Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 276: C900-C906, 1999;
0363-6143/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schneider, A. G.
Right arrow Articles by Pette, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schneider, A. G.
Right arrow Articles by Pette, D.
Vol. 276, Issue 4, C900-C906, April 1999

Muscle LIM protein: expressed in slow muscle and induced in fast muscle by enhanced contractile activity

Achim G. Schneider, Karim R. Sultan, and Dirk Pette

Faculty of Biology, University of Konstanz, D-78457 Constance, Germany


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

To identify early changes in gene expression during the fast-to-slow transition induced by chronic low-frequency stimulation, total RNA was extracted from 12-h-stimulated tibialis anterior (TA) muscles of rats and amplified by differential display RT-PCR. Among the signals of differentially expressed mRNAs, a cDNA ~300 bp in length, which was almost undetectable in control TA muscles but prominent in stimulated TA and normal soleus muscles, was identified. This cDNA was cloned and identified as corresponding to the mRNA of the muscle LIM protein (MLP). Its differential expression in control, stimulated TA, and soleus muscles was verified by Northern blotting. Antibodies against MLP were used to identify by immunoblot analysis a protein of 22 kDa, the predicted molecular mass of MLP. Immunohistochemistry revealed strong reactivity for MLP in all fibers of normal soleus muscle and faint staining of some type IIA and type I fibers in control TA muscle. These fibers increased in number and staining intensity in 4-day-stimulated TA muscle. MLP thus seems to play an essential role during the rearrangement of cytoskeletal and/or myofibrillar structures in transforming adult muscle fibers.

fast-to-slow transition; fiber type; immunohistochemistry; low-frequency stimulation; messenger ribonucleic acid


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

INCREASED NEUROMUSCULAR activity induced by chronic low-frequency stimulation (CLFS) elicits in mammalian skeletal muscles fast-to-slow fiber type conversions (20, 21). The stimulation-induced transitions in myofibrillar protein isoform expression, e.g., myosin light and heavy chains and troponin subunits, follow an ordered sequence. The underlying changes in gene expression manifest themselves in alterations in the levels of the corresponding mRNAs followed by alterations in the synthesis of specific proteins. Specifically, CLFS leads to fiber type transitions from type IIB to type IID(X) to type IIA to type I (20, 21). These transitions correspond to changes in myosin heavy chain (MHC) isoform expression such that MHCIIb is exchanged with MHCIId(x); subsequently the latter is exchanged with MHCIIa, and ultimately MHCIIa is exchanged with the slow MHCI isoform (15). Similar fast-to-slow transitions occur in proteins involved in Ca2+ release and Ca2+ sequestration (10, 12, 13), as well as in the enzyme apparatus of energy metabolism (21).

The early signals initiating the reprogramming of terminally differentiated muscle fibers during stimulation-induced fast-to-slow transitions have as yet not been elucidated. Transitory increases in mRNAs specific to c-fos, c-jun, and egr-1, which peaked by 4-8 h, and peak protein levels by 12 h were observed in two independent studies of low-frequency-stimulated rabbit muscle. After 7 days there was a secondary and sustained rise of these proteins, which persisted even after 21 days. As revealed by immunohistochemistry, the upregulation of the respective proteins was not restricted to muscle fibers but was also seen in endothelial cells (17). In addition, low-frequency-stimulated tibialis anterior (TA) muscles of rabbits exhibited enhanced expression of the HSP70 heat shock protein a few hours after the onset of stimulation (19). HSP70 mRNA peaked by 24 h (50-fold) but subsequently decayed and rose again after 2 wk of stimulation. The level of the corresponding protein was found to be elevated 10- to 12-fold after 14 days of CLFS (19). Another heat shock protein upregulated soon after stimulation onset with a time course resembling that of HSP70 is alpha B-crystallin (18). The expression of both, initially predominant in type I fibers and then spreading to transforming type II fibers, was accompanied by elevated mRNA levels for the four myogenic factors MyoD, myogenin, myf-5, and MRF4.

The possibility that the upregulation of early response genes and heat shock proteins reflects reactions to stress rather than representing signals causally related to the stimulation-induced transformation process cannot be excluded. The aim of the present study was to identify factors of putative regulatory function during the early phase of the fast-to-slow transformation process. We applied the method of differential display (16) to detect early changes in the expression of such factors. For this purpose, total RNA from the fast-twitch TA muscles of rats exposed to CLFS for 12 h was compared with RNA from the unstimulated contralateral (control) TA muscles and normal slow-twitch soleus (SOL) muscles. By this approach we were able to identify that the mRNA specific to muscle LIM protein (MLP) was highly upregulated in 12-h-stimulated TA muscle. MLP belongs to the cysteine-rich protein (CRP) family of LIM proteins (27). It contains two LIM domains but no other functional domain (2). This protein has previously been reported to be an essential regulator of myogenic differentiation (2).


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and CLFS. Adult male Wistar rats (body wt 400-470 g) were stimulated (10 Hz, 0.2-ms impulse width, 24 h/day) via electrodes implanted laterally to the peroneal nerve of the left hindlimb for different time periods. After the animals were killed, contralateral unstimulated (control) and stimulated TA muscles, contralateral SOL muscles, and cardiac muscles were removed, immersed in liquid N2, and pulverized with a liquid N2-cooled steel mortar.

RNA extraction and differential display. Total RNA was extracted by a modification of the method described by Chomczynski and Sacchi (6). RNA (0.2 µg) from stimulated and control TA muscles and from SOL muscle was amplified by differential display RT-PCR as described by Liang et al. (16), except that the DNase digestion step before reverse transcription was omitted and 2 µCi of [alpha -33P]dATP (Amersham) were incorporated during amplification (4). Primers were obtained from Differential Display Systems (Paris, France), SuperScript RNase H- Reverse Transkriptase was obtained from GIBCO-BRL (Eggenstein, Germany), and Taq polymerase was obtained from Pharmacia (Uppsala, Sweden). Amplified products were separated on a 6% DNA-sequencing gel and identified by autoradiography. Differential bands were excised and reamplified by a modified protocol such that 2-deoxynucleoside 5'-triphosphate concentration was elevated by 10-fold and radioactive dATP was omitted (16). Reamplified bands were detected on a 1.5% agarose gel and purified with the QIAquick gel extraction kit (QIAGEN, Hilden, Germany).

Cloning and sequencing. The reamplified cDNAs were cloned into pBluescript (Stratagene, Heidelberg, Germany). The Escherichia coli strain XL-1 Blue MRF' was made competent (14) and transformed (9). Positive (white) clones were selected, and the prepared plasmids were analyzed by restriction digestion and separation on an agarose gel. Nonradioactive dideoxy sequencing was done with the Dig Taq DNA sequencing kit with standard primers according to the manufacturer's protocol (Boehringer Mannheim). A database homology search was performed with BLAST.

Northern blot analysis. Total RNA (10 µg per lane) was separated on a formaldehyde agarose gel. The quantity and integrity of RNA were confirmed by evaluating the 18S and 28S RNAs by ethidium bromide staining. The RNA was blotted onto a nylon membrane (Hybond N; Amersham) for 2 h by alkaline capillary transfer (5). The membrane was dried overnight and subsequently fixed under ultraviolet light (254 nm) for 3 min. For hybridization, a solution consisting of 50% formamide, 5× SSC buffer (1× SSC buffer is 0.15 M NaCl plus 0.015 M sodium citrate), 50 mM sodium phosphate (pH 7.0), 2% blocking reagent (Boehringer Mannheim), 0.1% lauroylsarcosine, and 50 µg/ml yeast RNA was used. Prehybridization was done for 2 h at 50°C, and hybridization was carried out overnight at 68°C. Hybridization was performed with a digoxigenin-labeled cDNA probe (700 bp in length) amplified with the primers CCCTGAGAATTCACCATGCCG and AAATGCACTCGAGCTACAAAGGAGGC. Detection was performed with an alkaline phosphatase-coupled anti-digoxigenin antibody by using a commercially available chemiluminescence assay (Boehringer Mannheim).

Production of polyclonal antibodies against MLP. Three amino acid sequences from MLP were selected for immunization: peptide 1, GGLTHQVEKKE (2); peptide 2, KSLESTNVTDKDGEL; and peptide 3, NPSKFSAKFGESEKCPR. The three peptides were synthesized and coupled to a poly(L-lysine) backbone (24). Peptides (150 µg each) were injected along with 1 ml of the Ribi adjuvant system into a sheep. An equal amount of antigen was used for boostering every 3 wk. The immune serum was tested by ELISA with 0.1 µg of the corresponding peptide. Preimmune serum from the same sheep served as a control. The antibodies were affinity purified on an NHS-activated HiTrap column (Pharmacia) with the same peptide used for immunization. Only the antibodies directed against the COOH-terminal peptide (peptide 1) gave specific signals by immunoblot analysis and, therefore, will be referred to as MLP antibodies. A polyclonal antibody against MLP peptide 1 from rabbits (2), generously supplied by Dr. P. Caroni, was used for immunohistochemical studies.

Immunoblot analysis. Total muscle protein (100 µg) was separated on an SDS-15% polyacrylamide gel. Transfer to a 0.2-µm pore-size nitrocellulose membrane (Protran; Schleicher and Schüll, Dassel, Germany) was performed as described by Towbin et al. (25). The membrane was blocked with PBS containing 5% fat-free milk powder and was incubated overnight with the primary antibody in PBS and 0.5% fat-free milk powder at a concentration of 1.5 µg/ml. A peroxidase-coupled anti-sheep IgG (Sigma) was used as a secondary antibody. Chemiluminescence detection was performed with the ECL Western blotting detection reagent (Amersham). For immunoneutralization, the antibody was preabsorbed with a 10-fold molar surplus of the antigen for 2 h before application to the membrane.

Immunohistochemistry. Frozen sections, 9 µm thick, were air dried, fixed for 5 min in 3.6% formaldehyde in PBS, washed twice in PBS, and incubated for 15 min in 3% H2O2 in methanol. Sections were subsequently washed in distilled water. For detection of MLP, the sections were incubated for 2 h in a blocking solution (2% BSA, 10% goat serum, and 10% low-fat milk powder in PBS, pH 7.4). Excess blocking solution was removed, the primary antibody was overlaid, and the sections were incubated overnight at 4°C. The polyclonal MLP antibody was diluted 1:100 in blocking solution. For staining the MHC isoforms, the primary mouse monoclonal antibodies were diluted in blocking solution (2% BSA, 10% horse serum in PBS, pH 7.4) to yield the following concentrations: anti-MHCI (7HCS15), 10 µg/ml; anti-MHCIIa (SC-71), 10 µg/ml; and the BF-35 antibody (which recognizes all MHC isoforms except MHCIId(x), 10 µg/ml. The specificities of the 7HCS15 (26) and SC-71 and BF-35 (23) antibodies have been described elsewhere. The staining of desmin as a control for muscle fiber integrity (8) was achieved by using a monoclonal antibody (clone DE-B-5) from Boehringer Mannheim.

After incubation with the primary antibodies, sections were washed and reacted for 30 min with biotinylated secondary antibodies (for MHC isoforms, with horse anti-mouse IgG; for MLP, with goat anti-rabbit IgG). Thereafter, sections were washed, incubated for 30 min with a biotin-avidin-horseradish peroxidase complex (Vectastain ABC reagent; Vector Laboratories, Burlingame, CA), washed again, and reacted for 6 min with diaminobenzidine as the substrate (D 4293; Sigma). The reaction was stopped by washing the sections several times with distilled water. Where indicated (see the legends for Figs. 5 and 6), sections were counterstained with Harris' hematoxylin. Corresponding negative controls were obtained by substitution of the primary antibodies with control IgG from healthy mice or rabbits (SC-2025 and SC-2027; Santa Cruz Biotechnology). Immunohistochemical stainings were evaluated by examining six independent fields (~200 fibers each) for each condition. Results are given as means ± SD. A t-test was used to determine if differences between values from stimulated and control muscles existed. The acceptable level of significance was set at P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

RNA from SOL muscles, contralateral unstimulated muscles, and TA muscles stimulated for 12 h at low frequency was amplified by differential display RT-PCR (Fig. 1). For each muscle under study, total RNA from two animals was analyzed. The majority of the resulting PCR products from the various muscles displayed no conspicuous differences. A few signals, however, from stimulated muscles differed in intensity from those from control muscles. In the autoradiograph shown in Fig. 1, a band at ~300 bp, almost undetectable in the control TA muscles, produced very strong signals in both stimulated TA and normal SOL muscles.


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 1.   Detection of differentially expressed mRNAs from control muscles and tibialis anterior (TA) muscles stimulated for 12 h at low frequency (TAS), as well as from normal soleus (SOL) muscle, by differential display. Equal amounts of total RNA preparations from 2 animals (lanes 1 and 2) for each muscle were subjected to differential display by using primer pair GATGGCATTG and (T)11AC. Amplified products were separated on a sequencing gel and visualized by autoradiography. Arrow marks band of differentially expressed mRNA. TAC, contralateral TA.

The 300-bp band was excised from the gel, reamplified, and cloned for further analysis. The results from DNA sequencing were subjected to a homology search by BLAST. The 300-bp sequence could thus be unambiguously identified as a partial cDNA of the mRNA specific to MLP. Its differential expression in control and stimulated TA muscles, as well as in SOL muscle, was verified by Northern blot hybridization (Fig. 2). Stimulated TA and SOL muscles displayed a strong signal in the range of 900-950 nucleotides. Confirming the original results obtained by differential display, only a faint band was seen in the lane of the control TA muscles.


View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2.   Detection of muscle LIM protein (MLP) mRNA by Northern blot hybridization. A digoxigenin-labeled riboprobe was hybridized with equal amounts (10 µg) of total RNA from SOL and contralateral TA muscles and TA muscles stimulated for 12 h at low frequency. Positions of 18S and 28S RNAs are marked. Signal for MLP is at ~950 nt, corresponding to MLP mRNA.

To analyze MLP expression at the protein level, we raised polyclonal antibodies against three different peptide regions of MLP. As indicated by immunoblot analysis, only the COOH-terminal peptide produced a specific antibody recognizing MLP. This antibody was used for studying the expression of MLP at the protein level in TA muscles exposed to CLFS for different time periods (Fig. 3). The antibody recognized a protein at ~22 kDa, the predicted molecular mass of MLP. Preincubation of the affinity-purified antibody with a 10-fold molar surplus of the antigen completely abolished the signal at ~22 kDa (Fig. 3B). As illustrated by the immunoblot in Fig. 3A, a prominent MLP signal was also obtained in SOL and cardiac muscles, but not in the control TA muscle. However, CLFS led to an induction of MLP, which was first detected in 4-day-stimulated TA muscle. In 8-day-stimulated TA muscle the signal intensity resembled that in SOL muscle.


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 3.   Immunoblot for MLP in SOL, cardiac ventricle (VEN), and TA muscles exposed to chronic low-frequency stimulation for various time periods. Protein (100 µg) was applied to each lane. MLP was detected with an affinity-purified polyclonal antibody (A). For proving specificity of reaction, antibody was preincubated with a 10-fold molar surplus of antigen (B). Stimulation times (in days) are indicated. Note disappearance of specific signal at 22 kDa but persistence of secondary bands in high-molecular-mass region.

To localize MLP at the single-fiber level and to elucidate fiber type-specific distribution patterns, we performed immunohistochemical studies. Because our polyclonal antibody from sheep proved not to be suitable for immunohistochemistry, a polyclonal antibody from rabbits, generously provided by Dr. P. Caroni, was used. Confirming immunoblotting results (Fig. 3), staining for MLP was observed in cardiac muscle (results not shown) and SOL muscle (Fig. 4). In SOL muscle, all fibers were stained but intensities differed. On the basis of these stainings, the intracellular distribution of MLP appeared homogeneous without conspicuous nuclear staining. Compared with SOL muscle, only a minor fiber fraction of the TA muscle exhibited a faint staining for MLP (Figs. 4 and 5A). Thus immunohistochemistry proved to be more sensitive than immunoblotting, which produced no detectable MLP signal from control TA muscle (Fig. 3A). In 4-day-stimulated TA muscle, the number of reactive fibers increased, amounting to ~18% of the total population. Most of the reactive fibers displayed a staining stronger than that of the positive fibers in the control (Fig. 5B). In 8-day-stimulated muscles nearly all fibers displayed MLP reactivity but staining intensities differed (Fig. 5C).


View larger version (126K):
[in this window]
[in a new window]
 
Fig. 4.   Immunohistochemical stainings for MLP in cross sections of normal rat TA and SOL muscles.


View larger version (158K):
[in this window]
[in a new window]
 
Fig. 5.   Immunohistochemical stainings for MLP (A, B, C) and myosin heavy chain I (MHCI; D, E, F) in serial sections of control (A, D) and 4- (B, E) and 8-day-stimulated (C, F) rat TA muscles. Depicted areas were chosen on the basis of small amounts of type I fibers. Two fibers slightly stained for MHCI are seen in E, and one is seen in F. Nuclei were counterstained with Harris hematoxylin.

MLP upregulation was correlated with specific fiber types (Table 1, Fig. 6). Because fiber typing in 8-day-stimulated muscle was obscured by the onset of MHC isoform transitions, especially with regard to the appearance of hybrid fibers (22), we focused on the 4-day-stimulated muscle, i.e., the early phase of MLP upregulation. In this muscle, MLP-positive fibers had increased twofold. Compared with that of the control, the intensity of the staining had increased, and some fibers exhibited strong reactivity. The majority of the fibers intensely staining for MLP in 4-day-stimulated muscle (Fig. 6, MLP) were immunohistochemically identified as type IIA (Fig. 6, MHCIIa). In the control muscle only 35% of the type IIA fibers reacted with MLP (Table 1), but compared with that of the stimulated muscle their staining intensity was much weaker.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Fiber type distribution of MLP in cross-sectioned control and stimulated TA muscles



View larger version (164K):
[in this window]
[in a new window]
 
Fig. 6.   Serial cross sections of rat TA muscle stimulated for 4 days at low frequency and immunochemically stained with anti-MLP antibody (MLP) and antibodies 7HCS15 (MHCI), SC-71 (MHCIIa), and BF-35 [MHCIId(x)], which stains all fiber types except for type IID(X). Note 2 type I fibers (1 and 2) expressing different amounts of MLP, a MLP-negative type IIA fiber (3), and a type IIA fiber intensely stained for MLP (4). Nuclei were counterstained with Harris hematoxylin.

In control TA muscle, only 5% of the immunohistochemically defined type I fibers were MLP positive (Table 1). This fraction increased to ~37% in the 4-day-stimulated muscle. At this time, the percentage of type I fibers had not increased. MLP-positive type IID(X) fibers were not detected in the control muscle (not shown) and were scarcely seen in the 4-day-stimulated muscle. For instance, no such fibers can be detected in the area of the cross section in Fig. 6. An evaluation of a larger number of fibers revealed that <= 4% of the type IID(X) fibers were MLP positive in the 4-day-stimulated muscle (Table 1).

To exclude the possibility that MLP upregulation was related to CLFS-induced fiber injury, the integrity of the fibers was examined by immunohistochemical staining for desmin. According to Fridén and Lieber (8), loss of the cytoskeletal protein desmin is the earliest manifestation of fiber injury. As shown by immunohistochemical stainings for MLP and desmin (Fig. 7), desmin reactivity was unaltered in the 4-day-stimulated muscles, including the MLP-positive fibers.


View larger version (139K):
[in this window]
[in a new window]
 
Fig. 7.   Immunohistochemical staining of MLP and desmin in serial sections of 4-day-stimulated TA muscle. Note unaltered morphology and uniform staining for desmin in all fibers, including MLP-positive fibers.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

CLFS represents an excellent experimental model for studying the phenotypic modulation of the so-called terminally differentiated muscle fiber. The induced fast-to-slow conversion, which encompasses all major functional elements of the muscle fiber, reflects an extensive reprogramming of gene expression. At the level of the myofibrillar apparatus with sequential exchanges of a variety of fast with slow contractile and regulatory protein isoforms, this process comprises a thorough rearrangement of the sarcomere.

During the past years much knowledge of the quality, quantity, and time courses of stimulation-induced alterations in the phenotypic properties of fast-twitch muscles undergoing fast-to-slow transitions under the influence of CLFS has accumulated. However, basic factors and mechanisms causally related to stimulation-induced changes in gene expression have as yet remained obscure. In view of the early onset of such alterations in stimulated muscle, e.g., the rapid upregulation of hexokinase II (11) and the downregulation of parvalbumin (13) and of MHCIIb (15), a search for regulatory factors should focus on the first hours after the onset of stimulation.

Using the method of differential display, we show that the gene of MLP is strongly upregulated during the first 12 h after stimulation onset. Furthermore, the upregulated MLP mRNA, whose authenticity is proven by Northern blotting, is translated, as demonstrated by immunoblot analysis and immunohistochemistry. We also show that MLP is expressed in adult slow-twitch SOL muscle. In contrast to this muscle, with its high levels of expression of MLP in all fibers, normal TA muscle contains only a minor fraction of fibers, which, as judged by immunohistochemistry, express MLP only in small amounts. MLP is markedly upregulated after 4 days of CLFS, increases further after 8 days, and, as proved by the immunoblotting in additional studies, persists at high levels in 20-day-stimulated muscle (data not shown).

An interesting observation is that MLP is initially upregulated mainly in type IIA and type I fibers. This distribution pattern resembles that shown for the upregulation of heat shock protein HSP70 and alpha B-crystallin in low-frequency-stimulated rabbit muscle (18, 19). Because of their relatively high aerobic-oxidative capacities, type I and type IIA fibers are capable of sustained activity. These fibers seem to be primarily responsible for force generation during the initial phase of transformation, as type IIB and type IID(X) fibers fatigue and become transiently refractory after the onset of stimulation (10; A. Conjard and D. Pette, unpublished observations).

The upregulation of MLP in a fast-twitch muscle under the influence of a slow-type impulse pattern superimposed to its normal neural input points to the neural regulation of its expression in adult muscle. This interpretation is in agreement with the observation that MLP is upregulated by denervation in rat hindlimb muscles, predominantly composed of fast-twitch fibers (2). The denervation experiment suggests that MLP expression may be repressed by the phasic high-frequency impulse pattern normally delivered to fast-twitch muscles by their nerve. Here we show that this putative repression can be overcome by a tonic, slow-type impulse pattern superimposed on the phasic fast-type impulse pattern.

MLP has previously been identified as an essential factor in myogenesis and in the promotion of myogenic differentiation (2, 3). It is an interesting result of the present study that MLP is upregulated in response to CLFS. This observation is remarkable because CLFS-induced transitions in phenotypic properties occur in terminally differentiated adult muscle fibers. As shown in the present study by unaltered desmin expression, these transitions occur without detectable signs of myogenesis, i.e., satellite cell proliferation in connection with muscle fiber repair or regeneration, confirming previous observations on rat muscle (7, 22). Although the function of MLP in adult muscle fibers remains obscure, there is a possibility that it plays a role in the rearrangement of the myofibrillar apparatus concomitant with fiber type transformation. We propose that MLP, because of its suggested role as an adapter protein (1), is involved in the early adaptation of cytoskeletal and/or myofibrillar structures to enhanced contractile activity.


    ACKNOWLEDGEMENTS

We thank Dr. Bernd Kirschbaum and Dr. Daniel Margerie for stimulating discussions. We are grateful to Dr. Pico Caroni for generously supplying the polyclonal rabbit anti-MLP antibody used for immunohistochemistry.


    FOOTNOTES

This study was supported by the Deutsche Forschungsgemeinschaft, Sonderforschungsbereich 156, TP/B3.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: D. Pette, Faculty of Biology, Univ. of Konstanz, D-78457 Constance, Germany (E-mail: dirk.pette{at}uni-konstanz.de).

Received 26 June 1998; accepted in final form 30 December 1998.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Arber, S., and P. Caroni. Specificity of single LIM motifs in targeting and LIM/LIM interactions in situ. Genes Dev. 10: 289-300, 1996[Abstract/Free Full Text].

2.   Arber, S., G. Halder, and P. Caroni. Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell 79: 221-231, 1994[Medline].

3.   Arber, S., J. J. Hunter, J. Ross, M. Hongo, G. Sansig, J. Borg, J. C. Perriard, K. R. Chien, and P. Caroni. MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell 88: 393-403, 1997[Medline].

4.   Bauer, D., H. Müller, J. Reich, H. Riedel, W. Ahrenkiel, P. Warthoe, and M. Strauss. Identification of differentially expressed mRNA species by an improved display technique (DDRT-PCR). Nucleic Acids Res. 21: 4272-4280, 1993[Abstract/Free Full Text].

5.   Chomczynski, P. One-hour downward alkaline capillary transfer for blotting of DNA and RNA. Anal. Biochem. 201: 134-139, 1992[Medline].

6.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

7.   Delp, M. D., and D. Pette. Morphological changes during fiber type transitions in low-frequency-stimulated rat fast-twitch muscle. Cell Tissue Res. 277: 363-371, 1994[Medline].

8.   Fridén, J., and R. L. Lieber. Segmental muscle fiber lesions after repetitive eccentric contractions. Cell Tissue Res. 293: 165-171, 1998[Medline].

9.   Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166: 557-580, 1983[Medline].

10.   Hicks, A., K. Ohlendieck, S. O. Göpel, and D. Pette. Early functional and biochemical adaptations to low-frequency stimulation of rabbit fast-twitch muscle. Am. J. Physiol. 273 (Cell Physiol. 42): C297-C305, 1997[Abstract/Free Full Text].

11.   Hofmann, S., and D. Pette. Low-frequency stimulation of rat fast-twitch muscle enhances the expression of hexokinase II and both the translocation and expression of glucose transporter 4 (GLUT-4). Eur. J. Biochem. 219: 307-315, 1994[Medline].

12.   Hu, P., C. Yin, K. M. Zhang, L. D. Wright, T. E. Nixon, A. S. Wechsler, J. A. Spratt, and F. N. Briggs. Transcriptional regulation of phospholamban gene and translational regulation of SERCA2 gene produce coordinate expression of these two sarcoplasmic reticulum proteins during skeletal muscle phenotype switching. J. Biol. Chem. 270: 11619-11622, 1995[Abstract/Free Full Text].

13.   Huber, B., and D. Pette. Dynamics of parvalbumin expression in low-frequency-stimulated fast-twitch rat muscle. Eur. J. Biochem. 236: 814-819, 1996[Medline].

14.   Inoue, H., H. Nojima, and H. Okayama. High efficiency transformation of Escherichia coli with plasmids. Gene 96: 23-28, 1990[Medline].

15.   Jaschinski, F., M. Schuler, H. Peuker, and D. Pette. Changes in myosin heavy chain mRNA and protein isoforms of rat muscle during forced contractile activity. Am. J. Physiol. 274 (Cell Physiol. 43): C365-C370, 1998[Abstract/Free Full Text].

16.   Liang, P., L. Averboukh, and A. B. Pardee. Distribution and cloning of eukaryotic mRNAs by means of differential display: refinements and optimization. Nucleic Acids Res. 21: 3269-3275, 1993[Abstract/Free Full Text].

17.   Michel, J. B., G. A. Ordway, J. A. Richardson, and R. S. Williams. Biphasic induction of immediate early gene expression accompanies activity-dependent angiogenesis and myofiber remodeling of rabbit skeletal muscle. J. Clin. Invest. 94: 277-285, 1994.

18.   Neufer, P. D., and I. J. Benjamin. Differential expression of alpha B-crystallin and Hsp27 in skeletal muscle during continuous contractile activity. Relationship to myogenic regulatory factors J. Biol. Chem. 271: 24089-24095, 1996[Abstract/Free Full Text].

19.   Neufer, P. D., G. A. Ordway, G. A. Hand, J. M. Shelton, J. A. Richardson, I. J. Benjamin, and R. S. Williams. Continuous contractile activity induces fiber type-specific expression of HSP70 in skeletal muscle. Am. J. Physiol. 271 (Cell Physiol. 40): C1828-C1837, 1996[Abstract/Free Full Text].

20.   Pette, D., and R. S. Staron. Mammalian skeletal muscle fiber type transitions. Int. Rev. Cytol. 170: 143-223, 1997[Medline].

21.   Pette, D., and G. Vrbová. Adaptation of mammalian skeletal muscle fibers to chronic electrical stimulation. Rev. Physiol. Biochem. Pharmacol. 120: 115-202, 1992[Medline].

22.   Putman, C. T., S. Düsterhöft, and D. Pette. Changes in satellite cell content and myosin isoforms in low-frequency-stimulated fast muscle of hypothyroid rat. J. Appl. Physiol. 86: 40-51, 1999[Abstract/Free Full Text].

23.   Schiaffino, S., L. Gorza, S. Sartore, L. Saggin, S. Ausoni, M. Vianello, K. Gundersen, and T. Lömo. Three myosin heavy chain isoforms in type 2 skeletal muscle fibres. J. Muscle Res. Cell Motil. 10: 197-205, 1989[Medline].

24.   Tam, J. P. Synthetic peptide vaccine design: synthesis and properties of a high-density multiple antigenic peptide system. Proc. Natl. Acad. Sci. USA 85: 5409-5413, 1988[Abstract/Free Full Text].

25.   Towbin, H., T. Staehelin, and J. Gordon. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76: 4350-4354, 1979[Abstract/Free Full Text].

26.   Wehrle, U., S. Düsterhöft, and D. Pette. Effects of chronic electrical stimulation on myosin heavy chain expression in satellite cell cultures derived from rat muscles of different fiber-type composition. Differentiation 58: 37-46, 1994[Medline].

27.   Weiskirchen, R., J. D. Pino, T. Macalma, K. Bister, and M. C. Beckerle. The cysteine-rich protein family of highly related LIM domain proteins. J. Biol. Chem. 270: 28946-28954, 1995[Abstract/Free Full Text].


Am J Physiol Cell Physiol 276(4):C900-C906
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Exp PhysiolHome page
M. Velders, K. Legerlotz, S. J. Falconer, N. S. Stott, C. D. McMahon, and H. K. Smith
Effect of botulinum toxin A-induced paralysis and exercise training on mechanosensing and signalling gene expression in juvenile rat gastrocnemius muscle
Exp Physiol, December 1, 2008; 93(12): 1273 - 1283.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
I. A. Barash, M.-L. Bang, L. Mathew, M. L. Greaser, J. Chen, and R. L. Lieber
Structural and regulatory roles of muscle ankyrin repeat protein family in skeletal muscle
Am J Physiol Cell Physiol, July 1, 2007; 293(1): C218 - C227.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. M. Lehti, M. Silvennoinen, R. Kivela, H. Kainulainen, and J. Komulainen
Effects of streptozotocin-induced diabetes and physical training on gene expression of titin-based stretch-sensing complexes in mouse striated muscle
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E533 - E542.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
I. A. Barash, L. Mathew, M. Lahey, M. L. Greaser, and R. L. Lieber
Muscle LIM protein plays both structural and functional roles in skeletal muscle
Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1312 - C1320.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Glenmark, M. Nilsson, H. Gao, J.-A. Gustafsson, K. Dahlman-Wright, and H. Westerblad
Difference in skeletal muscle function in males vs. females: role of estrogen receptor-{beta}
Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1125 - E1131.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
I. A. Barash, L. Mathew, A. F. Ryan, J. Chen, and R. L. Lieber
Rapid muscle-specific gene expression changes after a single bout of eccentric contractions in the mouse
Am J Physiol Cell Physiol, February 1, 2004; 286(2): C355 - C364.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
W. G. Campbell, S. E. Gordon, C. J. Carlson, J. S. Pattison, M. T. Hamilton, and F. W. Booth
Differential global gene expression in red and white skeletal muscle
Am J Physiol Cell Physiol, April 1, 2001; 280(4): C763 - C768.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
S. E. Gordon, M. Fluck, and F. W. Booth
Plasticity in Skeletal, Cardiac, and Smooth Muscle: Selected Contribution: Skeletal muscle focal adhesion kinase, paxillin, and serum response factor are loading dependent
J Appl Physiol, March 1, 2001; 90(3): 1174 - 1183.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. R. Sultan, B. T. Dittrich, E. Leisner, N. Paul, and D. Pette
Fiber type-specific expression of major proteolytic systems in fast- to slow-transforming rabbit muscle
Am J Physiol Cell Physiol, February 1, 2001; 280(2): C239 - C247.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. Willmann, J. Kusch, K. R. Sultan, A. G. Schneider, and D. Pette
Muscle LIM protein is upregulated in fast skeletal muscle during transition toward slower phenotypes
Am J Physiol Cell Physiol, February 1, 2001; 280(2): C273 - C279.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
D. C. Graves and Z. Yablonka–Reuveni
Vascular Smooth Muscle Cells Spontaneously Adopt a Skeletal Muscle Phenotype: A Unique Myf5-/MyoD+ Myogenic Program
J. Histochem. Cytochem., September 1, 2000; 48(9): 1173 - 1194.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. R. Sultan, B. T. Dittrich, and D. Pette
Calpain activity in fast, slow, transforming, and regenerating skeletal muscles of rat
Am J Physiol Cell Physiol, September 1, 2000; 279(3): C639 - C647.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
S. Kästner, M. C. Elias, A. J. Rivera, and Z. Yablonka–Reuveni
Gene Expression Patterns of the Fibroblast Growth Factors and Their Receptors During Myogenesis of Rat Satellite Cells
J. Histochem. Cytochem., August 1, 2000; 48(8): 1079 - 1096.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schneider, A. G.
Right arrow Articles by Pette, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schneider, A. G.
Right arrow Articles by Pette, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online