Am J Physiol Cell Physiol AJP: Gastrointestinal and Liver Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 276: C66-C75, 1999;
0363-6143/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Timmer, R. T.
Right arrow Articles by Gunn, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Timmer, R. T.
Right arrow Articles by Gunn, R. B.
Vol. 276, Issue 1, C66-C75, January 1999

Inducible expression of erythrocyte band 3 protein

Richard T. Timmer and Robert B. Gunn

Department of Physiology, Emory University School of Medicine, Atlanta, Georgia 30322-3110

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

A permanent cell line with inducible expression of the human anion exchanger protein 1 (hAE1) was constructed in a derivative of human embryonic kidney cells (HEK-293). In the absence of the inducer, muristerone A, the new cell line had no detectable hAE1 protein by Western analysis or additional 36Cl flux. Increasing dose and incubation time with muristerone A increased the amount of protein (both unglycosylated and glycosylated). The 4,4'-dinitrostilbene-2,2'-disulfonate (DNDS)-inhibitable rapid Cl exchange flux was increased up to 40-fold in induced cells compared with noninduced cells. There was no DNDS-inhibitable rapid flux component in noninduced cells. This result demonstrates inducible expression of a new rapid Cl transport pathway that is DNDS sensitive. The additional transport of 36Cl and 35SO4 had the characteristics of hAE1-mediated transport in erythrocytes: 1) inhibition by 250 µM DNDS, 2) activation of 36Cl efflux by external Cl with a concentration producing half-maximal effect of 4.8 mM, 3) activation of 36Cl efflux by external anions that was selective in the order NO3 = Cl > Br > I, and 4) activation of 35SO4 influx by external protons. Under the assumption that the turnover numbers of hAE1 were the same as in erythrocytes, there was good agreement (±3-fold) between the number of copies of glycosylated hAE1 and the induced tracer fluxes. This is the first expression of hAE1 in a mammalian system to track the kinetic characteristics of the native protein.

anion exchanger 1; chloride transport; ecdysone receptor; HEK-293 cells

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

THE HUMAN ANION EXCHANGE PROTEIN 1 (hAE1) is the major intrinsic protein of the red blood cell membrane and a model for understanding the structure and function of membrane carriers (13, 15, 17). Its physiological function is to mediate the rapid exchange of Cl and HCO3 during the passage of erythrocytes through the peripheral and lung capillaries. In the peripheral capillary, the erythrocytes encounter the increased PCO2 of the tissue. CO2 enters the cell by diffusion and is effectively hydrated by cytoplasmic carbonic anhydrase to form protons and HCO3. This HCO3 product exits the cell on hAE1 in exchange for plasma Cl; thus the plasma Cl concentration in venous plasma is lower than in arterial plasma. The reaction is driven toward completion through the removal of intracellular protons by the buffer, hemoglobin, and the efflux of the HCO3 by hAE1. About two-thirds of the CO2 carried by the blood to the lungs is transported as HCO3 in the plasma after exchange on hAE1 (14). Surprisingly, knockout mice without AE1 (29) and naturally AE1-null bovines (20) can survive, but with tissue acidosis and fragile erythrocytes. hAE1-mediated anion-anion exchange is electrically silent and results in no net current crossing the membrane. This principal function is, therefore, invisible to patch-clamp and microelectrode measurements. The functional expression of hAE1 may only be observed by measuring the flux of tracer anions across the plasma membrane or the net transfer of one anion in exchange for an equivalent amount of another anionic species. This requires that many copies of hAE1 be assayed together. Each human erythrocyte has 106 copies of hAE1 (10, 32).

In previous reports, members of the AE family of proteins from mouse and human have been expressed in different systems, each with some limitations. Native and mutant mouse AE1 and hAE1 have been expressed in Xenopus oocytes injected with cRNA (1, 3, 5, 6, 12) and in HEK-293 cells (24) by transient transfection, and hAE1 has been expressed in insect Sf9 cells (7) and yeast (11, 31) by transformation. Functional hAE1 would be expected to bring Cl, HCO3, and thus protons toward electrochemical equilibrium and thus acidify the cytoplasm and kill cells with normal negative membrane potentials. This may be why we have been unable to make a permanent cell line that constitutively expressed hAE1. We report here on an expression system in a permanent cell line, 293-hAE1-wt, that we have made that is derived from EcR293 cells, a cell line itself derived from human embryonic kidney cells (HEK-293). In this cell line, expression of hAE1 is under the control of an inducible promoter element. The transcription of hAE1 from this promoter is activated by muristerone A (2beta ,3beta ,5beta ,11alpha ,14alpha ,20R,22R-heptahydroxycholest-7-en-6-one), which is a lipophilic plant and insect hormone that binds and activates a heterodimeric hormone receptor consisting of the ecdysone receptor and retinoid X receptor (28). We show that the promoter control was very tight and that no hAE1 was produced in the absence of inducer. This allowed the cell line with this construct, 293-hAE1-wt, to be passaged in culture in the absence of inducer for up to 5 mo without loss of inducibility and without the deleterious effects of functional hAE1.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Materials. The cDNA construct (pBS-hAE1) containing hAE1 was a kind gift of Dr. Ron R. Kopito (Stanford University, Palo Alto, CA). All chemicals were reagent grade or better and were obtained from either Fisher Scientific (Norcross, GA) or Sigma Chemical (St. Louis, MO). Peptide N-glycosidase F was purchased from New England Biolabs. Plasmids were endotoxin free and were purified using reagents from Qiagen (Chatsworth, CA). Muristerone A, Zeocin, and the pIND expression vector were purchased from Invitrogen (Carlsbad, CA). Ecdysone and 20-hydroxyecdysone (ecdysterone) were purchased from Sigma. Isotopes were purchased from DuPont NEN (Boston, MA).

Construction of hAE1 expression plasmid. The hAE1 cDNA construct (pBS-hAE1) contained the coding region for hAE1, as well as 56 bp of 5' untranslated region (UTR) and 623 bp of 3' UTR ligated into the Sac I site of pBS KS(-). In addition, this plasmid contained 180 bp of DNA of unknown origin between the Sac I cloning site and the Kpn I site of the multiple cloning site. Site-directed mutagenesis (9) was carried out on pBS-hAE1 to create a coding region cassette by introducing the following mutations into the hAE1 cDNA: 1) a Pml I site immediately preceding the initiation codon at the 5' end of the cDNA, 2) a second Pml I site immediately following the termination codon at the 3' end of the cDNA, and 3) replacement of the native TGA termination codon with a TAA termination codon. The sequences of the oligodeoxyribonucleotides used for mutagenesis are as follows: 1) CAACTGGACACTCAG<UNL><IT>CACGTG</IT></UNL>GCC<UNL>ATG</UNL>GAGGAGCTGCAG and 2) GAAGTGGCCATGCCTGTGTAAGG<UNL><IT>CACGTG</IT></UNL>CCCAGGCCCTAGACCCTCC. In the above sequences, the initiation codon is indicated by underlining, the termination codon is indicated by italics, and the Pml I sites are indicated by italics and underlining. The plasmid containing the Pml I sites in the hAE1 cDNA was sequenced by the dideoxy method (30) and designated pBS-hAE1-Pml. This plasmid was treated with Pml I, and the 2747-bp fragment was gel isolated using standard methods. This fragment contains the coding region of hAE1 with six nucleotides 5' to the initiation codon and five nucleotides 3' to the termination codon. We do not know whether this removal of the 5' or 3' UTR of the native hAE1 cDNA affects the expression of hAE1 in this system. The presence of the native 5' and 3' UTR of hAE1 does decrease expression in Xenopus oocytes (Timmer and Gunn, unpublished observations). The alteration of the native stop codon to TAA probably does not affect expression in this system; however, this change was made to permit expression in a variety of expression systems, including Dictyostelium discoideum. The expression vector used in these experiments, pIND, contained a multiple cloning site flanked by an inducible promoter element (see introduction for description) and the bovine growth hormone transcriptional terminator. The plasmid pIND was treated with EcoR V in the presence of the Klenow fragment of DNA polymerase I and deoxyribonucleotides, followed by treatment with calf intestinal alkaline phosphatase, and the linearized vector was gel isolated. Ligation of the hAE1 coding region with linearized pIND yielded a construct, pIND-hAE1, in which the hAE1 coding region was in one of two possible orientations with respect to the transcriptional promoter. The correct (sense) orientation was determined by restriction analysis of pIND-hAE1 using BamH I, which yields two characteristic fragments (sense orientation, 587 and 7184 bp; antisense orientation, 2220 and 5551 bp).

Cell culture, isolation of stable cell lines, and induction of hAE1 expression. EcR293 cells are a permanent cell line derived from HEK-293 cells that constitutively express a modified form of the ecdysone receptor and the human retinoic acid receptor (28) and were obtained from Invitrogen. The cells were grown as monolayers in T75 culture flasks in MEM with Hanks' salts and supplemented with L-glutamine, 5% FCS, and 2.5 µM Zeocin (Invitrogen) at 37°C in 5% CO2-95% air. After isolation of clonal populations of cells, the ability of cells to express hAE1 in response to induction with muristerone A was assessed by Western analysis of cell lysates following 48 h of induction with 2.5 µM muristerone A. We found that ~10% of the clones, which were all Zeocin resistant, were also capable of expressing hAE1 after induction. This frequency of expression is not surprising given that there is no positive selection for the ability to express the protein of interest, only the ability to survive in the presence of Zeocin. Thus integration into the chromosomal DNA must preserve the integrity of the resistance gene but not the cDNA for the heterologously expressed protein. Transfection of these cells was carried out using standard calcium phosphate precipitation methods as described previously (33).

Peptide synthesis and production of antibodies. A peptide corresponding to the carboxy-terminal residues 887-911 (ADDAKATFDEEEGRDEYDEVPMPV) was synthesized and purified by reverse-phase HPLC (Emory University Microchemical Facility, Winship Cancer Center). An additional cysteine was added to the amino terminus of the peptide to permit conjugation of the peptide to the carrier protein [keyhole limpet hemocyanin (KLH)] with sulfosuccinimidyl 4-[N-maleimidomethyl]-cyclohexane-1-carboxylate (Pierce Chemical, Rockford, IL). The preparation and purification of the peptide-KLH conjugate has been previously described (33). Production of peptide antiserum was as previously described (33) and was carried out according to standard protocols at Lampire Biological Laboratories (Pipersville, PA). Three rabbits were immunized, and positive antisera were obtained from all three animals. The preimmune and positive antisera were designated by the animal identification number (4990, 4991, and 4992). In these experiments, antiserum 4990 was used at a dilution of 1:1,000 in PBS.

Western analysis of glycosylated and deglycosylated protein. Preparation of cell extracts, SDS-PAGE, electrophoretic transfer to nitrocellulose, and immunodetection were carried out as previously described (33). In some experiments, the protein samples were enzymatically deglycosylated with peptide N-glycosidase F before SDS-PAGE. Briefly, 25 µg (10-20 µl) of total protein in lysis buffer was diluted to a volume of 45 µl, followed by addition of 5 µl of a solution containing 5% (wt/vol) SDS and 10% (vol/vol) beta -mercaptoethanol. The sample was heated at 100°C for 10 min and then cooled in a 37°C water bath. To the cooled solution were added 6 µl of 0.5 M sodium phosphate (pH 7.5), 6 µl of 10% (vol/vol) NP-40, and 2,500 units of peptide N-glycosidase F. The complete reaction mixture was incubated at 37°C for 60 min. The reaction was terminated by addition of an equal volume of 2× SDS-PAGE sample buffer and storage of the sample at -20°C until use. Sham-treated samples were processed as above, except that enzyme was omitted from the reaction.

Immunofluorescence. Cells were plated at 5 × 103 cells/cm2 in two-well culture slides precoated with poly-D-lysine as described above. The cells were allowed to attach for 24 h, and then muristerone A was added to the medium as described above for 48 h. The wells containing the cells were then washed twice with 1 ml of PBS containing 0.9 mM CaCl2 and 0.5 mM MgCl2. The wells attached to the slides were then removed, and the slides were placed in 150-mm culture dishes containing a freshly prepared methanol-acetone solution (1:1) and incubated for 2 min at room temperature. The slide was then removed, drained onto blotting paper, placed into a fresh 150-mm culture dish containing 30 ml of PBS, and incubated with gentle shaking for 5 min at room temperature, followed by gentle aspiration of the PBS. This procedure was repeated two more times. The slide was then drained onto blotting paper, and the areas between the wells were dried by blotting. Then 200 µl of diluted antibody solution (1:1,000 in PBS) was overlaid on the well area and incubated in a covered culture dish at 37°C for 30 min. The slide was then washed three times as described above. The second antibody (FITC-conjugated goat anti-rabbit IgG diluted 1:1,000 in PBS) was overlaid on the well area and incubated in a covered culture dish as before. After the incubation, the slide was washed three times as described above. A drop of 90% (vol/vol) glycerol was placed onto each well area, the slide was covered with a glass coverslip, and the edges were sealed with clear nail polish. The slide was then immediately examined using fluorescence microscopy (Axiovert, Carl Zeiss, Thornwood, NY) to obtain immunofluorescent or Nomarski images. Fluorescence imaging was carried out using a 475-nm filter for excitation and a 530-nm filter for emission.

Composition of EcR293 cells. The cells were grown as described above and then incubated for 10 min at room temperature with PBS containing 1 mM EDTA (PBS-EDTA). The cells were gently scraped from the surface of the flask and suspended in ~5 ml PBS-EDTA per T75 flask. The cells were centrifuged at 2,500 g and then resuspended in an equal volume of PBS-EDTA, centrifuged, and resuspended in a HEPES-buffered solution and centrifuged for 20 s at 750 g in a microcentrifuge tube. The supernatant was removed. An aliquot of the mixed cells was removed, and [3H]inulin was added and mixed. 36Cl (1 µCi) was added to the remainder and mixed in with a glass rod. Glass microhematocrit tubes were filled by aspiration to ~70 µl, sealed at one end with putty, and centrifuged in a microhematocrit centrifuge (IEC, Needham Heights, MA) for 2 min at room temperature. The tubes were placed upright in ice. Individual tubes were cut with a file to isolate packed cells and cell-free supernatant. The packed cells were analyzed for wet and dry weight, protein (33, 34), and radioactivity. The dried cell pellet was solubilized by addition of 0.25 ml of lysis solution A [0.1% (vol/vol) Triton X-100] and 0.50 ml lysis solution B [25 mM NaOH and 0.5% (wt/vol) sodium deoxycholate]. The protein concentration in the solubilized cell pellet was determined using the bicinchoninic acid method (33, 35). The samples packed with [3H]inulin were used to calculate trapped space, with the assumption that it was distributed as an extracellular marker.

36Cl efflux from cells attached in 12-well plates. The cells were seeded and allowed to attach and grow for 24 h. They were then induced with muristerone A as described above and incubated for 24-48 h at 37°C in 5% CO2-95% air. The seeding density was lowered if cells were not induced, so that when the cells were studied their densities were approximately the same as those of induced cells: 80-90% confluent by eye or as indicated. The culture plates were removed to room temperature, and the culture medium in each well was aspirated and then replaced and removed three times with the tracer-free loading medium. The standard medium contained (in mM) 149 (Cl + gluconate), ~151 Na, 1.8 Ca, 0.81 Mg, 5.3 K, 5.55 D-glucose, and 25 HEPES (pH 7.64 at 20°C). The loading medium, with the same Cl concentration and composition as the wash medium but with 36Cl, was incubated with the cells for at least 0.5 h at room temperature. This allowed the tracer and nonradioactive Cl to reach steady state as determined by subsequent flux measurements. The plate was placed on a thermostated aluminum block with a small amount of water to thermally connect the plate and block, and both were placed on an oscillating platform. After removal of the loading solution, the efflux from a given well was initiated by three 1-ml exchanges of Cl-free washing solution at the given temperature. This process was complete in 8-10 s. Eleven samples (0.75 ml) of efflux medium were added and removed at known times and placed directly into liquid scintillation vials. The time was marked to the nearest 0.2 s by a treadle-operated print-timer at the end of the removal of each sample of the efflux medium from the well. After the last removal, the well was allowed to dry completely before 0.25 ml of lysis solution A and 0.5 ml of lysis solution B were added. The lysis solution was analyzed for both protein and radioactivity.

The 36Cl content of the cells as a function of time was reconstructed from the counts remaining in the well at the end of the efflux and the counts removed with each of the eleven samples of efflux medium. The net counts (gross counts/min - background counts/min) at the end of the flux were assigned as the counts within the cell when the last efflux sample was removed. To this was added the net counts removed with the last efflux sample, and this was assigned as the counts within the cells when the penultimate efflux sample was removed. This process was repeated until the first efflux sample was removed and added to the counts within the cells at the time of aspiration of the third and final Cl-free wash. A typical graph of micromoles of Cl within the cells per gram of protein, which was calculated using the specific activity of the loading solution and the protein content of the well, is shown in Fig. 1 for induced and noninduced cells. This graph was log convex (19) and could not be fitted well by a single exponential but was well fitted by the sum of two exponential terms of the form N(t) = N1 · exp(-k1t) + N2 · exp(-k2t), where N(t) is the content of the cells as a function of time, and N1 and N2 are the sizes of the two compartments with efflux rate coefficients k1 and k2, respectively. The rate constants for this equation were calculated by nonlinear regression using at least 10 data values obtained from cells in a single well. The flux for the rapid component from each well of cells was taken as a single (n = 1) independent value. In some experiments, to test for statistical significance between more than two groups, an ANOVA was used, followed by a multiple-comparison protected t-test to determine which groups were significantly different (e.g., Ref. 32a).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Double exponential fit of 36Cl efflux data from noninduced and induced cells. A and B: washout curves of 36Cl-loaded cells with remaining traced Cl within cells [N(t)] at different times (t). Solid curves, best fits to sum of 2 exponential functions. Dashed lines, content of compartment (N1) with faster rate coefficient (k1). Dotted lines, content of compartment (N2) with slower rate coefficient (k2). Intercepts of these lines with ordinate show contents of compartments at beginning of efflux. A: noninduced 293-hAE1-wt cells. N(t) = 296 · exp(-0.0078t) + 247 · exp(-0.0021t). N1 + N2 = 543 µmol/g protein. Efflux = N1k1 = 2.31 µmol · g protein-1 · s-1. B: induced (72 h with 2.5 µM muristerone A) 293-hAE1-wt cells. N(t) = 389 · exp(-0.065t) + 143 · exp(-0.0024t). N1 + N2 = 532 µmol/g protein. Efflux = N1k1 = 25.3 µmol · g protein-1 · s-1. Net induced efflux (N1k1 - N2k2) = 23.0 µmol · g protein-1 · s-1.

Several controls were made to assure that these counts were the result of the efflux from the cells or counts trapped beneath the cells. First, the volume, number, and rate of the three Cl-free washes from wells loaded with tracer but without any cells were chosen to remove all net counts. Second, the efflux from Triton X-100-treated or saponin-treated cells was shown to consist of only the last 5% of the total counts at the slower rate. The two components of the efflux had the following characteristics. The slower rate coefficient (k2) and the fraction of the counts in N2 were the same in induced and noninduced cells. The slower rate coefficient was not reduced by the presence of 4,4'-dinitrostilbene-2,2'-disulfonate (DNDS) in the efflux medium in either induced or noninduced cells. The rapid rate coefficient (k1) was faster in induced cells than in noninduced cells and was inhibited by DNDS. This indicated that the first component included the efflux via hAE1 (induced cells only) and native pathways across the plasma membrane and that the slow component was the washout from either sequestered counts under and between the cells or from an intracellular pool and therefore insensitive to DNDS inhibition. Consequently, the efflux from the fast component (k1N1) is graphed for data presentation (see Figs. 4-6 and 8).

35SO4 influx in cells attached to 24-well plates. 293-hAE1-wt cells were plated at either 1 × 105 or 2 × 105 cells/well. After 1 day, some were induced with 2.5 µM muristerone A for 72 h. The cells were washed and incubated for 0.5 h in a tracer-free, Na-free, N-methyl-D-glucamine-SO4 medium otherwise like the influx medium. The influx medium contained (in mM) 92.1 Na2SO4, 1.8 calcium digluconate, 0.81 MgSO4, 5.55 D-glucose, 25 HEPES, 5.3 K2SO4 (total SO4 98.2 mM), and 2.8 µCi carrier-free 35SO4/ml. The noninduced and induced cells were always treated and fluxed in parallel. The culture plates were placed on a water thermostated table for 5 min, and the flux was initiated by aspirating the preincubation medium from the last column of wells and adding 35SO4-containing medium at known times (±0.2 s). This was done to successive columns of wells at six known times before terminating the influx simultaneously for all wells on the plate by three rapid ice-cold washes (>15 s total elapsed time) with (in mM) 143.8 NaCl, 1.8 CaCl2, 0.81 mM MgCl2, 5.3 KCl, and 5 HEPES (pH 7.4 at room temperature). The cells were solubilized by first adding 0.25 ml of lysis solution A and incubating at room temperature for 30-60 min and then adding and mixing 0.5 ml of lysis solution B. Two 100-µl samples from each well were used to measure protein (33), and a 450-µl sample was counted with 3 ml of Optifluor in a liquid scintillation counter. Triplet samples of the influx solution were counted contemporaneously with the flux samples for specific activity determination. The micromoles per gram protein in each well were calculated, and the slope of the linear least squares best fit to these values against sample times was the computed flux. Each condition was measured in quadruplicate, and the data points were pooled for the linear regression.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Composition of EcR293 cells. The cells were ~82% water by weight when corrected for the [3H]inulin trapped space, which was 32% on average but varied from 13 to 38% in individual experiments. There were on average 4.5 kg intracellular water/kg dry cell solids. From the analysis of the solubilized dried cell pellets, we calculated that the protein was 30.4 ± 1.7% (wt/wt) of the dry cell solids. Therefore, as a rule of thumb, to convert values of micromoles Cl (or other cellular component) per gram protein to millimoles per kilogram of cell water, one should divide the former value by ~15. The steady-state Cl concentration was calculated from the traced Cl content and water content. This assumes that all of the Cl was uniformly dissolved in the entire cell water. The ratio of intracellular Cl concentration to the extracellular Cl concentration was ~0.7 when extracellular Cl concentration was as low as 20 mM or as high as 150 mM.

Expression as determined by Western blot analysis and immunofluorescence. The induction of hAE1 was determined both as a function of duration and dose of the inducer, muristerone A. Samples of whole cell lysates with equal amounts of total protein were run on an SDS gel and electroblotted to nitrocellulose paper, and the amount of hAE1 was visualized by chemiluminescence after treatment of the blot with a primary rabbit anti-hAE1 antibody and a secondary goat anti-rabbit IgG antibody conjugated to horseradish peroxidase. A lysate sample from 105 red blood cells (which contained 0.1 pmol of hAE1 or 10 ng of hAE1) was used as a standard. The amount of hAE1 synthesized increased with the concentration of muristerone A, and the amount was greater after 48 h of induction than at 24 h at each concentration (Fig. 2A). There was no detectable hAE1 in the absence of treatment with muristerone A. The amount of hAE1 continued to increase up to at least 96 h (data not shown). Upon treatment with 2.5 µM muristerone A, the generation time of 293-hAE1-wt cells was slowed to about one-half that of uninduced 293-hAE1-wt cells or nontransfected EcR293 cells. Although the doubling time of the induced 293-hAE1-wt was slowed, these cells appeared to have a normal morphology and remained tightly adherent to the plates. There was a parallel increase in the appearance of higher molecular weight forms of immunoreactive hAE1 at the highest levels of induction. The higher molecular weight forms of hAE1 are probably due to glycosylation of the protein. To test this hypothesis, we treated whole cell lysates with peptide N-glycosidase F, an enzyme that cleaves at the junction of the sugar polymer and the asparagine on the protein backbone. The results (Fig. 2B) show apparently complete removal of the higher molecular weight bands, whereas the lower band remains unaffected by this treatment. In erythrocytes, hAE1 is normally glycosylated to a highly variable extent at Asn-642, located on the fourth putative extracellular loop from the amino terminus. Immunofluorescence shows intense hAE1 staining at the plasma membrane, diffuse staining throughout the cytoplasm, and a moderately intense staining that appears to be perinuclear (Fig. 3). The noninduced cells were devoid of immunofluorescence, as were the controls using preimmune serum or missing the second antibody (data not shown).


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 2.   Western blot analysis of human anion exchange protein 1 (hAE1) expressed after induction with muristerone A. A: lane labeled RBC was loaded with a total cell lysate of human red blood cells containing 10 ng of hAE1. Other lanes were loaded with 1.0 µg total cell lysate prepared from 293-hAE1-wt cells induced with muristerone A for either 24 or 48 h, as indicated. Concentration (µM) of muristerone A ([mur]) is indicated directly above corresponding lanes. Results indicate that amount of recombinant hAE1 produced in cells is directly correlated with both length of induction period and concentration of muristerone A added to media. B: deglycosylation was carried out in presence and absence peptide N-glycosidase F enzyme (PNGase F). Reaction was terminated by addition of an equal volume of SDS-PAGE sample buffer, and 3.1 µg of cell protein were loaded per lane. Result of deglycosylation reaction clearly indicates that higher molecular weight hAE1 protein bands are result of variable N-glycosylation. Prominent lower molecular weight band in absence of treatment represents nonglycosylated or core-glycosylated hAE1.


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 3.   Immunofluorescence of noninduced and induced cells. A: Nomarski image of noninduced 293-hAE1-wt cells. B: immunofluorescence for same field using an hAE1-specific antibody. C: immunofluorescence of induced cells (treated with 2.5 µM muristerone A for 48 h) using same antibody. Nomarski image of induced cells (data not shown) indicates that all cells were positive by immunofluorescence.

Functional analysis of hAE1 expressed in EcR293 cells. In control experiments, the Cl flux was small and unchanged in untransfected EcR293 cells or in HEK-293 cells incubated with 2.5 µM muristerone A for 24 or 48 h (data not shown). In Fig. 4 is shown the rapid component of the efflux from induced (2.5 µM muristerone A for 48 h) and noninduced cells in the absence and presence of 0.25 mM DNDS. The induced cells had a flux that was ~40 times the background flux in noninduced cells. All of the additional efflux through the rapid component in the induced cells was inhibited by DNDS when present in the efflux solutions. But the rapid component of the efflux was not inhibited by DNDS in the noninduced cells. This result demonstrates the induction of a new rapid Cl transport pathway that is DNDS sensitive.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4.   4,4'-Dinitrostilbene-2,2'-disulfonate (DNDS) inhibition of 36Cl efflux from noninduced and induced cells. 293-hAE1-wt cells were plated at 2 × 105/well. After 1 day, some were induced with 2.5 µM muristerone A for 48 h before 36Cl efflux (means ± SE) was assayed in triplicate in 19.9 mM Cl. Induced cells were 50-60% confluent. Efflux from induced cells was 40 times the efflux from noninduced cells (shaded bars). DNDS (0.25 mM) completely inhibited additional flux in induced cells but was without effect on smaller flux from noninduced cells (stippled bars). Values are means ± SD of 3 flux values.

The activation of 36Cl efflux from erythrocytes by external Cl is one of the characteristics of hAE1-mediated transport that implies a carrier-mediated, in contrast to channel-mediated, transport. Despite the decrease in the thermodynamic driving force for Cl (but not for 36Cl) by the substitution of Cl for gluconate in the external medium, tracer Cl efflux kinetics were activated. This transactivation suggests the coupling of the efflux to the influx either through the formation of a ternary complex (sequential kinetics) or through a single site with alternating access only if an anion is transported in each half cycle. This latter mechanism has ping-pong kinetics and has been demonstrated in human erythrocytes for hAE1-mediated anion exchange (16, 18).

The efflux as a function of external Cl in both induced and noninduced cells is shown in Fig. 5. The tracer Cl efflux from only the induced cells was activated by external nontracer Cl along a hyperbolic curve. The external medium was always isosmotic and isoionic, since Cl was substituted mole for mole with gluconate and all other components of the efflux media were held constant. The noninduced cells had a rapid component of the efflux that was small and was not activated by external Cl. The efflux from induced cells was more rapid in the all-gluconate medium and was further activated by external Cl concentrations, with an apparent concentration producing half-maximal effect (K1/2) of 4.8 mM. This value agrees with the value of K1/2-out = 6.4 ± 0.7 reported in erythrocytes at pH 6.7 (16, 27).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   External Cl activation of 36Cl efflux from noninduced and induced cells. 293-hAE1-wt cells were plated at 2 × 105/well. After 1 day, some were induced with 2.5 µM muristerone A for 48 h. Loading solution contained 10 mM Cl and 0.077 cpm 36Cl/pmol. Efflux was measured in triplicate (some symbols overlap) at 20°C in media with indicated NaCl concentrations. Media contained (in mM) 149 (Cl + gluconate), ~151 Na, 1.8 Ca, 0.81 Mg, 5.3 K, 5.55 D-glucose, and 25 HEPES (pH 7.64 at 20°C). Induced cell fluxes (black-diamond ) were fitted to Flux = Vo + Vmax · [Cl]o/(K1/2 + [Cl]o), where the zero chloride intercept (Vo) = 3.8, maximal velocity (Vmax) = 24.4 µmol · g protein-1 · s-1, [Cl]o is external Cl concentration, and K1/2 = 4.8 mM Cl. Mean value of flux in noninduced cells () was 0.6 µmol · g protein-1 · s-1 and was independent of [Cl]o. If analysis of activation of net induced flux allowed an increment of contaminating HCO3 in solutions, best fit parameters were Vmax = 27.2, K1/2 = 3.9 mM, and HCO3 = 0.5 mM. This agrees with value of 0.44 mM HCO3 calculated for water at pH 7.4 in equilibrium with room air, which has a PCO2 of 0.25 Torr. Noninduced cells (~50% confluent) contained 130 ± 45 pmol 36Cl/µg protein in rapid compartment, which was 88 ± 8% of total radioactivity. Induced cells (~75% confluent) contained 159 ± 31 pmol 36Cl/µg protein in rapid compartment, which was 66 ± 9% of total.

The transactivation of the 36Cl efflux by external anions in a gluconate background is shown for Cl, Br, I, and NO3 in Fig. 6. The sequence of anions that activates 36Cl efflux in erythrocytes is Cl = HCO3 = NO3 > Br > I. The relative values in erythrocytes are Cl = 1.0, Br = 0.33, and I = 0.01 (27). This same sequence of external anion activation of 36Cl efflux was found in induced cells and noninduced cells. The presence of 250 µM DNDS reduced the flux in induced cells to that in noninduced cells for each of these anions. The transactivation was presumably due to heteroexchange of the external anion for internal 36Cl. The slower rates of Cl efflux when Br or I was the external anion were probably due to the slower influx of these obligatory exchange halides on hAE1. When the same data are replotted (Fig. 6B), they demonstrate that for each external anion the difference between the efflux from induced and noninduced cells was equal to the difference between the efflux from induced cells in the absence and presence of DNDS. This demonstrated that the hAE1-mediated efflux was equal to the DNDS-sensitive efflux for each exchange pair of anions.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6.   External activation of 36Cl efflux from noninduced and induced cells by other monovalent anions. 293-hAE1-wt cells were plated at 105/well. After 2 days, some were induced with 2.5 µM muristerone A for 72 h before 36Cl efflux was measured in triplicate. Efflux media had same composition as loading solution except there was no 36Cl and all 28.8 mM Cl was replaced mole for mole by indicated monovalent anion. Mean Cl contents in fast compartment were 207 and 170 µmol/g protein for induced and noninduced cells, respectively. A: efflux (means ± SE, n = 3) from induced cells (shaded bars), noninduced cells (solid bars), and induced cells with 0.25 mM DNDS (stippled bars) is shown for each anion replacing Cl in external solution. Absolute efflux values were greatest in induced cells, but rank order of rates was same in induced and noninduced cells. Efflux in presence of DNDS was independent of external anion. * P < 0.05 vs. treatment for a given anion (induced, noninduced, and induced + DNDS); dagger  P < 0.05 vs. Br or I in induced cells; ddager  P < 0.05 vs. other 3 anions in induced cells. B: data in A replotted to show that efflux from induced cells minus efflux from noninduced cells (shaded bars) and DNDS-sensitive efflux from induced cells (stippled bars) were equal for each anion. Order of flux values was NO3 = Cl > Br > I, just as in erythrocytes.

The pH dependence of anion transport in induced and noninduced cells was evaluated by measuring the external proton activation of SO4. In Fig. 7, left, the 35SO4 influx into noninduced cells is shown. There was a 1.6-fold activation by the acid pH medium in noninduced cells that was not inhibited by 0.25 mM DNDS. The influx into induced cells is shown in Fig. 7, right. There was a 3.2-fold activation by acidic pH, which was 53% inhibited by DNDS. The net induced influx at pH 7.64 was 0.01 µmol · g protein-1 · s-1, whereas the net induced influx at pH 6.2 was sevenfold greater. This agrees with the activation of SO4 influx into erythrocytes, which was 6.8- to 7.2-fold at external pH 6.2 relative to the activation at external pH 7.64 (intracellular pH 7.2, 20°C; see Figs. 1 and 2 of Ref. 26). Both in these experiments and in erythrocytes, the internal pH was ~7.2 and the external SO4 concentration was saturating. Because the 293-hAE1-wt cells were preloaded with SO4, the influx may have been slower than when Cl-containing erythrocytes were used, but the relative flux values at different pH values would be expected to be the same. This flux was not Na dependent (data not shown) and thus not mediated by a Na-SO4 cotransporter. These are the characteristics expected from hAE1-mediated SO4 flux as judged from SO4 influx measurements in erythrocytes (25).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 7.   Activation of SO4 influx in induced cells by acidic pH (means ± SD). Left: noninduced cells at pH 7.64 and 6.2 have fluxes of 0.021 and 0.033 µmol · g protein-1 · s-1, respectively. Latter was not reduced by presence of 0.25 mM DNDS (stippled bar). ND, not determined. Right: induced cells have larger fluxes and larger activation by protons. Activated flux was partially inhibited by DNDS (stippled bar). At pH 6.2, flux into induced cells minus that into noninduced cells was 0.070 µmol · g protein-1 · s-1. Induced cells were treated for 72 h with 2.5 µM muristerone A. Proton activation quantitatively agrees with that reported in red blood cells, and flux increment in induced cells agrees with flux calculated from number of copies of glycosylated AE1 expressed (see DISCUSSION).

In Fig. 8, the 36Cl efflux into media with different external pH values is shown for induced and noninduced cells. The noninduced cells had a larger flux than usual, but the induced cells were still four- to eightfold larger. The external pH dependence of both groups of cells was slight. The linear regression showed a 1-flux unit reduction per 1-pH unit increase, whereas the induced cells showed a 3-flux unit increase per 1-pH unit increase over the pH range 6.7-8.5. This 4-flux unit increase in the net induced flux is an ~30% (4/13) increase per pH unit above the net induced flux at pH 6.7. In comparison, when only the external pH dependence was measured in erythrocytes with a fixed internal pH of 7.6, the maximal flux increased only 4% per pH unit at pH 6.7 (17), and, in another study with a fixed internal pH of 7.4, the flux increased 8% per pH unit at pH 6.75 (35). However, when the erythrocytes were preequilibrated and the external pH and the internal pH were altered together, there was a much larger increase (70%) in the 36Cl-Cl exchange due to the additional internal titration (15).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 8.   External pH (pH out) dependence of 36Cl efflux in induced and noninduced cells. Induced cells were treated with 2.5 µM muristerone A for 48 h. Efflux media contained 32 mM Cl, and pH of HEPES-buffered media was measured against standards at 20°C. Least squares linear regression line for noninduced cells () has equation Flux = 10 - 0.9 · pH. Linear regression line for induced cells (black-diamond ) has equation Flux = -0.7 + 2.8 · pH. This relative lack of external pH dependence is like that seen in human red blood cells when only external pH is changed and internal pH is held fixed. This is in contrast to activation of SO4 influx at low pH values shown in Fig. 7.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

The objective of this work was to express hAE1, the erythrocyte anion exchange membrane protein, in sufficient quantity to assure that both structural analysis and functional measurements could be carried out on the same population of molecules. The cell line developed here, 293-hAE1-wt, provides a promising system for the concomitant measurement of the function of mutant anion exchangers and their topology. Here we have been obliged to develop a system to perform transport assays on a large number of molecules, since hAE1 is not rheogenic and can only be properly assayed by tracer fluxes of the rapidly transported substrate, Cl. We have been able to demonstrate transactivation of Cl tracer efflux by external halides and NO3, determine the external Michaelis-Menten constant (Km) by transactivation with Cl, and demonstrate the inhibition of the induced tracer flux by 250 µM DNDS and the activation of SO4 influx at low external pH. These characteristics indicate that the hAE1 protein is functioning as it does in erythrocytes.

Three cell lines, native HEK-293 cells, EcR293 cells that constitutively express the ecdysone and retinoic acid receptors, and the permanent cell line 293-hAE1-wt when not induced, all fail to have DNDS-sensitive 36Cl efflux. These three cell lines also fail to have hAE1 by Western analysis. Thus the 293-hAE1-wt cells in the absence of induction by muristerone A lack carrier-mediated Cl transport and have a relatively low background flux mediated by unknown mechanisms.

The tracer efflux into nominally Cl-free gluconate solutions was greater in induced than in noninduced cells (Fig. 5). This efflux may reflect either net efflux of Cl or the exchange of tracer Cl with external HCO3. The efflux medium in equilibrium with room air [CO2 = 3.3 × 10-4 atm] at 20°C has a calculated HCO3 concentration of 0.44 mM (23). When the Cl activation data in Fig. 5 were fitted to the Michaelis-Menten equation with the ordinate at zero, the substrate fixed at the average flux of the noninduced cells (0.64 µmol · g protein-1 · s-1), and the scale on the abscissa allowed to be offset by an increment of HCO3 concentration, the best fit values were HCO3 = 0.52 mM, Km = 3.9 mM, and maximal velocity (Vmax) = 27.2 µmol · g protein-1 · s-1. This HCO3 concentration is close to the 0.44 mM calculated above. We, therefore, do not believe there is significant nonobligatory exchange of anions induced in this system but rather that contaminating HCO3 is responsible for the additional Cl efflux in Cl-free media.

The transactivation cannot be explained by electrodiffusion of Cl. If the 36Cl efflux were not through an electrically silent process and the induced pathway were making the membrane highly conductive to Cl, then the substitution of external Cl for gluconate would depolarize the membrane potential and decrease the electrical driving force for 36Cl efflux from the cell. This would tend to inhibit the tracer efflux of Cl, the opposite of what was observed in Fig. 5.

In erythrocytes, the relative maximal transport rates by hAE1 are SO4 = 1, I = 500, Br = 14,000, and Cl = 43,000 (8, 26, 27). The relative maximal transport rates we have measured here (Figs. 4-7) are 5-10 times smaller for Cl but the same as for I in red blood cells. The most likely explanation is that we have underestimated the rapid Cl fluxes, especially at higher levels of expression, as shown by the following calculations. The number of copies of hAE1 was estimated by comparing the density of the bands in the Western analysis (Fig. 2) with parallel blots containing variable amounts of erythrocyte membranes to generate a quantitative standard curve (data not shown). We estimate from our Western blots that there are ~9,000,000 copies of hAE1/µg total cell protein after induction for 48 h with 2.5 µM muristerone A. The proportion that was glycosylated is an upper bound on the functional hAE1 at the plasma membrane, since some glycosylated forms may be in the endoplasmic reticulum and Golgi apparatus. The immunofluorescence shows intense hAE1 staining at the plasma membrane, diffuse staining throughout the cytoplasm, and a moderately intense staining that appears to be perinuclear. We calculate that the maximum number of functional hAE1 at the plasma membrane is ~850,000 copies/cell or ~8.5 × 1015 copies/g protein based on our previous estimate of 10,000 cells/µg cell protein (33). If each copy functioned as if in a red blood cell membrane, the maximal Cl flux would be 200 µmol · g protein-1 · s-1 at 20°C (2, 15), and the maximal SO4 flux would be 0.068 µmol · g protein-1 · s-1 at 20°C (26). If we assume that each copy of hAE1 functions at the rate it does in human red blood cells under comparable conditions, the observed hAE1-dependent flux of SO4 (0.070 µmol · g protein-1 · s-1; Fig. 7) corresponds to 878,000 functional copies/cell, and the observed hAE1-dependent flux of Cl (20 µmol · g protein-1 · s-1; Fig. 5) corresponds to 85,900 functional copies/cell. Both of these calculations are based on the Vmax for transport of the respective anions at 20°C. Thus the SO4 influx accurately reflects the number of functional copies per cell. Whereas, if the Cl efflux were the Vmax under these conditions, it would underestimate the actual number copies of hAE1 by a factor of ~10. Because the hAE1-induced flux was measured at ~20 mM internal Cl, or at only 25% of internal saturation, the Cl efflux only underestimates the actual number of functional copies of hAE1 by a factor of ~2-3. This result is consistent with the underestimation of the rapid Cl flux using our present techniques.

Although the efflux from the rapid compartment of induced cells behaves as if it included the hAE1-mediated transport across the plasma membranes, the anatomical basis for the compartment with the slower rate coefficient has not been proven. Because the cells are a clonal cell line, all of the cells in a given well should be the same. Thus the two compartments seen in the washout curve cannot be the result of two different pools of cells. Because noninduced cells also seem to have two compartments, the presence of two compartments in the induced cells cannot have arisen simply from a distribution of responsiveness to the muristerone A. Thus more complex factors need to be involved. If there were a single pool of cells with a single intracellular pool of Cl, the washout curve would be a single exponential even if multiple parallel transport pathways existed in their plasma membranes. In general, there was little difference in the rate coefficients for the slower compartment between noninduced and induced cells. However, in noninduced cells, the difference between the faster and slower rate coefficients was less, and the relative sizes [N1/(N1 + N2) and N2/(N1 + N2)] of the two compartments were less well determined. Two findings support the conclusion that the compartment with the slower rate coefficient was due to another compartment (or compartments) within the cell. First, the amount of Cl in each compartment separately, as well as the total amount of Cl, was greater in induced cells than in noninduced cells. Second, the total amount of Cl traced during the efflux was not significantly different when DNDS was in the efflux medium. Both of these findings would be unlikely if the slower compartment were due to a space trapped beneath or between the cells. Because the cells did not form a coherent monolayer attached to the bottom of the well, the spaces between the cells should be no barrier to diffusion (which is much faster than the tracer flux). Also, it is difficult to conceive of a model to explain why these extracellular spaces should have more Cl when the cells expressed hAE1.

The pH dependence of anion exchange in erythrocytes is the basis for the titratable carrier hypothesis (13). The protonation of a specific group in the cytoplasmic domain of AE1 decreases the maximal transport rate for halides and other monovalent anions (17). The protonation of an external site on AE1 increases the influx rate of SO4 (13) by providing a cotransported proton at low pH values (25, 26) but has little effect on Cl-Cl exchange (17). This group is believed to be Glu-681 (22) for three reasons. First, this group is located in the cytoplasm and yet can be chemically modified by treatment with Woodward's reagent K, which is an impermeant carboxyl reagent, and sodium borohydride (NaBH4) to form the alcohol of glutamate at that position. Second, this modification reduces the pH dependence of these fluxes (21, 22) and induces electrogenic SO4-Cl exchange. Third, site-directed mutagenesis of the equivalent site in murine AE1 to glutamine and expression in oocytes caused inhibition of Cl fluxes and activation of SO4 exchanges, particularly of intracellular SO4/extracellular Cl exchange, which now is electrogenic (4, 6). However, these different proton effects may be at two sites. The inhibition of Cl exchange seems to be due to an internal, noncompetitive site. The proton activation of SO4 influx and the external halide activation of proton influx seems to be through protons acting as a cotransported substrate on the cis side of the membrane with the SO4 or halide (17, 25, 35). The results that we found in this paper on expression of hAE1 in HEK-293 cells, namely, the external proton activation of SO4 influx and the relative lack of external proton inhibition of Cl efflux, agrees with the behavior of hAE1 in erythrocytes.

    ACKNOWLEDGEMENTS

We thank Dr. J. W. Nichols for assistance with immunofluorescence, P. M. Smith for maintaining and transfecting the HEK-293 cells, Y. Yang for preparing plasmid cDNA for transfection, B. Stockman for performing SDS-PAGE and Western analysis, and B. M. Medley for preparing the manuscript.

    FOOTNOTES

This work was supported in part by National Heart, Lung, and Blood Institute Grant R37-HL-28674 (to R. B. Gunn).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: R. B. Gunn, Dept. of Physiology, Emory University School of Medicine, 1648 Pierce Dr., Atlanta, GA 30322-3110.

Received 11 June 1998; accepted in final form 28 September 1998.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Bartel, D., S. Lepke, G. Layh-Schmidt, B. Legrum, and H. Passow. Anion transport in oocytes of Xenopus laevis induced by expression of mouse erythroid band 3 protein-encoding cRNA and of a cRNA derivative obtained by site-directed mutagenesis at the stilbene disulfonate binding site. EMBO J. 8: 3601-3609, 1989[Medline].

2.   Brahm, J. Temperature-dependent changes of chloride transport kinetics in human red cells. J. Gen. Physiol. 70: 283-306, 1977[Abstract/Free Full Text].

3.   Brosius, F. C. I., S. L. Alper, A. M. Garcia, and H. F. Lodish. The major kidney band 3 gene transcript predicts an amino-terminal truncated band 3 polypeptide. J. Biol. Chem. 264: 7784-7787, 1989[Abstract/Free Full Text].

4.   Chernova, M., L. W. Jiang, M. Hand, M. Gola, M. Crest, K. Strange, and S. L. Alper. Mutational conversion of the electroneutral AE1 anion exchanger into an electrogenic exchanger with altered anion selectivity (Abstract). Soc. Gen. Physiol. Ser. 105: 31a, 1995.

5.   Chernova, M. N., B. D. Humphreys, D. H. Robinson, A. K. Stuart-Tilley, A. M. Garcia, F. C. I. Brosius, and S. L. Alper. Functional consequences of mutations in the transmembrane domain and the carboxy-terminus of the murine AE1 anion exchanger. Biochim. Biophys. Acta 1329: 111-123, 1997[Medline].

6.   Chernova, M. N., L. Jiang, M. Crest, M. Hand, D. H. Vandorpe, K. Strange, and S. L. Alper. Electrogenic sulfate/chloride exchange in Xenopus oocytes mediated by murine AE1 E699Q. J. Gen. Physiol. 109: 345-360, 1997[Abstract/Free Full Text].

7.   Dale, W. E., J. A. Textor, R. W. Mercer, and L. Simchowitz. Expression and characterization of the human erythrocyte anion exchanger in a Baculovirus/Sf-9 cell system. Protein Expr. Purif. 7: 1-11, 1996[Medline].

8.   Dalmark, M., and J. O. Wieth. Temperature dependence of chloride, bromide, iodide, thiocyanate and salicylate transport in human red cells. J. Physiol. (Lond.) 224: 583-610, 1972[Abstract/Free Full Text].

9.   Deng, W. P., and J. A. Nickoloff. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal. Biochem. 200: 81-88, 1992[Medline].

10.   Fröhlich, O., and R. B. Gunn. Binding of cis and trans isomers of 4,4'-dinitrostilbene-2,2'-disulfonate (DNDS) to the erythrocyte anion transporter. In: Genetics, Structure and Function of Blood Cells, edited by S. R. Hollan, G. Gardos, and B. Sarkadi. Budapest: Akademiai Kiado, 1981, p. 275-280. (Adv. Physiol. Sci. vol. 6)

11.   Groves, J. D., P. Falson, M. Le Maire, and M. J. A. Tanner. Functional cell surface expression of the anion transport domain of human red cell band 3 (AE1) in the yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 93: 12245-12250, 1996[Abstract/Free Full Text].

12.   Groves, J. D., and M. J. A. Tanner. The effects of glycophorin A on the expression of the human red cell anion transporter (band 3) in Xenopus oocytes. J. Membr. Biol. 140: 81-88, 1994[Medline].

13.   Gunn, R. B. A titratable carrier model for both mono- and di-valent anion transport in human red blood cells. In: Oxygen Affinity of Hemoglobin and Red Cell Acid-Base Status, edited by M. Rorth, and P. Astrup. New York: Academic, 1972, p. 823-827.

14.   Gunn, R. B. Buffer equilibria in red blood cells. In: The Regulation of Acid-Base Balance, edited by D. W. Seldin, and G. Giebisch. New York: Raven, 1989, p. 57-67.

15.   Gunn, R. B., M. Dalmark, D. C. Tosteson, and J. O. Wieth. Characteristics of chloride transport in human red blood cells. J. Gen. Physiol. 61: 185-206, 1973[Abstract/Free Full Text].

16.   Gunn, R. B., and O. Fröhlich. Asymmetry in the mechanism for anion exchange in human red blood cell membranes: evidence for reciprocating sites that react with one transported anion at a time. J. Gen. Physiol. 74: 351-374, 1979[Abstract/Free Full Text].

17.   Gunn, R. B., and O. Fröhlich. Asymmetry in the mechanism of anion exchange and evidence for reciprocating sites that react with one transported anion at a time. In: Membrane Transport in Erythrocytes, edited by U. V. Lassen, H. H. Ussing, and J. O. Wieth. Copenhagen: Munksgaard, 1980, p. 431-449. (Alfred Benzon Symp. 14)

18.   Gunn, R. B., and O. Fröhlich. Methods and analysis of erythrocyte anion fluxes. Methods Enzymol. 173: 54-80, 1989[Medline].

19.   Gunn, R. B., C. S. Patlak, and J. Z. Hearon. The logarithmic convexity of the washout function in tracer kinetics. Math. Biosci. 4: 1-6, 1969.

20.   Inaba, M., A. Yawata, I. Koshino, K. Sato, M. Takeuchi, Y. Takakuwa, S. Manno, Y. Yawata, A. Kanzaki, J. Sakai, A. Ban, K. Ono, and Y. Meade. Defective anion transport and marked sperocytosis with membrane instability caused by hereditary total deficiency of red cell band 3 in cattle due to a nonsense mutation. J. Clin. Invest. 97: 1804-1817, 1996[Medline].

21.   Jennings, M. L., and S. Al-Rhaiyel. Modification of a carboxyl group that appears to cross the permeability barrier in the red blood cell anion transporter. J. Gen. Physiol. 92: 161-178, 1988[Abstract/Free Full Text].

22.   Jennings, M. L., and J. S. Smith. Anion-proton cotransport through the human red blood cell band 3 protein. Role of glutamate 681. J. Biol. Chem. 267: 13964-13971, 1992[Abstract/Free Full Text].

23.   Knoche, W. Chemical reactions of CO2 in water. In: Biophysics and Physiology of Carbon Dioxide, edited by C. Bauer, G. Gros, and H. Bartels. New York: Springer-Verlag, 1980, p. 1-11.

24.   Lee, B. S., R. B. Gunn, and R. R. Kopito. Functional differences among nonerythroid anion exchangers expressed in a transfected human cell line. J. Biol. Chem. 266: 11448-11454, 1991[Abstract/Free Full Text].

25.   Milanick, M. A., and R. B. Gunn. Proton-sulfate co-transport. Mechanism of H+ and sulfate addition to the chloride transporter of human red blood cells. J. Gen. Physiol. 79: 87-113, 1982[Abstract/Free Full Text].

26.   Milanick, M. A., and R. B. Gunn. Proton-sulfate cotransport: external proton activation of sulfate influx into human red blood cells. Am. J. Physiol. 247 (Cell Physiol. 16): C247-C259, 1984[Abstract/Free Full Text].

27.   Milanick, M. A., and R. B. Gunn. Proton inhibition of chloride exchange: asynchrony of band 3 proton and anion transport sites? Am. J. Physiol. 250 (Cell Physiol. 19): C955-C969, 1986[Abstract/Free Full Text].

28.   No, D., T.-P. Yao, and R. M. Evans. Ecdysone-inducible gene expression in mammalian cells and transgenic mice. Proc. Natl. Acad. Sci. USA 93: 3346-3351, 1996[Abstract/Free Full Text].

29.   Peters, L. L., R. A. Shivdasani, S.-C. Liu, M. Hanspal, K. M. John, J. M. Gonzalez, C. Brugnara, B. Gwynn, N. Mohandas, S. L. Alper, S. H. Orkin, and S. E. Lux. Anion exchanger 1 (band 3) is required to prevent erythrocyte membrane surface loss but not to form the membrane skeleton. Cell 86: 917-927, 1996[Medline].

30.   Sanger, F., S. Nicklen, and A. R. Coulson. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467, 1977[Abstract/Free Full Text].

31.   Sekler, I., R. Kopito, and J. R. Casey. High level expression, partial purification, and functional reconstitution of the human AE1 exchanger in Saccharomyces cerevisiae. J. Biol. Chem. 270: 21028-21034, 1995[Abstract/Free Full Text].

32.   Ship, S., Y. Shami, W. Breuer, and A. Rothstein. Synthesis of tritiated 4,4'-diisothiocyano-2,2'stilbene disulfonic acid ([3H]DIDS) and its covalent reaction with sites related to anion transport in human red blood cells. J. Membr. Biol. 33: 311-323, 1977[Medline].

32a.   Snedecor, G. W., and W. G. Cochran. Statistical Methods (7th ed.). Ames, IA: Iowa State University Press, 1980, p. 217-236.

33.   Timmer, R. T., and R. B. Gunn. Phosphate transport by the human renal cotransporter NaPi-3 expressed in HEK-293 cells. Am. J. Physiol. 274 (Cell Physiol. 43): C757-C769, 1998[Abstract/Free Full Text].

34.   Wiechelman, K. J., R. D. Braun, and J. D. Fitzpatrick. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Anal. Biochem. 175: 231-237, 1988[Medline].

35.   Wieth, J. O., J. Brahm, and J. Funder. Transport and interactions of anions and protons in the red blood cell membrane. Ann. NY Acad. Sci. 80: 394-418, 1980.


Am J Physiol Cell Physiol 276(1):C66-C75
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
BloodHome page
R. Beckmann, J. S. Smythe, D. J. Anstee, and M. J. A. Tanner
Coexpression of band 3 mutants and Rh polypeptides: differential effects of band 3 on the expression of the Rh complex containing D polypeptide and the Rh complex containing CcEe polypeptide
Blood, April 15, 2001; 97(8): 2496 - 2505.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
P. A. Knauf, N. M. Raha, and L. J. Spinelli
The Noncompetitive Inhibitor Ww781 Senses Changes in Erythrocyte Anion Exchanger (Ae1) Transport Site Conformation and Substrate Binding
J. Gen. Physiol., February 1, 2000; 115(2): 159 - 174.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Timmer, R. T.
Right arrow Articles by Gunn, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Timmer, R. T.
Right arrow Articles by Gunn, R. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online