Am J Physiol Cell Physiol Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 275: C1409-C1416, 1998;
0363-6143/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murthy, K. S.
Right arrow Articles by Makhlouf, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murthy, K. S.
Right arrow Articles by Makhlouf, G. M.
Vol. 275, Issue 6, C1409-C1416, December 1998

EDITORIAL FOCUS
G protein-dependent activation of smooth muscle eNOS via natriuretic peptide clearance receptor

K. S. Murthy, B.-Q. Teng, J.-G. Jin, and G. M. Makhlouf

Departments of Physiology and Medicine, Medical College of Virginia, Virginia Commonwealth University, Richmond, Virginia 23298-0711

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In gastrointestinal smooth muscle, the neuropeptides vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) induce relaxation by interacting with VIP2/PACAP3 receptors coupled via Gs to adenylyl cyclase and with distinct receptors coupled via Gi1 and/or Gi2 to a smooth muscle endothelial nitric oxide synthase (eNOS). The present study identifies the receptor as the single-transmembrane natriuretic peptide clearance receptor (NPR-C). RT-PCR and Northern analysis demonstrated expression of the natriuretic peptide receptors NPR-C and NPR-B but not NPR-A in rabbit gastric muscle cells. In binding studies using 125I-labeled atrial natriuretic peptide (125I-ANP) and 125I-VIP as radioligands, VIP, ANP, and the selective NPR-C ligand cANP(4-23) bound with high affinity to NPR-C. ANP, cANP-(4-23), and VIP initiated identical signaling cascades consisting of Ca2+ influx, activation of eNOS via Gi1 and Gi2, stimulation of cGMP formation, and muscle relaxation. NOS activity and cGMP formation were abolished (93 ± 3 to 96 ± 2% inhibition) by nifedipine, pertussis toxin, the NOS inhibitor, NG-nitro-L-arginine, and the antagonists ANP-(1-11) and VIP-(10-28). NOS activity stimulated by all three ligands in muscle membranes was additively inhibited by Gi1 and Gi2 antibodies (82 ± 2 to 84 ± 1%). In reconstitution studies, VIP, cANP-(4-23), and guanosine 5'-O-(3-thiotriphosphate) stimulated NOS activity in membranes of COS-1 cells cotransfected with NPR-C and eNOS. The results establish a unique mechanism for G protein-dependent activation of a constitutive NOS expressed in gastrointestinal smooth muscle involving interaction of the relaxant neuropeptides VIP and PACAP with a single-transmembrane natriuretic peptide receptor, NPR-C.

endothelial nitric oxide synthase; nitric oxide; smooth muscle relaxation; natriuretic peptide receptors; cyclic nucleotides; signal transduction; vasoactive intestinal peptide; pituitary adenylate cyclase-activating peptide

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

THE HOMOLOGOUS PEPTIDE NEUROTRANSMITTERS, vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating peptide (PACAP), are potent relaxants of vascular and visceral smooth muscle (6, 32, 34). Both neuropeptides are colocalized with nitric oxide synthase (NOS) in neurons of the enteric nervous system (11): nitric oxide (NO) formed in nerve terminals regulates the release of VIP and PACAP and participates in gastric and intestinal smooth muscle relaxation (14, 18). In turn, VIP and PACAP regenerate NO in smooth muscle cells by activating a constitutive smooth muscle NOS, recently identified as endothelial NOS (eNOS) by in situ RT-PCR in single dispersed gastric smooth muscle cells and by cloning and sequence analysis (21, 29, 35).

The pathway involved in VIP/PACAP-stimulated NO formation in gastrointestinal smooth muscle is initiated by G protein-dependent stimulation of Ca2+ influx and activation of eNOS bound to calmodulin in the plasma membrane (27). In turn, NO activates soluble guanylyl cyclase, resulting in formation of cGMP and activation of cGMP-dependent protein kinase (cG-kinase) (29). VIP- or PACAP-stimulated NO formation in smooth muscle membranes is inhibited by pretreatment of muscle cells with pertussis toxin (PTx) and by incubation of smooth muscle membranes with guanosine 5'-O-(2-thiodiphosphate) (GDPbeta S) or Galpha i1-2 antibody, implying involvement of inhibitory G proteins in VIP- or PACAP-mediated activation of smooth muscle NOS (27).

Previous studies have shown that both VIP and PACAP interact with distinct, G protein-coupled receptors (29). We have recently shown that one of these receptors is the VIP2 receptor (also known as the PACAP3 receptor), which exhibits equally high affinity for VIP and PACAP and is coupled via Gs to adenylyl cyclase (1, 3, 36, 37). The identity of the receptor that mediates VIP/PACAP-dependent activation of eNOS in gastrointestinal smooth muscle is not known. Akiho et al. (2) have recently reported that VIP and the atrial natriuretic peptide (ANP) compete for binding to cecal muscle cells and that relaxation of these cells by ANP is blocked by NOS inhibitors. Neither the receptor nor the pathway involved in relaxation was identified. We have postulated that the natriuretic peptide clearance receptor (NPR-C), which can couple to inhibitory G proteins (3), could be the shared receptor with which VIP/PACAP and ANP interact to activate smooth muscle NOS. NPR-C is widely expressed and is the predominant natriuretic peptide receptor in vascular and visceral smooth muscle (4, 17, 33). The receptor exhibits high affinity for all natriuretic peptides (ANP, BNP, and CNP). The present studies provide functional and molecular evidence that VIP interacts with NPR-C, which is coupled via Gi1 and Gi2 to activation of eNOS in gastric smooth muscle cells. Reconstitution experiments in COS-1 cells cotransfected with NPR-C and eNOS confirmed the ability of VIP to activate eNOS in a G protein-dependent fashion.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Dispersion of gastric smooth muscle cells. Muscle cells were isolated from the circular muscle layer of rabbit stomach by sequential enzymatic digestion, filtration, and centrifugation as described previously (25-29). The cells were harvested by filtration through 500-µm Nitex followed by two centrifugations at 350 g for 10 min.

Binding of 125I-labeled ANP and 125I-VIP to dispersed muscle cells. Radioligand binding to dispersed muscle cells was done as described previously (25, 29). Triplicate samples (0.3 ml) of cell suspension (106 cells/ml) were incubated for 5 min with 50 pM radioligand (125I-ANP or 125I-VIP) in the presence or absence of unlabeled ligand. Bound and free radioligands were separated by rapid filtration. Nonspecific binding was 22 ± 6% of total binding for ANP and 36 ± 5% for VIP. In some experiments, binding and functional assays were done in cells enriched with NPR-C, with the use of the selective NPR-C ligand cANP-(4-23) as protective ligand (3, 22). Muscle cells were incubated with 1 µM cANP-(4-23) for 2 min at 31°C and then for 20 min with 5 µM N-ethylmaleimide (NEM) to inactivate all residual receptors (20, 25, 26). The cells were centrifuged twice for 10 min at 350 g to remove NEM and protective ligand and were resuspended in HEPES medium. Binding and relaxation were also measured after selective desensitization of VIP receptors as previously described (25, 29). The cells were incubated at 31°C for 30 min with 1 µM VIP, centrifuged twice for 10 min at 350 g, and resuspended in HEPES medium.

Measurement of cAMP, cGMP, cytosolic Ca2+, and relaxation in dispersed smooth muscle cells. cAMP and cGMP were measured by radioimmunoassay as described previously (25, 29). Agonists were added to 0.5 ml of muscle cell suspension (106 cells/ml) in the presence of 10 µM IBMX and the reaction terminated after 60 s; the results were expressed as picomoles per 106 cells above basal level. Intracellular Ca2+ concentration ([Ca2+]i) was measured in muscle cells loaded with fura 2 as described previously, and an estimate of [Ca2+]i was obtained from observed, maximal, and minimal fluorescence (25, 29). Relaxation was measured in muscle cells contracted with cholecystokinin octapeptide (CCK-8) as previously described (6, 25, 29). Relaxant agonists were added for 60 s to 0.5 ml of cell suspension (104 cells/ml); CCK-8 (1 nM) was then added for 30 s and the reaction was terminated with 1% acrolein. Relaxation was expressed as the increase in length of CCK-contracted muscle cells.

Measurement of NOS activity in dispersed muscle cells and muscle membranes. NOS activity in dispersed muscle cells was measured from the formation of L-[3H]citrulline in cells loaded with L-[3H]arginine as previously described (8, 25, 29). L-[3H]arginine (3 µCi/ml) was added to 1 ml of cell suspension for 10 min; the cells were treated during the last minute with ANP, cANP-(4-23), or VIP (1 µM). L-[3H]citrulline formation was expressed as counts per minute (cpm) per 106 cells above basal levels measured in separate samples.

NOS activity was also measured by a modification of the method of Bush et al. (9) in membrane fractions prepared from dispersed muscle cells as previously described (27). Membrane protein (0.4 mg) was incubated for 15 min at 31°C in 50 mM Tris · HCl buffer (pH 7.4) containing 50 µM L-arginine and ~150,000 cpm of L-[3H]arginine (sp act 58.7 Ci/mmol), 1 mM NADPH, 1 mM DTT, 4 µM FMN, 4 µM FAD, 10 µM tetrahydrobiopterin, 2 µg calmodulin (10 µg/ml), and Ca2+ (0.1 mM) in a final volume of 200 µl. In some experiments, the medium contained 100 µM GTP, 5 mM creatine phosphate, and 50 U/ml creatine phosphokinase. L-[3H]citrulline formation was expressed as picomoles L-citrulline per milligram protein per minute.

Identification of G proteins activated by VIP, ANP, and cANP-(4-23). G proteins selectively activated by ANP, cANP-(4-23), or VIP were identified by an adaptation of the method of Okamoto et al. (30) as previously described (26). Muscle membranes were solubilized in CHAPS and incubated at 37°C with 60 nM [35S]GTPgamma S in a medium containing 10 mM HEPES (pH 7.4), 100 µM EDTA, and 10 mM MgCl2. After the reaction was stopped, the solubilized membranes were placed in wells precoated with specific antibodies to Galpha i1, Galpha i2, Galpha i3, Galpha s, and Galpha q/11. After incubation for 2 h on ice, the wells were washed three times with phosphate buffer solution containing 0.05% Tween-20, and the radioactivity in each well was counted.

Expression of natriuretic peptide receptor subtypes in smooth muscle cells. Expression of natriuretic peptide receptor subtypes was determined by RT-PCR and Northern blotting and confirmed for NPR-C by cloning and cDNA sequencing of the PCR product. Total RNA was isolated from freshly dispersed and cultured (first passage) gastric smooth muscle cells, and 6 µg were reverse transcribed in a reaction volume of 20 µl containing 50 mM Tris · HCl (pH 8.3), 75 mM KCl, 3.0 mM MgCl2, 10 mM dithiothreitol, 0.5 mM dNTP, 2.5 µM random hexamers, and 200 units of RT. Three microliters of reverse transcribed cDNA were amplified by PCR (35 cycles) under standard conditions with specific primers for human NPR-A [CAAGCGCTCATGCTCTACGCCTAC (sense), GATGTTCTCCCCATCAGTAACAGTTC (antisense)] and NPR-B [GTGGCCCGCTTTGCCTCCCACTGG (sense), GGTGAAGTAGTGAGGCCGGTC (antisense)] and for bovine NPR-C [CTTCTATGGAGATGGCT (sense), TGCTTTGCAAGGAGAGC (antisense)] (10, 15). The amplified PCR products were analyzed on 1% agarose gel containing 0.1 µg/ml ethidium bromide. Cloned cDNAs for rat NPR-A, NPR-B, and NPR-C were used as positive controls for PCR under the same conditions. The PCR product obtained with NPR-C-specific primers was purified by electrophoresis on 1% agarose gel and was cloned into pCR II vector (Invitrogen). The nucleotide sequence was determined for cDNA inserts on both strands by a DNA sequencer. For Northern analysis, 20 µg of total RNA were fractionated by electrophoresis in 1.1% formaldehyde agarose gel and transferred to a nylon membrane. cDNA inserts for NPR-A and NPR-B using full-length rat cDNA, and for NPR-C using the cloned 541-bp RT-PCR product, were labeled with 32P using random hexamers as a probe. Hybridization was carried out under standard conditions, and autoradiography was performed at -80°C for 12 h.

Expression of NPR-C and eNOS in COS-1 cells. The 3.7 kb of bovine eNOS cDNA and the 1.7 kb of rat NPR-C cDNA cloned at the EcoR I site of pBluescript were digested with EcoR I and purified by agarose gel. The purified cDNA inserts were subcloned into the mammalian expression vector pCDL-SRalpha at the EcoR I site in the sense orientation. COS-1 cells (2-2.5 × 106) were transfected with 15 µg of eNOS cDNA or cotransfected with 15 µg each of eNOS and NPR-C cDNA in pCDL-SRalpha using the calcium phosphate precipitation method. Control COS-1 cells were transfected with equal amounts of pCDL-SRalpha vector without insert under the same conditions. The transfected cells were maintained in culture for 72-96 h. Expression was confirmed by RT-PCR and Northern blotting for NPR-C and eNOS. For RT-PCR, the specific primers for eNOS were CAGAGCTACGCTCAGCAG (sense) and CGGGGAGCTGTTGTAGGG (antisense) (21), and the specific primers for NPR-C were TGGAGGTGAAAAGTTCTGTTG (sense) and GTCATGGCAACCACAGAGAA (antisense) (14).

Materials. ANP, cANP-(4-23), VIP, and CCK-8 were obtained from Bachem (Torrance, CA); KT-5823 was from Kamiya Biomedical (Thousand Oaks, CA); LY-83583, calmidazolium, and H-89 were from Calbiochem; fura 2-AM was from Molecular Probes; L-[3H]arginine, 125I-VIP, 125I-ANP, 125I-cAMP, and 125I-cGMP were from New England Nuclear; NG-nitro-L-arginine (L-NNA) and all other chemicals were from Sigma Chemical. NPR-A and NPR-B cDNAs were kind gifts from Dr. David L. Garbers (University of Texas Southwestern Medical Center); NPR-C cDNA was a kind gift from Dr. David G. Lowe (Genentech); and eNOS cDNA was a kind gift from Dr. Thomas Michel (Harvard Medical School).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Selective expression of NPR-C and NPR-B in gastric smooth muscle cells. RT-PCR on RNA extracted from cultured gastric muscle cells in first passage using NPR-C- and NPR-B-specific primers yielded products of the expected size (541 and 228 bp, respectively; Fig. 1). No PCR product was obtained using NPR-A-specific primers. Northern analysis on RNA from freshly dispersed and cultured smooth muscle cells detected a single mRNA transcript for NPR-B (4.0 kb), a main transcript for NPR-C (7.9 kb) with some of smaller size (<3 kb), but none for NPR-A. Cloning and sequence analysis of the PCR product obtained with NPR-C-specific primers showed close similarity of the predicted amino acid sequences in rabbit to those in bovine (94%), human (93%), and rat (92%) proteins.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1.   Expression of natriuretic peptide clearance receptor (NPR-C) and NPR-B in freshly dispersed and cultured gastric smooth muscle cells. Total RNA was isolated from freshly dispersed and cultured (first passage) rabbit gastric smooth muscle cells and reverse transcribed. The cDNA was amplified with specific bovine NPR-C primers and human NPR-A and NPR-B primers. Experiments were done in the presence and absence of RT. A: PCR products of expected size were obtained with NPR-C and NPR-B primers but not NPR-A primers. B: transcripts corresponding to NPR-B (4.0 kb) and NPR-C (7.9 kb) but not NPR-A were detected by Northern analysis in freshly dispersed (lane 1) and cultured gastric smooth muscle cells (lane 2). MW, molecular weight.

Binding of 125I-VIP and 125I-ANP to dispersed smooth muscle cells. Both 125I-VIP and 125I-ANP bound with high affinity to dispersed muscle cells, with IC50 values of 4 ± 1 and 24 ± 6 nM, respectively (Fig. 2). The competition binding curves could be resolved into high-affinity and low-affinity binding sites with dissociation constant values of 0.16 ± 0.03 and 40.2 ± 6.2 nM for VIP and 0.23 ± 0.4 and 155 ± 65 nM for ANP.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2.   Characteristics of 125I-labeled atrial natriuretic peptide (125I-ANP; A) and vasoactive intestinal peptide (125I-VIP; B) binding to dispersed smooth muscle cells. Specific 125I-ANP binding was completely inhibited by ANP and partially by VIP and cANP-(4-23). Specific 125I-VIP binding was completely inhibited by VIP and partially by ANP and cANP-(4-23). Triplicate samples (0.3 × 106 cells) were incubated for 5 min with 50 pM 125I-ANP or 125I-VIP alone or in the presence of unlabeled ligand. Bound and free radioligands were separated by rapid filtration followed by repeated washing (4 times) with ice-cold HEPES medium containing 0.2% BSA. Nonspecific 125I-VIP and 125I-ANP binding was 36 ± 5 and 22 ± 6%, respectively. Values are means ± SE of 5 experiments.

125I-ANP binding was partly (47-55%) inhibited by VIP and the selective NPR-C ligand, cANP-(4-23), whereas 125I-VIP binding was partly (55-61%) inhibited by ANP and cANP-(4-23) (Fig. 2). The pattern implied that both ANP and VIP bound with high affinity to NPR-C receptors selectively recognized by cANP-(4-23). VIP bound also to receptors (i.e., VIP2/PACAP3) that were not recognized by ANP or cANP(4-23), whereas ANP bound also to receptors (i.e., NPR-B) that were not recognized by VIP or cANP(4-23).

The pattern of binding was corroborated by studies in which the VIP2/PACAP3 receptors were selectively desensitized or inactivated. Previous studies had shown that the VIP2/PACAP3 receptors coupled to adenylyl cyclase in smooth muscle were readily desensitized, whereas the unidentified receptors coupled to NOS were more resistant to desensitization (25, 29). Selective desensitization of VIP2/PACAP3 receptors by exposure to VIP for 30 min decreased 125I-VIP binding by 52 ± 2% but had no effect on 125I-ANP binding; residual 125I-VIP binding was completely inhibited by ANP and cANP-(4-23). Exposure of the cells to ANP for 30 min had no effect on 125I-ANP or 125I-VIP binding (data not shown). In muscle cells treated for 2 min with cANP(4-23) so as to protect NPR-C, and then for 20 min with NEM to inactivate all unprotected receptors, levels of both 125I-VIP and 125I-ANP binding were decreased (40 ± 5 and 42 ± 4%, respectively); residual 125I-VIP and 125I-ANP binding was abolished by VIP, ANP, or cANP-(4-23), implying that VIP and ANP can bind to NPR-C, from which they could be displaced by VIP, ANP, or the selective NPR-C ligand, cANP-(4-23).

Signaling cascade initiated by activation of NPR-C receptors. Both ANP and cANP-(4-23) increased [Ca2+]i, NOS activity, and cGMP formation in dispersed muscle cells. The increases in [Ca2+]i induced by ANP and cANP-(4-23) (145 ± 34 and 169 ± 32 nM, respectively, above a resting [Ca2+]i of 60 ± 5 nM), NOS activity (73 ± 11 and 61 ± 8% above basal levels, respectively), and cGMP formation (82 ± 13 and 75 ± 4% above basal level, respectively) were abolished by nifedipine (1 µM; Fig. 3).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Inhibition of nitric oxide synthase (NOS; A) activity and cGMP formation (B) in dispersed smooth muscle cells by blockade of various steps in the signaling pathway. Smooth muscle cells were stimulated with ANP (1 µM) or cANP-(4-23) (1 µM) after treatment for 60 min with pertussis toxin (PTx; 800 ng/ml) or for 10 min with nifedipine (1 µM), NG-nitro-L-arginine (L-NNA; 100 µM), or calmidazolium (Calmidaz; 1 µM). NOS activity was expressed as counts per minute (cpm) of L-[3H]citrulline/106 cells above basal level (1,064 ± 127 cpm L-[3H]citrulline/106 cells), and cGMP formation was measured by radioimmunoassay and expressed as pmol/106 cells above basal level (0.6 ± 0.2 pmol/106 cells). Values are means ± SE of 3-5 experiments.

NOS activity and cGMP formation stimulated by ANP and cANP-(4-23) were inhibited also by 1) PTx (Fig. 3), 2) the NOS inhibitor L-NNA (Fig. 3), 3) the calmodulin antagonist calmidazolium (Fig. 3), and 4) VIP and ANP receptor antagonists [VIP-(10-28) and ANP-(1-11)] (Fig. 4).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   Inhibition of NOS activity, cGMP formation, and muscle relaxation in dispersed smooth muscle cells by ANP and VIP receptor antagonists. Smooth muscle cells were stimulated with cANP-(4-23) (1 µM) in the presence and absence of VIP-(10-28) (10 µM) or ANP-(1-11) (10 µM). NOS activity and cGMP formation were expressed as percent increase above basal level, and relaxation as percent increase in the length of muscle cells precontracted with cholecystokinin octapeptide. Identical results (not shown) were obtained with ANP (1 µM). Values are means ± SE of 3-5 experiments.

Relaxation of dispersed smooth muscle cells induced by ANP and cANP-(4-23) was also inhibited by PTx, nifedipine, L-NNA, ANP-(1-11), and VIP-(10-28) (range 93 ± 3 to 96 ± 2% inhibition). Both cGMP formation and muscle relaxation were completely inhibited (95 ± 2 and 96 ± 3%) by the soluble guanylyl cyclase inhibitor LY-83583 (1 µM). KT-5823, a selective inhibitor of cG-kinase when used at a concentration of 1 µM (28), abolished muscle relaxation elicited by ANP and cANP-(4-23) but only partly inhibited muscle relaxation induced by VIP; residual muscle relaxation by VIP was abolished by H-89, a selective inhibitor of cA-kinase (data not shown). Relaxation induced by VIP was also inhibited by VIP-(10-28) (78 ± 8% inhibition) and ANP-(1-11) (53 ± 5%).

The patterns of stimulation of [Ca2+]i, NOS activity, and cGMP formation by ANP and cANP-(4-23) and inhibition of both responses by various agents were identical to those previously reported for VIP and PACAP (25, 29). The signaling cascade was triggered by agonist-induced Ca2+ influx and mediated by a Ca2+/calmodulin-dependent NOS. It is noteworthy that cGMP formation and relaxation by ANP were abolished by inhibitors of NOS and soluble guanylyl cyclase, implying that ANP interacted preferentially with NPR-C, for which it has high affinity, triggering a cascade involving NO-dependent activation of soluble guanylyl cyclase. ANP has a much lower affinity (2 × 103 times less) for NPR-B, the only natriuretic peptide receptor/guanylyl cyclase expressed in gastric muscle cells (Fig. 1) (5, 33).

Receptor binding and signal transduction in muscle cells enriched with NPR-C. 125I-VIP and 125I-ANP binding, cGMP and cAMP formation, and muscle relaxation were also measured in smooth muscle cells in which NPR-C was selectively preserved, and all other receptors including NPR-B and VIP2/PACAP3 receptors were inactivated. In these cells, control 125I-ANP and 125I-VIP binding decreased and the residual binding was abolished by VIP, cANP-(4-23), and ANP. The pattern of binding confirmed that VIP and ANP were capable of interacting with NPR-C. cGMP formation stimulated by ANP, cANP-(4-23), and VIP was not affected in these cells (control: 0.46 ± 0.08 to 0.56 ± 0.06 pmol/106 cells above basal level; cells with NPR-C only: 0.42 ± 0.08 to 0.51 ± 0.10 pmol/106 cells), whereas cAMP formation stimulated by VIP was abolished (control: 5.8 ± 1.1 pmol/106 cells above basal levels; cells with NPR-C only: 0.2 ± 0.1 pmol/106 cells). Muscle cell relaxation induced by ANP and cANP-(4-23) was not affected, whereas relaxation induced by VIP was decreased by 43 ± 5%; the decrease reflected suppression of the relaxant component mediated by VIP2/PACAP3 receptors coupled to adenylyl cyclase. The relaxant responses to all three agonists in cells where only NPR-C was preserved were abolished by L-NNA.

Identification of G proteins coupled to NPR-C. In membranes isolated from dispersed muscle cells, ANP and cANP-(4-23) (in the presence of GTP) stimulated NOS activity over and above maximal NOS activity stimulated by 100 µM Ca2+; NOS activity stimulated by Ca2+ and agonists was virtually abolished by L-NNA (93 ± 2% inhibition). Previous studies on gastric smooth muscle membranes (27) had shown that VIP, PACAP, and GTPgamma S stimulated NOS activity in a concentration-dependent fashion and that pretreatment of the cells with PTx before membrane isolation abolished agonist-stimulated NOS activity, implying involvement of an inhibitory G protein in the activation of gastric smooth muscle NOS; incubation of smooth muscle membranes with a common antibody to Galpha i1-2 inhibited VIP- and PACAP-stimulated NOS activity. In the present study, incubation of smooth muscle membranes for 60 min with Galpha i1 antibody (10 µg/ml) inhibited NOS activity stimulated by ANP and cANP-(4-23) (by 61 ± 2 to 63 ± 3%; P < 0.001), whereas incubation with Galpha i2 antibody (10 µg/ml) inhibited NOS activity (by 30 ± 5 to 31 ± 10%; P < 0.05); incubation with both antibodies elicited additive inhibition (82 ± 2 and 82 ± 1%; P < 0.001; Fig. 5). Although VIP-stimulated NOS activity was higher, the percentage of inhibition by Galpha i1 antibody (56 ± 2%; P < 0.001), Galpha i2 antibody (29 ± 2%; P < 0.001), or a combination of both antibodies (84 ± 3%; P < 0.001) was similar to that observed with ANP or cANP-(4-23) (Fig. 5). Incubation with Galpha s, Galpha o, Galpha q/11, and Galpha i3 antibodies had no significant effect (1 ± 6 to 5 ± 10% inhibition).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of NOS activity stimulated by cANP-(4-23), ANP, and VIP in muscle membranes by antibodies to Galpha i1 and Galpha i2. NOS activity in membranes was determined from the conversion of L-[3H]arginine to L-[3H]citrulline as previously described (Refs. 9 and 27; see MATERIALS AND METHODS). The results represent the increase in NOS activity (pmol citrulline · mg protein-1 · min-1) stimulated by ANP, cANP-(4-23), and VIP over and above maximal NOS activity stimulated by 0.1 mM Ca2+ (28.3 ± 3.7 pmol L-citrulline · mg protein-1 · min-1). Agonist-induced increase in NOS activity was partly inhibited by incubation for 60 min with Galpha i1 or Galpha i2 antibody (Ab; 10 µg/ml each) and abolished by the combination of both antibodies. Antibodies were used at concentrations (10 µg/ml) previously shown to be maximally effective in blocking the response mediated by the corresponding G protein (26, 41). Values are means ± SE of 4 experiments. Inhibition of NOS activity: ** P < 0.01.

The selective activation of Gi1 and Gi2 by ANP, cANP-(4-23), and VIP revealed by blockade of NOS activity on neutralization with Galpha i1 and Galpha i2 antibodies was confirmed by direct measurement of activation of both G proteins. In solubilized smooth muscle membranes, both ANP and cANP-(4-23) caused a significant increase in the binding of [35S]GTPgamma S to Galpha i1 and Galpha i2 (determined from the binding of a [35S]GTPgamma S · Galpha complex to the corresponding Galpha antibody) but not to Galpha s, Galpha i3, Galpha o, or Galpha q/11 (Table 1). VIP and PACAP also caused a significant increase in the binding of [35S]GTPgamma S to Galpha i1 and Galpha i2, as well as to Galpha s (Table 1); the binding to Galpha s reflected activation of VIP2/PACAP3 receptors coupled to adenylyl cyclase.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Binding of agonist-stimulated GTPgamma S.Galpha complexes in muscle membranes to G protein antibodies

Activation of eNOS by VIP and cANP-(4-23) in COS-1 cells cotransfected with NPR-C and eNOS. Decisive evidence demonstrating the ability of VIP to interact with NPR-C and activate eNOS was obtained in reconstitution experiments using COS-1 cells cotransfected with NPR-C and eNOS. Expression of NPR-C and eNOS in COS-1 cells was identified by RT-PCR and Northern analysis (Fig. 6, A and B). In membranes from COS-1 cells cotransfected with NPR-C and eNOS, but not in membranes from wild-type COS-1 cells, VIP and cANP-(4-23) (in the presence of 100 µM GTP) and GTPgamma S (100 µM) stimulated NOS activity [VIP: 3.4 ± 0.7, cANP-(4-23): 3.0 ± 0.6, and GTPgamma S: 3.8 ± 0.4 pmol L-citrulline · mg protein-1 · min-1] above maximal Ca2+-induced activity. NOS activity stimulated by these agents or Ca2+ was abolished by L-NNA (Fig. 7B). In contrast, in membranes from COS-1 cells transfected with eNOS only, GTPgamma S stimulated NOS activity (4.3 ± 0.5 pmol L-citrulline · mg protein-1 · min-1) above maximal Ca2+-induced activity, whereas neither VIP nor cANP-(4-23) had any significant effect (Fig. 7A).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 6.   Transfection of COS-1 cells with endothelial NOS (eNOS) and NPR-C. A: RT-PCR using rat NPR-C and bovine eNOS specific primers on RNA derived from wild-type (WT) COS-1 cells and COS-1 cells cotransfected with NPR-C and eNOS. PCR products of expected size (NPR-C, 256 bp; eNOS, 210 bp) were detected. Full-length rat NPR-C and bovine eNOS cDNA were used as controls. B: Northern blots demonstrating NPR-C and eNOS transcripts in COS-1 cells cotransfected with eNOS and NPR-C.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7.   Stimulation of NOS activity in membranes from COS-1 cells transfected with eNOS (A) or cotransfected with eNOS and NPR-C (B). NOS activity in membranes was determined as described in legend to Fig. 5. A: in membranes from COS-1 cells transfected with eNOS only, GTPgamma S (100 µM) but not VIP (1 µM) or cANP-(4-23) (1 µM) stimulated NOS activity over activity induced by 100 µM Ca2+ (8.1 ± 0.4 pmol L-citrulline/mg protein); NOS activity was abolished by L-NNA. Values are means ± SE of 4 experiments. B: in membranes from COS-1 cells cotransfected with eNOS and NPR-C, VIP (1 µM) and cANP-(4-23) (1 µM) (in the presence of GTP) and GTPgamma S (100 µM) stimulated NOS activity over activity induced by 100 µM Ca2+ (7.8 ± 0.5 pmol L-citrulline/mg protein); NOS activity was abolished by L-NNA. Values are means ± SE of 5 experiments. * P < 0.05; ** P < 0.01.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

This study establishes the mechanism whereby the neurotransmitter peptide VIP activates the constitutive NOS isoform (eNOS) expressed in gastrointestinal smooth muscle cells (35). In this unique instance, NOS acts as a membrane-bound effector enzyme directly activated by two G proteins (Gi1 and Gi2) that couple to the cytoplasmic domain of a single-transmembrane receptor, the natriuretic peptide clearance receptor (NPR-C). In other tissues, G protein-coupled seven-transmembrane receptors transduce the Ca2+ signals required for activation of constitutive neuronal NOS (7, 8, 23) or eNOS (24, 31), whereas in gastrointestinal smooth muscle, a G protein-coupled single-transmembrane receptor mediates both Ca2+ influx and direct activation of eNOS. As previously shown (27) and confirmed in this study, direct, G protein-dependent activation of NOS is evident in smooth muscle membranes and could be reproduced in membranes from COS-1 cells transfected with eNOS or cotransfected with eNOS and NPR-C.

As depicted in Fig. 8, VIP and PACAP interact with cognate seven-transmembrane receptors (VIP2/PACAP3) coupled via Gs to adenylyl cyclase (27, 36) and with single-transmembrane receptors (NPR-C) coupled via Gi1 and Gi2 to smooth muscle eNOS. Although the NPR-C is devoid of cytoplasmic guanylyl cyclase and kinase domains and normally serves to internalize and degrade natriuretic peptides, its truncated 37-amino acid carboxy terminal appears to activate inhibitory G proteins coupled to various effector enzymes (3, 12, 16, 19). The NPR-C-mediated coupling of Gi1 and Gi2 results in activation of smooth muscle eNOS.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8.   Dual signaling cascades initiated by interaction of VIP or pituitary adenylate cyclase-activating peptide (PACAP) with single-transmembrane NPR-C and seven-transmembrane VIP2/PACAP3 receptors. The NPR-C cascade involves G protein (Gi1 and Gi2)-dependent stimulation of Ca2+ influx and activation of a membrane-bound eNOS. Generation of NO leads to sequential activation of soluble guanylyl cyclase (GC) and cGMP-dependent protein kinase (cG-kinase). cG-kinase (activated by cGMP and cross-activated by cAMP) and cAMP-dependent protein kinase (cA-kinase) are jointly responsible for smooth muscle relaxation.

Evidence for the involvement of NPR-C in mediating activation of eNOS by VIP is based on 1) radioligand binding studies demonstrating interaction of VIP with a complement of receptors recognized by the selective NPR-C ligand, cANP-(4-23); 2) pharmacological evidence that cANP-(4-23) and VIP initiate identical signaling cascades involving coupling to specific G proteins (Gi1 and Gi2); 3) blockade of the signaling cascades with both VIP and ANP antagonists; and 4) reconstitution experiments in which VIP was shown to activate eNOS in COS-1 cells cotransfected with NPR-C and eNOS.

The steps in the cascade leading to NO formation initiated by the selective NPR-C agonist, cANP-(4-23), as well as by ANP, which has high affinity for NPR-C (3, 5, 22, 33), are identical to those initiated by VIP (Fig. 8) (25, 27, 29). cANP-(4-23) interacted exclusively with NPR-C, whereas ANP interacted with both NPR-C and NPR-B (the only other natriuretic peptide expressed in gastric muscle), and VIP interacted with both NPR-C and VIP2/PACAP3 receptors. This conclusion was confirmed by functional and binding studies in naive cells and in cells where only NPR-C was preserved by selective receptor protection, or where VIP2/PACAP3 receptors were selectively eliminated by desensitization.

NOS activity and cGMP formation stimulated by VIP/PACAP, cANP-(4-23), and ANP (25, 29) were abolished by PTx, implying that they were mediated by one or more inhibitory G proteins. Previous studies had shown that NOS activity stimulated by VIP and PACAP in muscle membranes was inhibited by a common antibody to Galpha i1 and Galpha i2 (27). In the present study, specific antibodies to Galpha i1 and Galpha i2 inhibited NOS activity stimulated by VIP, cANP-(4-23), and ANP. The effects of both antibodies when used at optimal concentrations were additive, causing >80% inhibition of NOS activity. Selective activation of Gi1 and Gi2 by ANP and cANP-(4-23) was corroborated by direct measurement of Galpha i1 and Galpha i2 binding to [35S]GTPgamma S. VIP activated both Gi1 and Gi2 as well as Gs, which couples VIP2/PACAP3 receptors to adenylyl cyclase.

Reconstitution experiments using membranes derived from COS-1 cells cotransfected with eNOS and NPR-C confirmed that VIP and cANP-(4-23) stimulate NOS activity in a G protein-dependent fashion, over and above NOS activity stimulated by a maximally effective concentration of Ca2+ (27). Consistent with involvement of a G protein, GTPgamma S alone stimulated NOS activity in membranes from COS-1 cells transfected with eNOS only (Fig. 7A) or cotransfected with eNOS and NPR-C (Fig. 7B). Previous studies (27) on membranes isolated from dispersed gastric muscle cells showed that GTPgamma S, VIP, and PACAP stimulated NOS activity in a concentration-dependent fashion and that NOS activity was abolished by GDPbeta S.

In summary, the relaxant neuropeptides, VIP and PACAP, initiate dual signaling cascades by interacting with seven-transmembrane VIP2/PACAP3 receptors coupled via Gs to activation of adenylyl cyclase and single-transmembrane natriuretic receptors (NPR-C) coupled via Gi1 and Gi2 to activation of membrane-bound, Ca2+/calmodulin-dependent eNOS. The signaling cascades make optimal use of the cyclic nucleotide system in smooth muscle and underlie the potency of VIP and PACAP as relaxant neurotransmitters.

    ACKNOWLEDGEMENTS

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-28300.

    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: G. M. Makhlouf, PO Box 980711, Medical College of Virginia, Richmond, VA 23298-0711.

Received 13 July 1998; accepted in final form 1 September 1998.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Adamou, J. E., N. Aiyar, S. Van Horn, and N. A. Elshourbagy. Cloning and functional characterization of the human intestinal peptide (VIP2) receptor. Biochem. Biophys. Res. Commun. 209: 385-392, 1995[Medline].

2.   Akiho, H., Y. Chijiiwa, H. Okabe, N. Harada, and H. Nawata. Interaction between atrial natriuretic peptide and vasoactive intestinal peptide in guinea pig cecal smooth muscle. Gastroenterology 109: 1105-1112, 1995[Medline].

3.   Anand-Srivastava, M. B., P. D. Sehl, and D. G. Lowe. Cytoplasmic domain of natriuretic peptide receptor-C inhibits adenylyl cyclase: involvement of a pertussis toxin-sensitive G protein. J. Biol. Chem. 271: 19324-19329, 1996[Abstract/Free Full Text].

4.   Anand-Srivastava, M. B., and G. J. Trachte. Atrial natriuretic factor receptors and signal transduction mechanisms. Pharmacol. Rev. 45: 455-497, 1993[Medline].

5.   Bennett, B. D., G. L. Bennett, R. V. Vitangcol, J. R. S. Jewett, J. Burnier, W. Henzel, and D. G. Lowe. Extracellular domains-IgG fusion for three human natriuretic peptide receptors. J. Biol. Chem. 266: 23060-23067, 1991[Abstract/Free Full Text].

6.   Bitar, K. N., and G. M. Makhlouf. Relaxation of isolated gastric smooth muscle cells by vasoactive intestinal peptide. Science 216: 531-533, 1982[Abstract/Free Full Text].

7.   Bredt, D. S., P. M. Hwang, and S. H. Snyder. Localization of nitric oxide synthase indicating a neuronal role for nitric oxide. Nature 347: 768-770, 1990[Medline].

8.   Bredt, D. S., and S. H. Snyder. Isolation of nitric oxide synthetase, a calmodulin requiring enzyme. Proc. Natl. Acad. Sci. USA 87: 682-685, 1990[Abstract/Free Full Text].

9.   Bush, P. A., N. E. Gonzalez, and L. J. Ignarro. Nitric oxide synthase from cerebellum catalyzes the formation of equimolar quantities of nitric oxide and citrulline from L-arginine. Biochem. Biophys. Res. Commun. 186: 308-314, 1992[Medline].

10.   Canaan-Kuhl, S., B. D. Jamison, R. E. Myers, and R. Pratt. Identification of "B" receptor for natriuretic peptide in human kidney. Endocrinology 130: 550-552, 1992[Abstract/Free Full Text].

11.   Costa, M., J. B. Furness, S. Pompolo, S. J. H. Brookes, J. C. Bornstein, D. S. Bredt, and S. H. Snyder. Projections and chemical coding of neurons with immunoreactivity for nitric oxide synthase in guinea pig small intestine. Neurosci. Lett. 148: 121-125, 1992[Medline].

12.   Drewett, J. G., and D. L. Garbers. The family of guanylyl cyclase receptors and their ligands. Endocr. Rev. 15: 135-162, 1994[Abstract/Free Full Text].

13.   Engel, A. M., J. R. Schoenfeld, and D. G. Lowe. A single residue determines the distinct pharmacology of rat and human natriuretic peptide receptor-C. J. Biol. Chem. 269: 17005-17008, 1994[Abstract/Free Full Text].

14.   Grider, J. R., and J.-G. Jin. VIP release and L-citrulline production from isolated ganglia of the myenteric plexus: regulation of VIP release by nitric oxide. Neuroscience 54: 521-526, 1993[Medline].

15.   Hagiwara, H., H. Sakaguchi, K. M. Lodhi, K. Suda, and S. Hirose. Subtype switching of natriuretic peptide receptors in rat chondrocytes during in vitro culture. J. Biochem. 116: 606-609, 1994[Abstract/Free Full Text].

16.   Hirata, M., C.-H. Chang, and F. Murad. Stimulatory effects of atrial natriuretic factor on phosphoinositide hydrolysis in cultured bovine aortic smooth muscle cells. Biochim. Biophys. Acta 1010: 346-351, 1989[Medline].

17.   Jamison, R. L., S. Canaan-Kuhl, and R. Pratt. Physiology and cell biology update: the natriuretic peptides and their receptors. Am. J. Kidney Dis. 10: 519-530, 1992.

18.   Jin, J.-G., K. S. Murthy, J. R. Grider, and G. M. Makhlouf. Stoichiometry of neurally induced VIP release, NO formation, and relaxation in rabbit gastric muscle. Am. J. Physiol. 271 (Gastrointest. Liver Physiol. 34): G357-G369, 1996[Abstract/Free Full Text].

19.   Koller, K. J., and D. V. Goeddel. Molecular biology of the natriuretic peptides and their receptors. Circulation 86: 1081-1088, 1992[Abstract/Free Full Text].

20.   Kuemmerle, J. F., D. C. Martin, K. S. Murthy, J. M. Kellum, J. R. Grider, and G. M. Makhlouf. Co-existence of contractile and relaxant 5-HT receptors coupled to distinct signaling pathways in intestinal muscle cells: convergence of the pathways on Ca2+ mobilization. Mol. Pharmacol. 42: 1090-1096, 1992[Abstract].

21.   Lamas, S., P. A. Marsden, G. K. Li, P. Tempst, and T. Michel. Endothelial nitric oxide synthase: molecular cloning and characterization of a distinct constitutive enzyme isoform. Proc. Natl. Acad. Sci. USA 89: 6348-6352, 1992[Abstract/Free Full Text].

22.   Maack, T., M. Suzuki, F. A. Almeida, D. Nussenzveig, R. M. Scarborough, G. A. McEnroe, and J. A. Lewicki. Physiological role of silent receptors of atrial natriuretic factor. Science 238: 675-678, 1987[Abstract/Free Full Text].

23.   Moncada, S., R. M. J. Palmer, and E. A. Higgs. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev. 43: 109-142, 1991[Medline].

24.   Murad, F. The nitric oxide-cyclic GMP signal transduction system for intracellular and intercellular communication. Recent Prog. Horm. Res. 49: 239-248, 1994.

25.   Murthy, K. S., J.-G. Jin, J. R. Grider, and G. M. Makhlouf. Characterization of PACAP receptors and signaling pathways in rabbit gastric muscle cells. Am. J. Physiol. 272 (Gastrointest. Liver Physiol. 35): G1391-G1399, 1997[Abstract/Free Full Text].

26.   Murthy, K. S., and G. M. Makhlouf. Differential coupling of muscarinic m2 and m3 receptors to adenylyl cyclases V/VI in smooth muscle. Concurrent m2-mediated inhibition via Galpha i3 and m3-mediated stimulation via Gbeta gamma q. J. Biol. Chem. 272: 21317-21324, 1997[Abstract/Free Full Text].

27.   Murthy, K. S., and G. M. Makhlouf. VIP/PACAP-mediated activation of membrane-bound NO synthase in smooth muscle is mediated by pertussis toxin-sensitive Gi1-2. J. Biol. Chem. 269: 15977-15980, 1994[Abstract/Free Full Text].

28.   Murthy, K. S., and G. M. Makhlouf. Interaction of cA-kinase and cG-kinase in mediating relaxation of dispersed smooth muscle cells. Am. J. Physiol. 268 (Cell Physiol. 37): C171-C180, 1995[Abstract/Free Full Text].

29.   Murthy, K. S., K.-M. Zhang, J.-G. Jin, J. R. Grider, and G. M. Makhlouf. VIP-mediated and G protein-coupled Ca2+ influx activates a constitutive NOS in dispersed gastric muscle cells. Am. J. Physiol. 265 (Gastrointest. Liver Physiol. 28): G660-G671, 1993[Abstract/Free Full Text].

30.   Okamoto, T., T. Ikezu, Y. Murayama, E. Ogata, and I. Nishimoto. Measurement of GTPgamma S binding to specific G proteins in membranes using G-protein antibodies. FEBS Lett. 305: 125-128, 1992[Medline].

31.   Palmer, R. M. J., A. G. Ferrige, and S. Moncada. Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature 327: 524-526, 1987[Medline].

32.   Said, S. I., and V. Mutt. Isolation from porcine intestinal wall of an active octacosapeptide related to secretin and to glucagon. Eur. J. Biochem. 28: 199-204, 1972[Medline].

33.   Suga, S.-I., K. Nakao, K. Hosoda, M. Mukoyama, Y. Ogawa, G. Shirakami, Y. Saito, Y. Kambayashi, K. Inoue, and H. Imura. Receptor selectivity of natriuretic peptide family, atrial natriuretic peptide, brain natriuretic peptide, and C-type natriuretic peptide. Endocrinology 130: 229-239, 1992[Abstract/Free Full Text].

34.   Sundler, F., E. Ekbald, A. Absood, A. Hakanson, K. Koves, and A. Arimura. Pituitary adenylate cyclase activating peptide: a novel intestinal peptide-like neuropeptide in the gut. Neuroscience 46: 439-454, 1992[Medline].

35.   Teng, B.-Q., K. S. Murthy, J. F. Kuemmerle, J. R. Grider, and G. M. Makhlouf. Expression of endothelial nitric oxide synthase in human and rabbit gastrointestinal smooth muscle cells. Am. J. Physiol. 275 (Gastrointest. Liver Physiol. 38): G342-G351, 1998[Abstract/Free Full Text].

36.   Teng, B.-Q., K. S. Murthy, J. F. Kuemmerle, J. R. Grider, and G. M. Makhlouf. Selective expression of VIP2/PACAP3 receptors in rabbit and guinea pig gastric and tenia coli smooth muscle cells. Regul. Pept. 77: 127-134, 1998[Medline].

37.   Usdin, T. B., T. I. Bonner, and E. Mezey. Two receptors for vasoactive intestinal polypeptide with similar specificity and complementary distribution. Endocrinology 135: 2662-2680, 1994[Abstract].


Am J Physiol Cell Physiol 275(6):C1409-C1416
0002-9513/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
M. William, E. J. Hamilton, A. Garcia, H. Bundgaard, K. K. M. Chia, G. A. Figtree, and H. H. Rasmussen
Natriuretic peptides stimulate the cardiac sodium pump via NPR-C-coupled NOS activation
Am J Physiol Cell Physiol, April 1, 2008; 294(4): C1067 - C1073.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
R. A. Rose and W. R. Giles
Natriuretic peptide C receptor signalling in the heart and vasculature
J. Physiol., January 15, 2008; 586(2): 353 - 366.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Zhou, J. Huang, and K. S. Murthy
Molecular cloning and functional expression of a VIP-specific receptor.
Am J Physiol Gastrointest Liver Physiol, October 1, 2006; 291(4): G728 - G734.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. I. Said
Mediators and modulators of pulmonary arterial hypertension
Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L547 - L558.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. Zhou and K. S. Murthy
Identification of the G protein-activating sequence of the single-transmembrane natriuretic peptide receptor C (NPR-C)
Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1255 - C1261.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. S. Murthy and H. Zhou
Selective phosphorylation of the IP3R-I in vivo by cGMP-dependent protein kinase in smooth muscle
Am J Physiol Gastrointest Liver Physiol, February 1, 2003; 284(2): G221 - G230.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
E. H. Rho, W. J. Perkins, R. R. Lorenz, D. O. Warner, and K. A. Jones
Differential effects of soluble and particulate guanylyl cyclase on Ca2+ sensitivity in airway smooth muscle
J Appl Physiol, January 1, 2002; 92(1): 257 - 263.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Lelievre, N. Pineau, Z. Hu, Y. Ioffe, J.-Y. Byun, J.-M. Muller, and J. A. Waschek
Proliferative Actions of Natriuretic Peptides on Neuroblastoma Cells. INVOLVEMENT OF GUANYLYL CYCLASE AND NON-GUANYLYL CYCLASE PATHWAYS
J. Biol. Chem., November 16, 2001; 276(47): 43668 - 43676.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. S. Murthy
cAMP inhibits IP3-dependent Ca2+ release by preferential activation of cGMP-primed PKG
Am J Physiol Gastrointest Liver Physiol, November 1, 2001; 281(5): G1238 - G1245.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
B.-Q. Teng, J. R. Grider, and K. S. Murthy
Identification of a VIP-specific receptor in guinea pig tenia coli
Am J Physiol Gastrointest Liver Physiol, September 1, 2001; 281(3): G718 - G725.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
J. A. Carvajal, K. Aguan, L. P. Thompson, I. A. Buhimschi, and C. P. Weiner
Natriuretic Peptide-Induced Relaxation of Myometrium from the Pregnant Guinea Pig Is Not Mediated by Guanylate Cyclase Activation
J. Pharmacol. Exp. Ther., April 1, 2001; 297(1): 181 - 188.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. S. Murthy, J. R. Grider, and G. M. Makhlouf
Heterologous desensitization of response mediated by selective PKC-dependent phosphorylation of Gi-1 and Gi-2
Am J Physiol Cell Physiol, October 1, 2000; 279(4): C925 - C934.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
K. A. Lucas, G. M. Pitari, S. Kazerounian, I. Ruiz-Stewart, J. Park, S. Schulz, K. P. Chepenik, and S. A. Waldman
Guanylyl Cyclases and Signaling by Cyclic GMP
Pharmacol. Rev., September 1, 2000; 52(3): 375 - 414.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. S. Murthy, B.-Q. Teng, H. Zhou, J.-G. Jin, J. R. Grider, and G. M. Makhlouf
Gi-1/Gi-2-dependent signaling by single-transmembrane natriuretic peptide clearance receptor
Am J Physiol Gastrointest Liver Physiol, June 1, 2000; 278(6): G974 - G980.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. S. Murthy and G. M. Makhlouf
Identification of the G Protein-activating Domain of the Natriuretic Peptide Clearance Receptor (NPR-C)
J. Biol. Chem., June 18, 1999; 274(25): 17587 - 17592.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Almirez and A. A. Protter
Clearance of Human Brain Natriuretic Peptide in Rabbits; Effect of the Kidney, the Natriuretic Peptide Clearance Receptor, and Peptidase Activity
J. Pharmacol. Exp. Ther., May 1, 1999; 289(2): 976 - 980.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. J. Galligan
Focus on: "G protein-dependent activation of smooth muscle eNOS via natriuretic peptide clearance receptor"
Am J Physiol Cell Physiol, December 1, 1998; 275(6): C1407 - C1408.
[Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. S. Murthy, H. Zhou, and G. M. Makhlouf
PKA-dependent activation of PDE3A and PDE4 and inhibition of adenylyl cyclase V/VI in smooth muscle
Am J Physiol Cell Physiol, March 1, 2002; 282(3): C508 - C517.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murthy, K. S.
Right arrow Articles by Makhlouf, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murthy, K. S.
Right arrow Articles by Makhlouf, G. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online