|
|
||||||||
1 Laboratoire de Biochimie des
Transports Cellulaires, This study was
designed to demonstrate the presence of epidermal growth factor (EGF)
in the rat exorbital lacrimal gland. EGF precursor gene transcription
was demonstrated first by RT-PCR analysis of lacrimal gland RNA using a
set of specific primers and second by Northern blot analysis of rat
lacrimal gland mRNA. A rabbit polyclonal antibody
(rEGF2) directed against rat
submaxillary gland EGF was used to detect EGF-containing proteins by
RIA. Results indicate that the rat lacrimal gland does not contain
detectable soluble and mature EGF but that the EGF immunoreactivity is
associated with the membrane-enriched fraction. Analysis of the
detergent-solubilized membrane proteins by gel filtration shows that
membrane-associated EGF immunoreactivity was present as a
high-molecular-mass protein. Moreover, as shown by Western blot
analysis, a specific anti-rat EGF precursor antibody
(ppEGF1) can immunoprecipitate a
152-kDa EGF-containing protein. Taken together, these results
demonstrate for the first time both EGF precursor gene transcription
and EGF precursor protein expression in a lacrimal tissue, i.e., the
rat exorbital lacrimal gland. The demonstration that EGF appears to be
stored only as its full-length membrane precursor may provide important
information to study the regulation of its secretory process.
reverse transcriptase-polymerase chain reaction; rat epidermal
growth factor antibody; rat epidermal growth factor precursor antibody; immunoprecipitation; exocrine gland
EPIDERMAL GROWTH FACTOR (EGF) is a very potent 6-kDa
polypeptide mitogen that belongs to a family of growth factors that
also includes transforming growth factor- Recently, it was shown that human (27, 49), mouse (45), and rat (50)
tears contained EGF or an EGF-like immunoreactivity and that the total
production of EGF in human tears increased during reflex tearing (46).
The EGF precursor mRNA has been detected by Northern blot in mouse (14)
and by RT-PCR in human (52) lacrimal glands. Moreover, EGF-like
immunoreactivities have been detected in human (26), mouse (14), and
rat (48, 50) lacrimal tissues.
The lacrimal gland produces the complex aqueous portion of tears, which
contains many components, including electrolytes and proteins. The pH,
electrolyte concentration, and protein composition of lacrimal fluids
are crucial in maintaining the health of the ocular surface. The
proteins synthesized and secreted by the lacrimal glands are very
specific and are thought to be mainly involved in the bacteriostatic
action of tears. Until now, only a few of them have been identified,
but their secretion involves both the constitutive (42) and regulated
pathways (8). From the work of Savage and Cohen (35), showing the
stimulating effect of EGF on corneal epithelial cell proliferation, the
role of EGF in corneal wound healing has been extensively studied. The
results indicated that EGF and other growth factors were involved in
the stimulation of reepithelization processes as well as keratinocyte and corneal endothelium proliferation (5, 51). Thus the conserved presence of EGF and/or EGF-related molecules in tears and
lacrimal glands of both humans and rodents further suggested that it
may serve an important function in the periocular environment. In light
of these results, it was suggested that the lacrimal gland could be
important in the process of corneal wounding by producing growth
factors secreted in tears (51). In the human lacrimal gland, EGF
secretion could involve a muscarinically regulated pathway (53).
However, until now nothing was known about the storage form of EGF in
this tissue and consequently about the way by which EGF could be
secreted into the tear fluid.
In view of the above hypothesis, and because the lacrimal gland tissue
from rat is very easy to obtain compared with its human counterpart, we
decided to look for the presence of EGF and to identify the molecular
form present in the rat exorbital lacrimal gland. We first examined EGF
gene expression by both RT-PCR and Northern blot analysis. Second,
EGF-containing proteins were identified and localized using anti-rat
EGF and anti-rat EGF precursor antibodies. Results obtained were
compared with reference tissues such as rat submaxillary gland and
kidney. Our results demonstrate for the first time both EGF precursor
gene transcription and EGF precursor protein expression in a lacrimal
tissue, i.e., the rat exorbital lacrimal gland. Contrary to previous
observations made in both mouse (14) and rat (50) lacrimal gland, we
were unable to detect the 6-kDa soluble form of mature EGF in the rat
lacrimal gland. Our results demonstrate that EGF is stored only as its full-length membrane-associated precursor and may provide key information to study the regulation of its secretory process.
Animals.
Adult male albino Sprague-Dawley rats were obtained from IFFA CEDO and
used throughout this study.
Chemicals.
Peroxidase-conjugated and alkaline phosphatase-conjugated goat
anti-rabbit IgG, mouse EGF (mEGF), synthetic rat TGF- Rat submaxillary gland EGF purification.
Rat EGF (rEGF) was isolated from submaxillary glands of adult male
Sprague-Dawley rats (at least 12 wk old) using rapid HPLC techniques
according to Simpson et al. (41). This purification involved the
homogenization of the frozen tissue in drastic acidic conditions
followed by centrifugation of the homogenate. The rEGF contained in the
soluble material was purified by sequential chromatography through a
preparative reverse-phase C18 column and an analytical C18 HPLC column
and anion exchange on a mono-Q column. During the course of this
purification, rEGF was followed by radioreceptor assay (RRA) as
described below but using
125I-labeled mEGF as radioligand.
From 23 g of tissue (wet mass), we obtained ~600 µg of purified
rEGF. The purity of the final product was checked by comparison with
commercial mEGF and hEGF by SDS-PAGE, automated amino acid sequence
analysis, and ability to stimulate HC 11 cell growth (data not shown).
rEGF radiolabeling.
Native rEGF was radiolabeled with
[125I]NaI by the
chloramine T method. Briefly, 1 µg rEGF dissolved in 20 µl of 0.25 M sodium phosphate buffer (pH 7.4) was incubated for 45 s in the
presence of 0.5 mCi (5 µl) carrier-free
[125I]NaI and 10 µl
chloramine T (2 mg/ml) at room temperature. The reaction was terminated
by the addition of 20 µl sodium metabisulfite (2 mg/ml) and 40 µl
NaI (2.5 mg/ml) and the mixture was diluted to 500 µl with 50 mM
sodium phosphate buffer (pH 7.4) containing 150 mM NaCl and 1% BSA.
125I-rEGF was separated from
nonincorporated
[125I]NaI by
chromatography on a PD-10 (Sephadex G-25) desalting column. In these
conditions, the peptide incorporated 40-60% of the radioactivity, and the eluted iodinated peptide is 95-97% precipitable by 10% TCA.
Antibody production.
Purified rEGF was used to generate polyclonal rabbit antibodies.
Production was performed according to the Eurogentec custom protocol of
immunization. Two rabbits were immunized with 50 µg of rEGF and
further boosted twice at 15-day intervals and then once more 1 mo
later. The presence of specific anti-rEGF antibodies in sera was tested
by their ability to immunoprecipitate
125I-rEGF. Both rabbits produced
antibodies, but only one (rEGF2) was retained because of its higher serum titer. The IgG fraction of
this antiserum was prepared by chromatography on protein A-Sepharose.
![]()
ABSTRACT
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS AND DISCUSSION
References
![]()
INTRODUCTION
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS AND DISCUSSION
References
(TGF-
), heparin-binding EGF-like growth factor (HB-EGF), amphiregulin, and betacellulin. These
growth factors bind and activate the intrinsic tyrosine kinase activity
of the EGF receptor (EGFR) (10). Most of the known growth factors are
derived from soluble precursors. These biologically inactive soluble
precursors are confined to cytoplasmic compartments of the secretory
pathway where they mature through proteolytic cleavage before being
released outside the cell. It is now well established from both cDNA
sequence analysis and protein biochemistry that growth factors of the
EGF family are also synthesized in the form of precursor molecules.
However, they constitute an exception to the general model, since they
are thought to be synthesized as transmembrane glycoproteins. For
example, cDNA analysis of the EGF precursor predicted proteins of
1,207, 1,217, and 1,133 amino acids, respectively, for human (1), mouse
(33, 40), and rat (34), resulting in glycoproteins of molecular mass
between 140 and 170 kDa. This molecule is made up of a large
extracellular region (~1,000 amino acids) with the EGF sequence
(48-53 amino acids) located near the plasma membrane, a
transmembrane domain, and an intracellular domain of variable length
(19). In tissues such as kidney (2, 33, 37) and mammary
gland (3), EGF is present as part of the extracellular portion of the
transmembrane precursor. However, in the submaxillary gland from
rodents, the EGF precursor molecule is fully and intracellularly
processed into EGF (33) and stored in the secretory granules of the
granular convoluted tubules (31, 39); thus the ways by which EGF is secreted in the extracellular medium must be completely different. In
the first case, the precursor needs to be cleaved extracellularly by an
unidentified ectoprotease (12, 13), whereas, in the second case,
secretion involves the well-known regulated exocrine secretion through
stored secretory granules (6).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS AND DISCUSSION
References
, trypsin (10,000 N
-benzoyl-L-arginine
ethyl ester units/mg), soybean trypsin inhibitor (1 mg inhibits 10,000 units trypsin), polyethylene glycol 6000, pepstatin A, leupeptin,
chymostatin, antipain, p-nitrophenyl phosphate, p-nitrophenol, and protein
molecular mass markers were obtained from Sigma Chemical (St. Louis,
MO). Enhanced chemiluminescence (ECL) developer and Hyperfilm were from
Amersham France (Les Ulis, France). Bicinchoninic acid protein assay
kit and ImmunoPure Ag/Ab immobilization trial kit (SulfoLink coupling
gel) were purchased from Pierce (Rockford, IL). Recombinant human EGF
(hEGF) was from Preprotech (Washington, MA). Triton X-100 was obtained
from Merck (Darmstadt, Germany). Bio-Gel P-10 was from Bio-Rad
Laboratories (Ivry/seine, France). Prepacked HiPrep 16/60 Sephacryl
S-200 HR, Mono Q HR 5/5, PD-10 desalting columns, deoxynucleotide
triphosphates, protein A-Sepharose CL-4B, agarose, and DNA
size markers were obtained from Pharmacia Biotech (Orsay, France).
Superscript RNase H
RT,
random primers, and restriction enzymes
Pst I,
Hae III, and Sst I were from GIBCO BRL (Eragny,
France). The random primer DNA labeling kit was obtained from
Boehringer Mannheim (Meylan, France). Upstream and downstream
oligonucleotide primers and synthetic peptide p437 were synthesized by
Eurogentec (Seraing, Belgium). Taq DNA
polymerase was from Appligene (Illkirch, France).
[125I]NaI (100 mCi/ml,
3.7 MBq/ml),
[
-32P]dCTP (3,000 Ci/mmol, 111 TBq/mmol), and
125I-labeled mEGF (150-200
µCi/µg, 5.6-7.4 MBq/µg) were purchased from New England
Nuclear (Les Ulis, France).
Preparation and fractionation of the rat tissues.
Rats were killed by carbon dioxide inhalation. The exorbital lacrimal,
parotid, and submaxillary glands, heart, brain, kidney, and liver were
rapidly removed. Glandular tissues were trimmed of their fatty and
connective tissues, and hearts and livers were extensively washed to
eliminate blood contamination as much as possible. All tissues were
further fragmented into small pieces and either used for the
preparation of lacrimal acini as described previously (20) or frozen in
liquid nitrogen and stored at
20°C until processing for RNA
(18) or subcellular fraction preparation (see below).
20°C until further
characterization of the membrane-associated EGF-containing proteins.
RRA and RIA of soluble and/or membrane-associated EGF precursor molecules. Rat liver membrane fraction prepared as described previously (20) was used as the source of EGFR for RRA. Up to 400 µl of diluted or undiluted soluble fractions from submaxillary gland, lacrimal gland, or kidney (prepared as described above) or known amounts of rEGF were incubated in the presence of 125I-rEGF [30,000-50,000 counts/min (cpm), 25 pM] and liver membranes in a final volume of 500 µl of buffer (50 mM sodium phosphate, pH 7.4, and 250 mM sucrose) for 3 h at 20°C. Bound and free 125I-rEGF were separated by rapid filtration through glass-fiber filters as described previously (20). The radioactivity retained on the filter was counted on an LKB 1275 mini-gamma-counter. A standard competition curve was generated using increasing concentrations of nonlabeled rEGF ranging from 0 to 100 nM. With the assumption that all activities bind to the EGFR with equal potency, the amounts of EGF-like activities in the various soluble fractions were quantified by comparing the displacement curve with that of authentic rEGF.
RIA was performed using 125I-rEGF as radioligand and the IgG fraction of the rabbit polyclonal anti-rEGF antibody (rEGF2) prepared as described above and further characterized as described in RESULTS AND DISCUSSION. Immunoreactive rEGF (irEGF) was quantified in both soluble (submaxillary gland, lacrimal gland, and kidney) and detergent-solubilized (lacrimal gland and kidney) membrane fractions. To release low-molecular-mass EGF from both soluble and Triton-solubilized membrane-associated precursor, aliquots of the fractions were incubated in the presence of 200 µg/ml trypsin for 1 h at 37°C. Trypsin hydrolysis was stopped by the addition of soybean trypsin inhibitor (1 mg/ml final concentration). irEGF in samples or known amounts of rEGF were then assayed in a final volume of 250 µl, in the presence of 30,000-50,000 cpm 125I-rEGF and rEGF2 at a final dilution of 1:5,000. After overnight incubation at 4°C, 50 µl of nonimmune rabbit serum were added and antigen-antibody complexes were precipitated by 300 µl of 20% polyethylene glycol 6000 (wt/vol) in 50 mM sodium phosphate buffer. After vortexing, the tubes were stored at 4°C for 2 h and centrifuged for 15 min at 15,000 g at 4°C. Supernatants were aspirated, and pellets were monitored for 125I using an LKB 1275 mini-gamma-counter. irEGF in the different fractions was estimated by comparison with a competition curve obtained with authentic rEGF.Gel filtration analysis of the molecular mass form of membrane-associated EGF precursor molecules. Triton-extracted membrane-associated EGF-containing molecules in both kidney and lacrimal gland were characterized by gel filtration on 1.6 × 60-cm Sephacryl S-200 and 1.6 × 30-cm Bio-Gel P-10 columns. The columns were equilibrated at 4°C in lysis buffer B. Elution was performed in the same buffer at the flow rates of 13 ml/h for Sephacryl S-200 and 8 ml/h for the Bio-Gel P-10 column. Calibration of the Sephacryl S-200 column was performed with ferritin (440 kDa), chicken IgY (190 kDa), BSA (67 kDa), ovalbumin (45 kDa), carbonic anhydrase (29 kDa), cytochrome c (12.4 kDa), and rat submaxillary gland EGF (5.3 kDa). Calibration of the Bio-Gel P-10 column was performed with chicken IgY (190 kDa), rat submaxillary gland EGF (5.3 kDa), and p-nitrophenol. An aliquot of the solubilized membrane proteins from each tissue was analyzed before (Sephacryl S-200) and/or after (Sephacryl S-200 and Bio-Gel P-10) trypsin hydrolysis as described above. In both cases, 1-ml fractions were collected for evaluation of their irEGF content by RIA either directly or after trypsin hydrolysis as indicated in RESULTS AND DISCUSSION.
Immunoprecipitation of membrane-associated EGF precursor molecules. For immunoprecipitation experiments, 1 ml of lacrimal gland lysates and 0.5 ml of kidney membrane lysates prepared in lysis buffer A were used. Immunoprecipitations were carried out overnight at 4°C under constant rocking in the presence of 8 µg of ppEGF1 in the absence or presence of 20 µg of peptide p437. Immune complexes were precipitated with 30 µl of protein A-Sepharose conjugate for 1 h at 4°C, and the immunoprecipitates were collected by centrifugation for 15 s at 10,000 g. Immunoprecipitates were then washed twice in lysis buffer A and finally in Tris-buffered saline buffer (10 mM Tris · HCl, pH 7.5, and 150 mM NaCl). Immunoprecipitates were then analyzed for the presence of EGF precursor molecules either by RIA or Western blot. For RIA analysis, the washed protein A-Sepharose pellet was first resuspended in 100 µl of trypsin-containing buffer (100 µg trypsin/ml) and incubated for 1 h at 37°C. Protein A-Sepharose was pelleted by centrifugation, and the supernatant was tested for the presence of irEGF. For Western blot analysis, the immunoprecipitate was heated in SDS sample buffer for 5 min at 100°C. Solubilized proteins were separated by 7.5% SDS-PAGE, electrotransferred, and blotted overnight to nitrocellulose membrane (BA 85, Schleicher & Schuell, Dassel, Germany). Blots were then further processed and immunostained with affinity-purified anti-p437 antibody (ppEGF1; 0.8 µg/ml) and probed with a 1:10,000 dilution of goat anti-rabbit IgG antibody linked to horseradish peroxidase exactly as described previously (18). Blots were developed in ECL according to manufacturer recommendations and visualized by exposure to Amersham Hyperfilm-ECL.
RNA extraction and RT-PCR analysis. Total RNAs from brain, heart, liver, kidney, parotid glands, submaxillary glands, whole lacrimal glands, and lacrimal acinar cells from rats were prepared and subjected to reverse transcription as described previously (18). Oligonucleotide primers (22-mer) were used for amplification of the EGF precursor mRNA by PCR. The sense and antisense oligonucleotide sequences were obtained from a published cDNA sequence of the rat prepro-EGF (Ref. 34; GenBank no. M63585). They are listed in the 5'-to-3' direction with the following coordinates: sense positions 3084-3105 (ATGTCTGCCAATGCTCAGAAGG) and antisense positions 3679-3700 (TAGGACCACAAACCAAGGTTGGG). After 30 cycles of amplification (1 min at 94°C, 1 min at 60°C, and 1 min at 72°C) performed in a Perkin-Elmer thermal cycler, amplified cDNAs were analyzed by electrophoresis on a 2% agarose gel in buffer containing 89 mM Tris, 89 mM boric acid, and 1 mM EDTA (pH 8) and identified by ethidium bromide staining as previously described (18). Negative controls were carried out either with reverse transcription performed in the absence of RNA templates or with RNA incubated in the absence of RT. cDNAs were further transferred to Zeta-probe membranes (Bio-Rad) by capillary blotting overnight under high ionic strength (10× SSC buffer = 1.5 M sodium chloride and 0.15 M sodium citrate supplemented with 0.5% SDS wt/vol) and fixed covalently to the membrane by intense ultraviolet (UV) illumination.
Southern blot analysis of PCR amplification products.
To verify the specificity of the amplification products, the
hybridization of the Southern blots with a specific cDNA probe was
performed. The probe used was the 0.4-kb
Pst I fragment derived from cDNA clone
pmEGF-26F12 of the mouse prepro-EGF (11) (American Type Culture
Collection, ref. no. 37486). The probe was labeled by random priming
with [
-32P]dCTP.
Southern blots were prehybridized and hybridized with the labeled probe
(20 ng, 3 × 106 cpm/ml) and
washed under increasing stringency from 2× SSC-0.1% SDS at
45°C for 15 min to 0.1× SSC-0.1% SDS at 65°C for 15 min, as previously described (18). Autoradiographs were obtained by exposure
to Amersham Hyperfilm using two intensifying screens at
80°C.
Restriction mapping of the amplification products.
To further confirm the specificity of amplification, restriction enzyme
analysis of the amplified cDNA fragments from rat lacrimal gland cells
and rat submaxillary gland was also performed. Three different
restriction enzymes were used, Pst I,
Sst I, and Hae III. The incubations were carried
out in a final volume of 30 µl containing 14 µl of amplification
products, 1 µl of each restriction enzyme (10 units), 3 µl of the
10× buffer supplied by the manufacturer, and sterile distilled
water (up to 30 µl) for 3 h at 37°C. Incubations were stopped by
dilution with 80 µl of Tris-EDTA buffer and immediate
precipitation at
20°C with ethanol in the presence of sodium
acetate. Digestion products were analyzed by electrophoresis on 2.5%
agarose gel and visualized as described above.
Northern blot analysis of
poly(A)+ RNA
from rat tissues.
Poly(A)+ RNA (mRNA) was purified
from total RNA through oligo(dT)-cellulose affinity chromatography.
Samples of mRNA (20 µg) were first size separated by electrophoresis
in agarose (1.5%) and then transferred and covalently fixed to
Zeta-probe membranes as previously described (18). The 617-bp cDNA
fragment obtained by RT-PCR amplification of the rat submaxillary gland
RNA (see above) was used to probe the Northern blot. This probe was
purified by extraction from agarose gel and labeled by random priming
in the presence of
[
-32P]dCTP. The
Northern blot was prehybridized, hybridized overnight in the presence
of the labeled probe (3 × 106 cpm/ml), washed under high
stringency, and autoradiographed by exposure to Amersham Hyperfilm
using two intensifying screens at
80°C as described
previously (18). To test for the integrity of the
poly(A)+ RNA preparations from the
different rat tissues, Northern blot analysis for
-actin mRNA was
carried out with a 1150-bp fragment of the mouse
-actin cDNA in a
manner similar to that described above.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
As stated in the introduction, the presence of EGF as well as its mRNA in lacrimal gland tissues and the presence of EGF in tears were recently documented. Moreover, it is now known that EGF mRNA encodes a high-molecular-mass precursor molecule from which EGF may be released by proteolytic cleavage. EGF may be present as a part of the extracellular portion of the transmembrane precursor (as in the kidney), or this precursor could be fully and intracellularly processed into EGF (as in the submaxillary gland). Until now, despite the demonstration of the presence of an EGF immunoreactivity in some lacrimal gland tissues, little attention has been given to the identification of the molecular form present in such tissues. The following experiments were thus performed with the rat exorbital lacrimal gland to answer this question. We first used the highly sensitive technique of RT-PCR, in conjunction with specific oligonucleotide primers for the rEGF, to investigate the expression of the EGF mRNA in the lacrimal gland and for comparison with other rat tissues.
RT-PCR analysis of the tissue expression of EGF mRNA.
As a control for the integrity of the RNA that serves as substrate for
the RT-PCR analysis, agarose gel electrophoresis was performed, and the
RNA was visualized with ethidium bromide under UV illumination (data
not shown, but see Ref. 18). Equal amounts of highly preserved RNA
appear to be present in the fractions. These RNAs were first reverse
transcribed into cDNA and then amplified by PCR using specific sense
and antisense primers deduced from the sequence of the rEGF precursor
(34). Amplification primers were chosen to amplify a region of the
precursor mRNA (nt 3084-3700) that overlaps the sequence encoding
the EGF molecule (nt 3308-3466) (Fig.
1A). A
single amplified product of the expected size (617 bp) was visible on
an ethidium bromide-stained agarose gel (Fig. 1B). Strong signals were obtained
with RNA from the submaxillary gland, lacrimal gland, and lacrimal
acinar cells, as well as from kidney. Weaker signals were observed with
both parotid and liver RNA, and no amplification signals were seen with
brain and heart RNA. Moreover, no amplification products could be
detected when the RNA template was omitted from the reaction (control)
or when the amplification was performed with non-reverse-transcribed
RNA (data not shown). These results show first that RNA templates were necessary to observe the amplification product and second that this product originates from mRNA rather than from potentially contaminating genomic DNA.
|
mRNA in brain and of HB-EGF mRNA
in both brain and heart RNA populations (data not shown). The absence
of EGF transcripts in the rat brain is in agreement with the previous
demonstration that the rat brain does not contain any detectable irEGF
(32).
The demonstration of the presence of EGF mRNA by RT-PCR in the rat
exorbital lacrimal gland confirms the results obtained with human (52)
and mouse (14) lacrimal tissues. The intensity of the amplification
signal in both lacrimal gland and acinar cell RNA preparations,
compared with the submaxillary gland and kidney, suggests that they may
contain relatively high amounts of EGF mRNA. However, because of the
high sensitivity of the technique, it is known that quantification of a
specific transcript as well as comparison from tissue to tissue by
RT-PCR is rather difficult. Thus, to have a better estimation of the
relative amounts of EGF mRNA and to determine the size of the
transcript, we decided to analyze the
poly(A)+ RNA from several rat
tissues, i.e., submaxillary and lacrimal glands, lacrimal acinar cells,
liver, brain, and kidney, by Northern blot.
Northern blot analysis of
poly(A)+ RNA.
The 617-bp PCR product was used as a probe after
32P labeling by random priming.
Northern blots were hybridized with the labeled probe and washed under
high-stringency conditions as described in MATERIALS
AND METHODS. Hybridization revealed one specific 5-kb
transcript in our control tissues, i.e., in submaxillary gland and
kidney as well as in lacrimal and liver preparations (Fig.
2A). The
size of this transcript is close to that of the prepro-EGF mRNA
identified by Northern blot in mouse kidney and submaxillary gland (14)
and only slightly longer than the rat prepro-EGF cDNA (4801 bp) cloned
from rat kidney (34). This Northern blot analysis clearly shows that
the lacrimal gland contains significant amounts of prepro-EGF
transcript. The tissue content could be estimated to be about one-tenth
of that present in both submaxillary gland and kidney. Contrary to the
results of Kasayama et al. (14) obtained with mouse tissues, we did not
find any difference in the size of the transcript between the lacrimal gland and kidney.
|
-actin shows an intense and nearly equal hybridization signal (Fig.
2B). This confirms the integrity of
the different mRNA preparations and indicates that the variations in
EGF mRNA signals observed between the different rat organs are not the
consequence of either mRNA degradation or important variations in the
mRNA loading.
Taken together, these results indicate that the RT-PCR amplification
product observed with lacrimal gland and lacrimal acinar cell
preparations presumably reflects the presence of mRNA encoding prepro-EGF. Thus the following experiments were designed to determine whether translation of this mRNA in the rat lacrimal gland results in
the presence of the entire membrane-associated EGF precursor protein or
of a fully processed and soluble low-molecular-mass EGF molecule.
Assay of EGF-related molecules in soluble fractions from
submaxillary gland, lacrimal gland, and kidney by RRA.
The next experiments were designed to determine the presence of EGF or
EGF-related molecules in the rat lacrimal gland. We first looked for
the presence of soluble EGFR binding proteins in the soluble fractions
from control tissues, i.e., submaxillary gland and kidney, and compared
the results with those of the lacrimal gland. In these experiments,
serial dilutions of the soluble fractions from the different tissues
were tested for their ability to compete with
125I-rEGF for binding to the rat
liver EGFR. As can be seen in Fig. 3, all
three soluble fractions compete with
125I-rEGF for binding to the EGFR
and show displacement curves parallel to that of purified rEGF.
Comparison of these curves with that of standard EGF allowed an
estimation of the amounts of EGF-like molecules present in the
different tissues. As could be predicted, submaxillary glands contain
the highest amount of soluble EGF-like activity (5,700 pg/mg tissue),
whereas kidney (340 pg/mg tissue) and lacrimal glands (200 pg/mg
tissue) contain lower and comparable activities. Taking into account
our knowledge that EGF is not the only EGFR binding molecule, these
results only indicate that the lacrimal gland contains soluble
EGF-related activities. EGF might be only one of these activities,
since TGF-
has been demonstrated to be present in the rat lacrimal
gland (47) and since we have recently identified both TGF-
and
HB-EGF transcripts in addition to EGF in the same tissue by RT-PCR
(data not shown). Thus the determination of the specific contribution
of EGF in this EGFR binding activity requires development of a specific
and sensitive RIA for rEGF.
|
RIA for rEGF.
Polyclonal antibodies were produced by immunizing rabbits against a
purified and native preparation of rat submaxillary gland EGF (rEGF).
The IgG fraction of the antiserum containing the highest titer was
purified through protein A-Sepharose chromatography as described in
MATERIALS AND METHODS. An RIA was thus
developed using 125I-rEGF and the
anti-rEGF antiserum rEGF2. As
shown in Fig. 4, for an antibody dilution
of 1:5,000, rEGF inhibits >95% of
125I-rEGF binding, with a
half-maximal inhibition at an rEGF concentration between 0.1 and 0.2 nM. These experimental conditions allowed the detection of 60 pg/assay
of rEGF. This antibody is highly selective for rEGF. Although mEGF has
very high sequence homology (79%) with rEGF, 100 times more of this
growth factor is required for comparable displacement. Moreover, mEGF
displaced 125I-rEGF in a
nonparallel fashion compared with rEGF, indicating the nonidentity of
the antigenic determinants. The antibody
rEGF2 only weakly recognized hEGF,
despite its 67% homology with rEGF, and did not recognize rat TGF-
(35% homology) at concentrations as high as 100 nM. Taken together,
these results show that this antibody directed against native rEGF
clearly cross-reacts with closely related molecules as a function of
their sequence homology with rEGF. These results are in striking
opposition to those obtained with RRA experiments in which we observed
that all these molecules compete with equal potency when binding to the
EGFR (data not shown).
|
, which has been shown to be present in the rat lacrimal
gland (47), shows the highest homology with EGF in the family of EGFR
binding growth factors, it is clear that the rEGF2 antibody that did not bind
TGF-
can be used to specifically identify EGF in this tissue. The
other advantage of RIA vs. RRA is that it allows the measurement of EGF
or EGF-containing molecules in both soluble fractions and membrane
preparations solubilized in the presence of detergents. This was the
subject of the following experiments.
Assay of EGF in soluble fractions from submaxillary gland, lacrimal gland, and kidney by RIA. To measure the level of irEGF in the soluble fractions from the different tissues, serial dilutions were assessed for their ability to compete with 125I-rEGF in binding to the rEGF2 antibody. As was proposed by Schaudies et al. (36), to detect the presence of EGF-containing molecules (precursor) that may have antigenic properties different from those of mature rEGF, samples of lacrimal gland and kidney were tested both before and after tryptic digestion as described in MATERIALS AND METHODS. Mature EGF is insensitive to trypsin (38), and tryptic digestion of EGF precursor molecules releases EGF in a form that is both immunologically and biologically indistinguishable from mature EGF (Ref. 36 and see Fig. 7).
As is shown in Fig. 5, soluble extracts of submaxillary gland fully compete with 125I-rEGF in binding to the rEGF2 antibody. This immunoreactive material competes with 125I-rEGF in a manner parallel to rEGF. The displacement curve is unaffected by previous tryptic digestion of the sample (data not shown), suggesting that it is composed of mature soluble EGF. Calculation of the amount of EGF in this fraction gave a value of 5,200 pg/mg of tissue. This value is only slightly less than the one determined by the RRA experiments (5,700 pg/mg). As could be predicted, this indicates that EGF makes up most of the soluble EGFR binding activity in the submaxillary gland.
|
and/or HB-EGF may be part of this activity,
since TGF-
has been demonstrated to be present in the rat lacrimal
gland (47) and since we have recently identified both TGF-
and
HB-EGF transcripts in addition to EGF in the same tissue by RT-PCR
(data not shown). These observations are discrepant with previously
published results showing the presence of soluble mature EGF in both
mouse (14) and rat (50) lacrimal tissues and will be discussed below in
view of the following experiments.
Because we were unable to detect soluble mature EGF in the rat lacrimal
gland, the following experiments were performed to search for the
presence of its membrane-associated precursor.
Assay of EGF in solubilized membrane fractions from lacrimal gland
and kidney by RIA.
Membrane fractions from both the lacrimal gland and kidney were
prepared and solubilized in a Triton-containing buffer. Serial dilutions of Triton-solubilized membranes were then tested for the
presence of immunoreactive EGF both before and after trypsin hydrolysis
as described above. As can be seen in Fig.
6, samples from both tissues only poorly
(lacrimal gland) or moderately (kidney) compete with
125I-rEGF for binding to the
rEGF2 antibody. The displacement
curves generated by the Triton-solubilized membranes were not parallel to the curve obtained with purified rEGF, indicating the nonidentity of
the immunoreactive materials. As discussed above for the soluble fractions, tryptic digestion of the sample was used to test for the
presence of EGF precursor in the Triton X-100 extracts. As can be seen
in Fig. 6, trypsin hydrolysis of both lacrimal gland and
kidney results in a dramatic increase in the ability of the samples to
compete for binding to the antibody. Opposite to what was observed with
the untreated samples, the trypsin-treated samples generated
displacement curves that were parallel to the standard curve, thus
suggesting the generation of mature irEGF from precursor molecules.
After trypsin hydrolysis, the level of irEGF detected rose from 1.6 to
25.7 pg/mg of tissue in the lacrimal gland and from 9.5 to 110 pg/mg of
tissue in the kidney. As stated above, it is now known that the rat
kidney contains membrane-associated EGF precursor molecules (37). Thus,
by analogy with the kidney, the presence of the trypsin-sensitive
EGF-containing molecules in the Triton-solubilized membrane fraction
from the rat lacrimal gland strongly suggests the existence of
membrane-associated EGF precursor molecules in this tissue.
|
Characterization of the detergent-extracted membrane-associated EGF
precursor molecules by size exclusion chromatography.
The following experiments were performed to determine the size of the
EGF-containing molecules that generate immunoreactive EGF on trypsin
treatment as well as the size of the material released by trypsin.
Triton-solubilized membrane fractions from both the kidney (Fig.
7, A and
C) and the lacrimal gland (Fig. 7,
B and D) were analyzed by size exclusion
chromatography either on Sephacryl S-200 (Fig. 7,
A and
B) or Bio-Gel P-10 (Fig. 7,
C and
D) as described in
MATERIALS AND METHODS.
|
Immunoprecipitation and Western blot analysis of the detergent-extracted membrane-associated EGF precursor molecules. The above size exclusion chromatographic analysis of the detergent-solubilized membrane-associated EGF immunoreactivity only provided rough estimates of the EGF precursor(s) molecular mass(es). So we tried to obtain more accurate values by using an antibody (ppEGF1) raised against a synthetic peptide (p437) that corresponds to a sequence of the rat prepro-EGF that is predicted to be located in its intracellular juxtamembrane domain. Because of the location of this antigenic determinant, ppEGF1 antibody is postulated to identify only membrane-associated precursor molecules.
Triton-solubilized membrane fractions from the kidney and lacrimal gland were first immunoprecipitated in the absence or presence of the antibody ppEGF1. The specificity of the immunoprecipitation was assessed by performing the incubation with ppEGF1 in the absence or presence of a saturating concentration of the peptide p437, as described in MATERIALS AND METHODS. Immunoprecipitates were subsequently analyzed by Western blot using the ppEGF1 antibody. As shown in Fig. 8, the immmunoprecipitate from the rat lacrimal gland membrane fraction appears to contain only one specific immunoreactive protein with an apparent molecular mass of 152 kDa. This protein is also present in the immunoprecipitate from the kidney membrane, together with three other proteins with apparent molecular masses of 115, 97, and 75 kDa. A final demonstration that these are EGF precursor molecules would necessitate the demonstration that they also contain the sequence of EGF. Unfortunately, our anti-rat EGF antibody (rEGF2) and most of the anti-native EGF antibodies do not efficiently recognize denatured EGF and cannot be used in Western blot analysis. However, indirect evidence that EGF is present in both kidney and lacrimal gland ppEGF2 immunoprecipitates has been obtained in parallel experiments. The protein A-Sepharose-recovered ppEGF2 immunoprecipitates from both tissues were first incubated in the presence of trypsin. The incubation media (protein A-Sepharose supernatants) were subsequently analyzed by RIA for the presence of EGF immunoreactivity using the rEGF2 antibody. Both kidney and lacrimal gland immunoprecipitates were shown to contain trypsin-released immunoreactive EGF. The specificity of these results was further confirmed by showing that the addition of p437 during the immunoprecipitation phase completely precluded the detection of this EGF immunoreactivity (data not shown).
|
precursor molecule is rapidly cleaved in its
NH2-terminal proregion, releasing
all the glycosylated part of the molecule and leaving TGF-
membrane
anchored. The release of mature soluble TGF-
by the cleavage of the
resulting, lower-molecular-mass, TGF-
-containing, membrane-anchored
form is a highly regulated process (28, 29). In the case of
amphiregulin, cleavage of the precursor led to the generation of a
predominant 43-kDa soluble form that may retain the full-length
NH2-terminal proregion (4). The
release of this proamphiregulin ectodomain was also shown to be
regulated (4).
If we look at EGF, it is clear that tissues such as submaxillary glands
from rodents fully and intracellularly process pro-EGF into mature
6-kDa EGF that is secreted through regulated exocytosis (6, 31, 33,
39). However, as suggested from in vivo studies performed with urine
and milk (16, 17, 21, 30), the predominant EGF species released from
most epithelial cells appears to be a high-molecular-mass, 160-kDa
form. Moreover, both NIH/3T3 cells (23) and Madin-Darby canine
kidney cells (9) stably transfected with the human pro-EGF
cDNA have demonstrated that membrane-associated pro-EGF is only present
as a single high-molecular-mass precursor that is proteolytically
cleaved to release a high-molecular-mass, soluble 160-kDa EGF form,
without any evidence for the generation of mature 6-kDa EGF. From these
observations, it seems that our results with the rat lacrimal gland
greatly resemble those obtained with in vitro transfected cells. If the
comparison can be further extended, we may suggest that the primary
product secreted by this gland would also be high-molecular-mass EGF.
This high-molecular-mass (trypsin-sensitive) soluble pro-EGF, which
would be present in the extracellular tissue medium, was not observed
in the course of our study. This may be the result of a low rate of
precursor cleavage at the distal site and/or rapid wash-out of
the extracellular tissue medium before tissue processing. Both of these
phenomena would contribute to the lowering of the steady-state level of soluble immunoreactive EGF below the RIA threshold. It is clear that
further studies using immunoprecipitation experiments after metabolic
labeling of the tissue as well as kinetic analysis of the secretory
product(s) are needed to test this hypothesis. However, we can propose
a model for the action of this secreted pro-EGF. As stated in the
introduction, tear EGF at the ocular surface has been reported to be
present as the 6-kDa growth factor (27, 45, 50) that is suggested to be
involved at least in the regulation of corneal wound healing (5, 35,
51). We recently observed that plasmin, a serine protease that is also
present in tears at elevated levels in some corneal diseases (7, 43,
44), was able to fully process the membrane-anchored pro-EGF into the mature soluble 6-kDa EGF (20a). So we propose that
soluble high-molecular-mass pro-EGF present in the aqueous flow coming
from the lacrimal gland could be matured into the well-known 6-kDa
growth factor only when reaching the ocular surface. Under these
conditions, a detectable amount of soluble pro-EGF could be present in
tears, a question that has never been addressed to our knowledge. This
does not mean that the only role of the pro-EGF soluble form would be
to produce the 6-kDa growth factor. Indeed, soluble pro-EGF forms have
been reported to bind and activate the EGFR (2, 22, 21, 30, 36, 37),
but the question remains as to whether it is their only function and,
if so, whether they induce exactly the same cellular response.
In conclusion, this study demonstrates the transcription of the EGF
precursor gene in the rat exorbital lacrimal gland. The soluble,
mature, low-molecular-mass form of EGF was undetectable in this tissue.
However, as in the kidney, EGF is present in the form of its
membrane-associated high-molecular-mass (152 kDa) precursor. Because we
have detected relatively high amounts of EGFR binding activity in the
soluble fraction from the rat lacrimal gland, this could indicate that
other growth factors of the EGF family are present in this tissue. In
these conditions, the EGF-like immunoreactivity previously detected and
localized in the duct cells of the rat exorbital lacrimal gland (48,
50) could represent either some immunoreactivity cross-reacting with
one of these soluble growth factors or the detection of the
EGF-containing membrane-associated precursor protein.
Location of the site(s) of synthesis of the EGF precursor mRNA and
protein in the rat lacrimal gland, by both in situ hybridization and
immunohistochemistry, and investigation of the way(s) by which EGF
could be released from its precursor into tears are now required.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Jocelyne Dujancourt for skillful and expert technical assistance and Sarah Tite for reading the manuscript.
| |
FOOTNOTES |
|---|
This work was supported by the Centre National de la Recherche Scientifique (UMR 5619), France.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: P. Mauduit, Laboratoire de Biochimie des Transports Cellulaires, CNRS, UMR 5619, Bat. 432, Université Paris-Sud, 91405 Orsay Cedex, France.
Received 9 July 1998; accepted in final form 1 December 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bell, G. I.,
N. M. Fong,
M. M. Stempien,
M. A. Wormsted,
D. Caput,
L. Ku,
M. S. Urdea,
L. B. Rall,
and
R. Sanchez-Pescador.
Human epidermal growth factor precursors: cDNA sequence, expression in vitro and gene organization.
Nucleic Acids Res.
14:
8427-8444,
1986
2.
Breyer, J. A.,
and
S. Cohen.
The epidermal growth factor precursor isolated from murine kidney membranes.
J. Biol. Chem.
265:
16564-16570,
1990
3.
Brown, C. F.,
C. T. Teng,
B. T. Pencost,
and
R. P. Diaugustine.
Epidermal growth factor precursor in mouse lactating mammary gland alveolar cells.
Mol. Endocrinol.
3:
1077-1083,
1989
4.
Brown, C. L.,
K. S. Meise,
G. D. Plowman,
R. J. Coffey,
and
P. J. Dempsey.
Cell surface ectodomain cleavage of human amphiregulin precursor is sensitive to a metalloprotease inhibitor. Release of a predominant N-glycosylated 43-kDa soluble form.
J. Biol. Chem.
273:
17258-17268,
1998
5.
Burstein, N. L.
Growth factor effects on corneal wound healing.
J. Pharmacol.
1:
263-277,
1987.
6.
Byyny, R. L.,
D. N. Orth,
S. Cohen,
and
E. S. Doyne.
Epidermal growth factor: effects of androgens and adrenergic agents.
Endocrinology
95:
776-782,
1974
7.
Cejkova, J.,
Z. Lojda,
S. Dropcova,
and
D. Kadlecova.
The histochemical pattern of mechanically or chemically injured rabbit cornea after aprotinin treatment: relationships with the plasmin concentration of the tear fluid.
Histochem. J.
25:
438-445,
1993[Medline].
8.
Dartt, D. A.
Regulation of inositol phosphates, calcium and protein kinase C in the lacrimal gland.
Prog. Retinal Eye Res.
13:
443-478,
1994.
9.
Dempsey, P. J.,
K. S. Meise,
Y. Toshitake,
K. Nishikawa,
and
R. J. Coffey.
Apical enrichment of human EGF precursor in Madin-Darby canine kidney cells involves preferential basolateral ectodomain cleavage sensitive to a metalloprotease inhibitor.
J. Cell Biol.
138:
747-758,
1997
10.
Fantl, W. J.,
D. E. Johnson,
and
L. T. Williams.
Signalling by receptor tyrosine kinases.
Annu. Rev. Biochem.
62:
453-481,
1993[Medline].
11.
Gray, A.,
T. J. Dull,
and
A. Ullrich.
Nucleotide sequence of epidermal growth factor cDNA predicts a 128,000 molecular weight protein precursor.
Nature
303:
722-725,
1993.
12.
Jorgensen, P. E.,
E. Nexo,
and
S. S. Poulsen.
The membrane fraction of homogenized rat kidney contains an enzyme that releases epidermal growth factor from the kidney membranes.
Biochim. Biophys. Acta
1074:
284-288,
1991[Medline].
13.
Journe, F.,
R. Wattiez,
A. Piron,
M. Carion,
G. Laurent,
J. Heuson-Stiennon,
and
P. Falmagne.
Renal epidermal growth factor precursor: proteolytic processing in an in vitro cell-free system.
Biochim. Biophys. Acta
1357:
18-30,
1997[Medline].
14.
Kasayama, S.,
Y. Ohba,
and
T. Oka.
Expression of epidermal growth factor gene in mouse lacrimal gland: comparison with that in the submandibular gland and kidney.
J. Mol. Endocrinol.
4:
31-36,
1990
15.
Laksmanan, J.,
and
D. A. Fisher.
An inborn error in epidermal growth factor prohormone metabolism in a mouse model of autosomal recessive polycystic kidney disease.
Biochem. Biophys. Res. Commun.
196:
892-901,
1993[Medline].
16.
Lakshmanan, J.,
E. Salido,
R. Lam,
L. Barajas,
and
D. A. Fisher.
Identification of pro-epidermal growth factor and high molecular weight epidermal growth factors in adult mouse urine.
Biochem. Biophys. Res. Commun.
173:
902-911,
1990[Medline].
17.
Lakshmanan, J.,
E. Salido,
R. Lam,
and
D. A. Fisher.
Epidermal growth factor prohormone is secreted in human urine.
Am. J. Physiol.
263 (Endocrinol. Metab. 26):
E142-E150,
1992
18.
Maréchal, H.,
H. Jammes,
B. Rossignol,
and
P. Mauduit.
EGF receptor mRNA and protein in rat lacrimal acinar cells: evidence of its EGF-dependent phosphotyrosilation.
Am. J. Physiol.
270 (Cell Physiol. 39):
C1164-C1174,
1996
19.
Massagué, J.,
and
A. Pandiella.
Membrane-anchored growth factors.
Annu. Rev. Biochem.
62:
515-541,
1993[Medline].
20.
Mauduit, P.,
H. Jammes,
and
B. Rossignol.
M3 muscarinic acetylcholine receptor coupling to PLC in rat exorbital lacrimal acinar cells.
Am. J. Physiol.
264 (Cell Physiol. 33):
C1550-C1560,
1993
20a.
Mauduit, P.,
H. Maréchal,
G. Van Setten,
and
B. Rossignol.
Plasmin release of EGF from its membrane associated precursor (Abstract). Proc. Int. Congr. Exp. Eye Res. XIII Paris, 1998, vol. 67, p. S57.
21.
Mroczkowski, B.,
and
M. Reich.
Identification of biologically active epidermal growth factor precursor in human fluids and secretions.
Endocrinology
132:
417-425,
1993
22.
Mroczkowski, B.,
M. Reich,
K. Chen,
G. I. Bell,
and
S. Cohen.
Recombinant human epidermal growth factor is a glycosylated membrane protein with biological activity.
Mol. Cell. Biol.
9:
2771-2778,
1989
23.
Mroczkowski, B.,
M. Reich,
J. Whittaker,
G. I. Bell,
and
S. Cohen.
Expression of human epidermal growth factor precursor cDNA in transfected mouse NIH 3T3 cells.
Proc. Natl. Acad. Sci. USA
85:
126-130,
1988
24.
Mullhaupt, B.,
A. Feren,
E. Fodor,
and
A. Jones.
Liver expression of epidermal growth factor RNA.
J. Biol. Chem.
269:
19667-19670,
1994
25.
Nexo, E.,
P. E. Jorgensen,
L. Thim,
and
P. Roepstorff.
Purification and characterization of a low and high molecular weight form of epidermal growth factor from rat urine.
Biochim. Biophys. Acta
1037:
388-393,
1990[Medline].
26.
Obata, H.,
H. Horiuchi,
Y. Dobashi,
T. Oka,
M. Sawa,
and
R. Machinami.
Immunohistochemical localization of epidermal growth factor in human main and accessory lacrimal glands.
Jpn. J. Ophthalmol.
37:
113-121,
1993[Medline].
27.
Ohashi, Y.,
M. Motokura,
Y. Kinoshita,
T. Mano,
H. Watanabe,
S. Kinoshita,
R. Manabe,
K. Oshiden,
and
C. Yanaihara.
Presence of epidermal growth factor in human tears.
Invest. Ophthalmol. Vis. Sci.
30:
1879-1882,
1989[Abstract].
28.
Pandiella, A.,
and
J. Massague.
Cleavage of the membrane precursor for transforming growth factor
is a regulated process.
Proc. Natl. Acad. Sci. USA
88:
1726-1730,
1991
29.
Pandiella, A.,
and
J. Massague.
Multiple signals activate cleavage of the membrane transforming growth factor-
precursor.
J. Biol. Chem.
266:
5769-5773,
1991
30.
Parries, G.,
K. Chen,
K. Misono,
and
S. Cohen.
The human urinary epidermal growth factor (EGF) precursor. Isolation of a biologically active 160-kilodalton heparin-binding pro-EGF with a truncated carboxyl terminus.
J. Biol. Chem.
270:
27954-27960,
1995
31.
Pasquini, F.,
G. Anna Petris,
R. Sbaraglia,
R. Scopelliti,
G. Cengi,
and
L. Frati.
Biological activities in the granules isolated from the mouse submaxillary gland.
Exp. Cell Res.
86:
233-236,
1974[Medline].
32.
Probstmeier, R.,
and
M. Schachner.
Epidermal growth factor is not detectable in developing and adult rodent brain by a sensitive double site enzyme immunoassay.
Neurosci. Lett.
63:
290-294,
1986[Medline].
33.
Rall, L. B.,
J. Scott,
J. R. Crawford,
D. Penschow,
H. D. Niall,
J. P. Coghlan,
and
G. I. Bell.
Mouse prepro-epidermal growth factor synthesis by the kidney and other tissues.
Nature
313:
228-231,
1985[Medline].
34.
Saggi, S. J.,
R. Safirstein,
and
P. M. Price.
Cloning and sequencing of the rat preproepidermal growth factor cDNA: comparison with mouse and human sequences.
DNA Cell Biol.
11:
481-487,
1992[Medline].
35.
Savage, C. R.,
and
S. Cohen.
Proliferation of corneal epithelium induced by epidermal growth factor.
Exp. Eye Res.
15:
361-366,
1973[Medline].
36.
Schaudies, R. P.,
J. Grimes,
H. L. Wray,
and
O. Koldovsky.
Identification and partial characterization of multiple forms of biologically active EGF in rat milk.
Am. J. Physiol.
259 (Gastrointest. Liver Physiol. 22):
G1056-G1061,
1990
37.
Schaudies, R. P.,
and
J. P. Johnson.
Increased soluble EGF after ischemia is accompanied by a decrease in membrane-associated precursors.
Am. J. Physiol.
264 (Renal Fluid Electrolyte Physiol. 33):
F523-F531,
1993
38.
Schaudies, R. P.,
and
C. R. Savage.
Isolation of rat epidermal growth factor: chemical, biological and immunological comparisons with mouse and human EGF.
Comp. Biochem. Physiol. B Biochem. Mol. Biol.
84:
497-505,
1986.
39.
Scott, J.,
S. Patterson,
L. Rall,
G. I. Bell,
R. Crawford,
J. Penschow,
H. Niall,
and
J. Coghlan.
The structure and biosynthesis of epidermal growth factor precursor.
J. Cell Sci. Suppl.
3:
19-28,
1985[Medline].
40.
Scott, J.,
M. Urdea,
M. Quiroga,
R. Sanchez-Pescador,
N. Fong,
M. Selby,
W. J. Rutter,
and
G. I. Bell.
Structure of a mouse submaxillary messenger RNA encoding epidermal growth factor and seven related proteins.
Science
221:
236-240,
1983
41.
Simpson, R. J.,
J. A. Smith,
R. L. Moritz,
M. J. O'Hare,
P. S. Rudland,
J. R. Morrison,
C. J. Lloyd,
B. Greco,
A. W. Burgess,
and
E. C. Nice.
Rat epidermal growth factor: complete amino acid sequence.
Eur. J. Biochem.
153:
629-637,
1985[Medline].
42.
Sullivan, D. A.
Ocular mucosal immunity.
In: Mucosal Immunology, edited by P. L. Ogra,
J. Mestecky,
M. E. Lamm,
W. Strober,
J. McGhee,
and J. Bienenstock. Orlando, FL: Academic, 1994, p. 569-597.
43.
Tervo, T.,
N. Honkanen,
G. B. Van Setten,
T. Virtanen,
A. Tarkkanen,
and
M. Harkonen.
A rapid fluorometric assay for tear fluid plasmin activity.
Cornea
13:
148-155,
1994[Medline].
44.
Tervo, T.,
E. M. Salonen,
A. Vaheri,
I. Immonen,
G. B. Van Setten,
J. Himberg,
and
A. Tarkkanen.
Elevation of tear fluid plasmin in corneal disease.
Acta Ophthalmol. Scand.
66:
393-399,
1988.
45.
Tsutsumi, O.,
A. Tsutsumi,
and
T. Oka.
Epidermal growth factor-like, corneal wound healing substance in mouse tears.
J. Clin. Invest.
81:
1067-1071,
1988.
46.
Van Setten, G. B.
Epidermal growth factor in human tear fluid: increased release but decreased concentration during reflex tearing.
Curr. Eye Res.
9:
79-83,
1990[Medline].
47.
Van Setten, G. B.,
S. Macauley,
M. Humphreys-Beher,
N. Chegini,
and
G. Schultz.
Detection of transforming growth factor alpha mRNA and protein in rat lacrimal glands and characterization of transforming growth factor alpha in human tears.
Invest. Ophthalmol. Vis. Sci.
37:
166-173,
1996
48.
Van Setten, G. B.,
K. Tervo,
I. Virtanen,
A. Tarkkanen,
and
T. Tervo.
Immunohistochemical demonstration of epidermal growth factor in the lacrimal and submandibular glands of rats.
Acta Ophthalmol. Scand.
68:
477-480,
1990.
49.
Van Setten, G. B.,
L. Viinikka,
T. Tervo,
K. Pesonen,
A. Tarkkanen,
and
J. Perheentupa.
Epidermal growth factor is a constant component of normal human tear fluid.
Graefes Arch. Clin. Exp. Ophthalmol.
227:
184-187,
1989[Medline].
50.
Watanabe, H.,
Y. Ohashi,
S. Kinoshita,
R. Manabe,
and
K. Ohsiden.
Distribution of epidermal growth factor in rat ocular and periocular tissues.
Graefes Arch. Clin. Exp. Ophthalmol.
231:
228-232,
1993[Medline].
51.
Wilson, S. E.
Lacrimal gland epidermal growth factor production and the ocular surface.
Am. J. Ophthalmol.
111:
763-765,
1991[Medline].
52.
Wilson, S. E.,
and
S. A. Lloyd.
Epidermal growth factor messenger RNA production in human lacrimal gland.
Cornea
10:
519-524,
1991[Medline].
53.
Yoshino, K.,
D. Monroy,
and
S. C. Pflugfelder.
Cholinergic stimulation of lactoferrin and epidermal growth factor secretion by the human lacrimal gland.
Cornea
15:
617-621,
1996[Medline].
This article has been cited by other articles:
![]() |
V. Tepavcevic, R. R. Hodges, D. Zoukhri, and D. A. Dartt Signal Transduction Pathways Used by EGF to Stimulate Protein Secretion in Rat Lacrimal Gland Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1075 - 1081. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Arango, P. Li, M. Komatsu, C. Montes, C. A. C. Carraway, and K. L. Carraway Production and Localization of Muc4/Sialomucin Complex and Its Receptor Tyrosine Kinase ErbB2 in the Rat Lacrimal Gland Invest. Ophthalmol. Vis. Sci., November 1, 2001; 42(12): 2749 - 2756. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Kömüves, A. Feren, A. L. Jones, and E. Fodor Expression of Epidermal Growth Factor and Its Receptor in Cirrhotic Liver Disease J. Histochem. Cytochem., June 1, 2000; 48(6): 821 - 830. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |