids Res. 19: 5537-5542, 1991[Abstract/Free Full Text].

33.   Taylor, M. V., M. Gusse, G. I. Evan, N. Dathan, and M. Mechali. Xenopus myc proto-oncogene during development: expression as a stable maternal mRNA uncoupled from cell division. EMBO J. 5: 3563-3570, 1986[Medline].

34.   Tumlin, J. A., J. P. Lea, C. E. Swanson, C. L. Smith, S. S. Edge, and J. S. Someren. Aldosterone and dexamethasone stimulate calcineurin activity through a transcription-independent mechanism involving steroid receptor-associated heat shock proteins. J. Clin. Invest. 99: 1217-1223, 1997[Medline].

35.   Verrey, F. Early aldosterone effects. Exp. Nephrol. 6: 294-301, 1998[Medline].

36.   Verrey, F. Transcriptional control of sodium transport in tight epithelia by adrenal steroids. J. Membr. Biol. 144: 93-110, 1995[Medline].

37.   Verrey, F., and J. Beron. Activation and supply of channels and pumps by aldosterone. News Physiol. Sci. 11: 126-133, 1996.[Abstract/Free Full Text]

38.   Verrey, F., P. Kairouz, E. Schaerer, P. Fuentes, K. Geering, B. C. Rossier, and J. P. Kraehenbuhl. Primary sequence of Xenopus laevis Na-K-ATPase and its localization in A6 kidney cells. Am. J. Physiol. 256 (Renal Fluid Electrolyte Physiol. 25): F1034-F1043, 1989[Abstract/Free Full Text].

39.   Verrey, F., J. P. Kraehenbuhl, and B. C. Rossier. Aldosterone induces a rapid increase in the rate of Na,K-ATPase gene transcription in cultured kidney cells. Mol. Endocrinol. 3: 1369-1376, 1989[Abstract/Free Full Text].

40.   Vig, E., T. J. Barrett, and W. V. Vedeckis. Coordinate regulation of glucocorticoid receptor and c-jun mRNA levels: evidence for cross-talk between two signaling pathways at the transcriptional level. Mol. Endocrinol. 8: 1336-1346, 1994[Abstract/Free Full Text].


Am J Physiol Cell Physiol 276(5):C1154-C1161
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
O. Pochynyuk, J. D. Stockand, and A. Staruschenko
Ion Channel Regulation by Ras, Rho, and Rab Small GTPases
Experimental Biology and Medicine, November 1, 2007; 232(10): 1258 - 1265.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. W. Good
Nongenomic Actions of Aldosterone on the Renal Tubule
Hypertension, April 1, 2007; 49(4): 728 - 739.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. Pochynyuk, Q. Tong, A. Staruschenko, H.-P. Ma, and J. D. Stockand
Regulation of the epithelial Na+ channel (ENaC) by phosphatidylinositides
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F949 - F957.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. N. Helms, X.-J. Chen, S. Ramosevac, D. C. Eaton, and L. Jain
Dopamine regulation of amiloride-sensitive sodium channels in lung cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L710 - L722.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Zhang, X. Xia, D. I. Jalal, T. Kuncewicz, W. Xu, G. D. Lesage, and B. C. Kone
Aldosterone-sensitive repression of ENaC{alpha} transcription by a histone H3 lysine-79 methyltransferase
Am J Physiol Cell Physiol, March 1, 2006; 290(3): C936 - C946.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
Q. Tong, R. E. Booth, R. T. Worrell, and J. D. Stockand
Regulation of Na+ transport by aldosterone: signaling convergence and cross talk between the PI3-K and MAPK1/2 cascades
Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1232 - F1238.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. D. Stockand and J. G. Meszaros
Aldosterone stimulates proliferation of cardiac fibroblasts by activating Ki-RasA and MAPK1/2 signaling
Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H176 - H184.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. Hendron and J. D. Stockand
Activation of Mitogen-activated Protein Kinase (Mitogen-activated Protein Kinase/Extracellular Signal-regulated Kinase) Cascade by Aldosterone
Mol. Biol. Cell, September 1, 2002; 13(9): 3042 - 3054.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. D. Stockand
New ideas about aldosterone signaling in epithelia
Am J Physiol Renal Physiol, April 1, 2002; 282(4): F559 - F576.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Le Menuet, R. Isnard, M. Bichara, S. Viengchareun, M. Muffat-Joly, F. Walker, M.-C. Zennaro, and M. Lombes
Alteration of Cardiac and Renal Functions in Transgenic Mice Overexpressing Human Mineralocorticoid Receptor
J. Biol. Chem., October 12, 2001; 276(42): 38911 - 38920.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. Verrey
Early aldosterone action: toward filling the gap between transcription and transport
Am J Physiol Renal Physiol, September 1, 1999; 277(3): F319 - F327.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spindler, B.
Right arrow Articles by Verrey, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spindler, B.
Right arrow Articles by Verrey, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online