Am J Physiol Cell Physiol Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 275: C1384-C1390, 1998;
0363-6143/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X. G.
Right arrow Articles by Peracchia, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X. G.
Right arrow Articles by Peracchia, C.
Vol. 275, Issue 5, C1384-C1390, November 1998

Molecular dissection of a basic COOH-terminal domain of Cx32 that inhibits gap junction gating sensitivity

Xiao Guang Wang and Camillo Peracchia

Department of Pharmacology and Physiology, School of Medicine and Dentistry, University of Rochester, Rochester, New York 14642-8711

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Connexin32 (Cx32) mutants were studied by double voltage clamp in Xenopus oocytes to determine the role of basic COOH-terminal residues in gap junction channel gating by CO2 and transjunctional voltage. Replacement of five arginines with N (5R/N) or T residues in the initial COOH-terminal domain (CT1) of Cx32 enhanced CO2 sensitivity. The positive charge, rather than the R residue per se, is responsible for the inhibitory role of CT1, because mutants replacing the five R residues with K (5R/K) or H (5R/H) displayed CO2 sensitivity comparable to that of wild-type Cx32. Mutants replacing R with N residues four at a time (4R/N) showed that CO2 sensitivity is strongly inhibited by R215 and mildly by R219, whereas R220, R223, and R224 may slightly increase sensitivity. Neither the 5R/N nor the 4R/N mutants differed in voltage sensitivity from wild-type Cx32. The possibility that inhibition of gating sensitivity results from electrostatic interactions between CT1 and the cytoplasmic loop is discussed as part of a model that envisions the cytoplasmic loop of Cx32 as a key element of chemical gating.

cell communication; cell junctions; connexins; channels; acidification; Xenopus oocytes

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

GAP JUNCTIONS ARE CELL contact membrane domains that mediate direct cell-cell communication by metabolic and electrical signals. Gap junction communication accounts for functional synchrony in phenomena such as contraction of the uterus and myocardium and multiple nerve cell firing and is believed to play a role in cellular homeostasis, growth, and differentiation (for review see Ref. 2).

A functional gap junction channel is composed of two hemichannels (connexons) representing hexamers of transmembrane proteins known as connexins, a protein family of over a dozen members. Connexins contain four transmembrane regions, linked by two extracellular and a cytoplasmic loop (CL), a short NH2 terminus (NT), and a COOH terminus (CT) of variable length. Connexin sequences are highly conserved aside from CL and CT regions, which vary significantly in length and composition. Connexin-specific sequences may account for the functional individuality of connexins.

Gap junction channels are mostly in an open state but can close in response to changes in cytosolic Ca2+ or H+ concentration, resulting in cell-cell uncoupling (for review see Ref. 10). Coupled cells reversibly uncouple electrically and metabolically from each other with exposure to 100% CO2 (14, 16), but the molecular mechanism of CO2-induced channel gating is still unclear. The CT chain has been suggested to play a role in determining the CO2 gating sensitivity of connexin43 (Cx43) (6), and a ball-and-chain model for Cx43 CO2 gating has been proposed (4, 8). In contrast, connexin32 (Cx32) mutants missing 84% of CT are as sensitive to CO2 as wild-type Cx32 (21, 23). Spray and Burt (14) proposed that low-pH-induced uncoupling follows protonation of histidine (H) residues. A role in determining the CO2 sensitivity of Cx43 has been attributed to H95 (3), a residue located at the beginning of CL in most connexins, and preliminary data suggest that two other H residues of Cx43 (H126 and H142) modulate in opposite ways the CO2 effects (5). However, in Cx32 the replacement of H126 with R did not affect CO2 sensitivity (20).

We have used site-directed mutagenesis and chimeric construction techniques to characterize, in Xenopus oocyte pairs, domains of Cx32 and connexin38 (Cx38) potentially involved in CO2-induced channel gating (19, 20). Cx32, the principal rat liver connexin, is poorly sensitive to CO2, whereas Cx38, the connexin expressed by Xenopus embryos, is very sensitive to CO2. Our data indicate that the second half of CL (CL2) contains a domain relevant for CO2 gating sensitivity, because a Cx32 chimera containing CL2 of Cx38 is as sensitive to CO2 as Cx38, (20). The NT chain does not appear to be relevant, whereas the potential role of the CT chain could not be tested, because the relevant chimeras did not express functional channels (19). Recently, the potential role of the CT of Cx32 was tested with CT deletions and basic residue mutations (21). This study showed that whereas CT deletion by 84% has no effect, replacement of the five basic residues (R215, R219, R220, R223, and R224) of the initial CT domain (CT1) with neutral residues (N or T) dramatically enhances Cx32 sensitivity to CO2. The five R residues ranked as follows in inhibiting CO2 gating sensitivity: R215 > R219 and R220 > R223 and R224 (21). To further analyze the functional significance of the R residues of CT1 and to determine whether it is the positive charge of the R residues, rather than the R residues per se, that inhibits CO2 gating sensitivity, the present study has tested individual R residue mutations and replacements of R residues with other positively charged residues (K or H).

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Site-directed mutagenesis. Molecular biology protocols were generally as described by Sambrook et al. (13). The cDNA of Cx32 (9) was used in the construction of DNA mutants. The strategy employed to create all the Cx32 mutants has been previously described (19). All the mutants were verified by DNA sequence analysis (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Sequences of Cx32 COOH-terminal mutants

Oligonucleotide sequences. Oligonucleotides were synthesized by a DNA synthesizer (model 393, ABI, Foster City, CA). The sequences used to produce mutants, with letters in italics and underlined representing mutated nucleotides, are as follows: (5R/N), 5'-CCTTGCGGGAGGGCGGATTGGA<OVL><IT>GTT</IT></OVL> <OVL><IT>GTT</IT></OVL>CTGAGC<OVL><IT>GTTGTT</IT></OVL>; (5R/K), 5'-CTTGCGGGAGGGCGGATTGGA<OVL><IT>CTTCTT</IT></OVL>CTGAGC<OVL><IT>CTTCTT</IT></OVL>GGCACAGGCC<OVL><IT>TT</IT></OVL>GATGATGAGGTACACCACCTC; (5R/H), 5'-CTTGCGGGAGGGCGGATTGGAG<OVL><IT>T</IT></OVL>GG<OVL><IT>T</IT></OVL>GCTGAGCA<OVL><IT>T</IT></OVL>GG<OVL><IT>T</IT></OVL>GGGCACAGGC<OVL><IT>GT</IT></OVL>GGATGATGAGGTACACCACCTC; (4R/N#1), 5'-GAGC<OVL><IT>GTTGT</IT></OVL>TGGCACAGGCCCGGATGATGAGGTACACCAC;(4R/N#2 sense), 5'-CTCATCATC<OVL><IT>AAC</IT></OVL>GCCTGTGCCCGC<OVL><IT>AAC-</IT></OVL> GCTCAG<OVL><IT>AACAAC</IT></OVL>TCC; (4R/N#2 antisense), 5'-GGA<OVL><IT>GT</IT></OVL>TGTTCTGAGC<OVL><IT>GTT</IT></OVL>GCGGGCACAGGC<OVL><IT>GTT</IT></OVL>GATGATGAG; (4R/N#3 sense), 5'-CATCATC<OVL><IT>AAC</IT></OVL>GCCTGTGCC<OVL><IT>AAC</IT></OVL>CGTGCTCAG<OVL><IT>AACAAC</IT></OVL>TCCAATCC; (4R/N#3 antisense), 5'-GGATTGGA<OVL><IT>GTTGTT</IT></OVL>CTGAGCACG<OVL><IT>GTT</IT></OVL>GGCACAGGC<OVL><IT>GTT</IT></OVL>GATGATG; (4R/N#4 sense), 5'-CTGTGCC<OVL><IT>AACAAC</IT></OVL>GCTCAGCGC<OVL><IT>AAC</IT></OVL>TCCAATCCGCCCTCC; (4R/N#4 antisense), 5'-GGAGGGCGGATTGGA<OVL><IT>GTT</IT></OVL>GCGCTGAGC<OVL><IT>GTTGTT</IT></OVL>GGCACAG; (4R/N#5 sense), 5'-GTGCC<OVL><IT>AACAAC</IT></OVL>GCTCAG<OVL><IT>AAC</IT></OVL>CGCTCCAATCCGCCCTCCCGC; (4R/N#5 antisense), 5'GCGGGAGGGCGGATTGGAGCG<OVL><IT>GTT</IT></OVL>CTGAGC<OVL><IT>GTTGTT</IT></OVL>GGCAC.

Preparation of cRNA. Wild-type and mutated forms of Cx32 cDNA were subcloned into pBluescript (Stratagene, Menasha, WI) or pGEM 3Z (Promega, Madison, WI) and used for in vitro synthesis of cRNA. cRNAs were transcribed from linearized plasmid using T7 or SP6 mMESSAGE mMACHINE (Ambion, Austin, TX) in the presence of the cap analog m7G(5')ppp(5')G (Ambion).

Oocyte preparation and microinjection. Oocytes were prepared as described previously (11). Briefly, adult female frogs (Xenopus laevis) were anesthetized with 0.3% tricaine (MS-222), and the oocytes were surgically removed from the abdominal incision. The oocytes were placed in ND 96 medium containing (in mM) 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, and 5 HEPES, with pH adjusted to 7.6 with NaOH. Oocytes at stage V or VI were subsequently defolliculated twice for 45 min each in 2 mg/ml collagenase (Sigma Chemical, St. Louis, MO) in Ca2+-free OR2 solution consisting of (in mM) 82.5 NaCl, 2.5 KCl, 1 MgCl2, and 5 HEPES, with pH adjusted to 7.6 with NaOH, at room temperature. The defolliculated oocytes were injected with 46 nl of 0.25 µg/µl antisense oligonucleotide complementary to endogenous Xenopus Cx38: 5'-GCTTTAGTAATTCCCATCCTGCCATGTTTC-3' [commencing at nt -5 of Cx38 cDNA sequence (1)] by means of a nanoject apparatus (Drummond, Broomall, PA). The antisense oligonucleotide blocks completely the endogenous junctional communication within 48 h. At 48-72 h postinjection, 46 nl of wild-type or mutated cRNA (0.02-0.1 µg/µl) were injected into oocytes at the vegetal pole, and the oocytes were incubated overnight at 18°C. The oocytes were mechanically stripped of their vitelline layer in a hypertonic medium (11) and paired at the vegetal poles in ND 96 medium. Oocyte pairs were studied electrophysiologically 0.5-2 h after pairing.

Uncoupling protocol. The oocyte chamber was continuously perfused at a flow rate of 0.6 ml/min by a peristaltic pump (Dyamax model RP-1, Rainin Instrument, Woburn, MA). The superfusion solution was ejected by a 22-gauge needle placed near the edge of the conical well containing the oocyte pair. The level of the solution in the chamber was maintained constant by continuous suction. Electrical uncoupling of oocyte pairs was induced by 3 or 15 min of superfusion (0.6 ml/min) of Cl--free saline (Cl- replaced with methanesulfonate) continuously gassed with 100% CO2. The Cl--free saline contained (in mM) 75 NaOH, 10 KOH, 4 Ca(OH)2, 5 Mg(OH)2, and 10 MOPS, with pH adjusted to 7.2 with methanesulfonic acid. The Cl--free saline was used to prevent an increase in membrane current caused by the opening of Ca2+-activated Cl- channels during exposure to 100% CO2 (11), which could interfere with junction current (Ij) measurement.

Double voltage-clamp recording. All the experiments were performed using the standard double voltage-clamp procedure for measuring junction conductance (Gj) (16) according to a previously published protocol (11). Briefly, microelectrodes were pulled from borosilicate glass capillaries (1.2 mm OD, 0.68 mm ID; Kwik fill, W-P Instruments, New Haven, CT) by means of a Brown-Flaming micropipette puller (Sutter Instruments, San Francisco, CA). The microelectrodes, filled with a 3 M KCl solution, had a low tip resistance (0.5-1 MOmega in ND 96 medium), such that, even in oocyte pairs with significantly different initial Gj (Table 2), similar percent drops in Gj with CO2 were attained. The bath was grounded with a silver-silver chloride reference electrode connected to the superfusion chamber via an agar bridge. After the insertion of a current and a voltage microelectrode in each of the two oocytes, both oocytes were initially voltage clamped to the same holding potential (Vm), similar to their resting membrane potential, so that no Ij would flow at rest (Ij = 0 pA). A junction potential (Vj) gradient was created by imposing a +20-mV voltage step (V1) of 2-s duration every 30 s to oocyte 1 while maintaining V2 at Vm; thus Vj = V1. The negative-feedback current (I2), injected by the clamp amplifier in oocyte 2 for maintaining V2 constant at Vm, was used to calculate Gj, inasmuch as it is identical in magnitude to Ij but of opposite sign (Ij = -I2); Gj = Ij/Vj. Pulse generation and data acquisition were performed by means of a computer equipped with pClamp software and Labmaster TL-1A/D-D/A interface (Axon Instruments, Foster City, CA).

                              
View this table:
[in this window]
[in a new window]
 
Table 2.   Initial Gj of oocyte pairs expressing Cx32 mutants

For studying voltage dependence of Gj, each oocyte of the pair was first voltage clamped at -20 mV. Voltage steps of 20 mV (±120-mV maximum) and 20-s duration were then applied to either oocyte of the pair, while the other was maintained at -20 mV. To illustrate the relationship between steady-state Gj (Gj ss) and Vj, the normalized Gj (Gj ss/Gj max, where Gj max is maximal Gj) was plotted with respect to Vj. The curve was fitted to a two-state Boltzmann distribution of the following form: (Gj ss - Gj min)/(Gj max - Gj ss) = exp[-A(Vj - V0)], where V0 is the Vj at which the voltage-sensitive conductance is one-half of the maximal value, Gj min is the theoretical minimum normalized Gj, and A = nq/kT is a constant expressing voltage sensitivity in terms of number of equivalent gating charges (n) moving through the entire applied field, where q is the electron charge, k is the Boltzmann constant, and T is the temperature in Kelvin.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Effect of arginine mutation to lysine or histidine on CO2 gating sensitivity of Cx32. In a previous study we reported that replacement of five R residues of CT1 (R215, R219, R220, R223, and R224) with N or T greatly enhances the CO2 gating sensitivity of Cx32 (21). To determine whether it is the positive charge of the R residue or the R residue per se that inhibits CO2 gating sensitivity, in the present study the five R residues of CT1 were replaced with another basic residue, K (mutant 5R/K), or with H (mutant 5R/H), a residue that assumes a positive charge at acidic pH.

With 3-min CO2 exposures, Gj dropped to 89.4 ± 3.9% (mean ± SE, n = 3) with 5R/K (Fig. 1A, see Fig. 3) and to 90.6 ± 6.7% (n = 3) with 5R/H (Fig. 1B, see Fig. 3). With 15-min exposures to 100% CO2, Gj dropped to 58.8 ± 6.0% (n = 5) with 5R/K (Fig. 1A, see Fig. 3) and to 43.6 ± 9.0% (n = 4) with 5R/H (Fig. 1B, see Fig. 3). Thus 5R/K and 5R/H channels displayed low CO2 sensitivity, virtually identical to that of Cx32 (see Fig. 3). In both mutants, maximum uncoupling and recoupling rates (Fig. 1) were also similar to those of wild-type Cx32 [~9%/min (21)], but the uncoupling rate differed greatly from that of the mutant 5R/N [~18%/min (21)].


View larger version (18K):
[in this window]
[in a new window]
 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.   Time course of gap junction conductance (Gj) in Xenopus oocyte pairs expressing 5R/K (A) and 5R/H (B) exposed to 100% CO2. CO2 gating sensitivity of connexin32 (Cx32) is not altered by replacement of 5 R residues of initial COOH terminus (CT1) with K, another basic residue (5R/K), or H (5R/H), a residue that assumes positive charge at acidic pH. This indicates that basic nature of this domain, rather than presence of R residues per se, is reason for rather low pH sensitivity of Cx32. With 3-min CO2 exposures, Gj dropped to 89.4 ± 3.9% (mean ± SE, n = 3) with 5R/K and to 90.6 ± 6.7% (n = 3) with 5R/H. With 15-min exposures to CO2, Gj dropped to 58.6 ± 6.0% (n = 5) with 5R/K (A) and to 43.6 ± 9.0% (n = 4) with 5R/H (B). Maximum uncoupling rates of 5R/K (6.5%/min) and 5R/H (8.2%/min) were similar to that of wild-type Cx32 (~9%/min) and much lower than that of 5R/N (~18%/min) (21).

Effect of four arginine mutations to asparagine residues on CO2 gating sensitivity. To test the role of individual positive charges of CT1 in CO2 gating sensitivity, the R residues were mutated four at a time to N residues (4R/N#1, 4R/N#2, 4R/N#3, 4R/N#4, and 4R/N#5, Table 1). On exposure to 100% CO2, only the mutant 4R/N#1 (only R215 preserved) reproduced precisely the uncoupling behavior of wild-type Cx32. 4R/N#1 (Figs. 2A and 3) and wild-type Cx32 (Fig. 3) behaved almost identically not only in uncoupling magnitude, but also in uncoupling and recoupling rates. Gj of 4R/N#1 channels dropped to 86.5 ± 9.7% (n = 4) with 3 min of CO2 exposure and to 38.5 ± 7.2% (n = 5) with 15 min of CO2 exposure, at a maximum uncoupling rate of 6.9%/min (Figs. 2A and 3).


View larger version (21K):
[in this window]
[in a new window]
 


View larger version (22K):
[in this window]
[in a new window]
 


View larger version (23K):
[in this window]
[in a new window]
 


View larger version (20K):
[in this window]
[in a new window]
 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Average time course of Gj during exposure to 100% CO2 in oocyte pairs expressing 4R/N#1 (A, R215 preserved), 4R/N#2 (B, R219 preserved), 4R/N#3 (C, R220 preserved), 4R/N#4 (D, R223 preserved), and 4R/N#5 (E, R224 preserved). CO2 gating sensitivity of 4R/N#1 is similar to that of Cx32 (21), and sensitivities of 4R/N#3, 4R/N#4, and 4R/N#5 are similar to that of 5R/N (21). In contrast, sensitivity of 4R/N#2 is intermediate between that of Cx32 and that of 5R/N. This indicates that only R215 and R219 are effective in inhibiting CO2 sensitivity, with R215 being a much more powerful inhibitor than R219. With 3-min CO2 exposures, Gj dropped to 86.5 ± 9.7% (n = 4) with 4R/N#1, 43.5 ± 5.9% (n = 6) with 4R/N#2, 5.6 ± 3.5% (n = 3) with 4R/N#3, 0.7 ± 0.9% (n = 4) with 4R/N#4, and 1.3 ± 0.6% (n = 4) with 4R/N#5. With 15-min exposures to CO2, Gj dropped to 38.5 ± 7.2% (n = 5) with 4R/N#1, ~0% (n = 5) with 4R/N#2, 2.8 ± 2.9% (n = 3) with 4R/N#3, ~0% (n = 5) with 4R/N#4, and 2.1 ± 1.1% (n = 4) with 4R/N#5.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Summary of effects of replacing R residues with N, T, K, or H residues in CT1 on normalized Gj with 3- or 15-min exposures to CO2 (100% Gj = control, pretreatment Gj value). Replacement of all 5 R residues with N or T residues greatly increases CO2 sensitivity of Cx32, whereas replacement of R residues with other positively charged residues (K or H) does not affect CO2 sensitivity. This indicates that positive charge, rather than R residue per se, is effective in reducing CO2 sensitivity of Cx32. Partial replacements of R with N residues indicate that R215 is strongest inhibitor of CO2 gating sensitivity of Cx32, inasmuch as 4R/N#1 behaves similarly to wild-type Cx32, and that R219 is a mild inhibitor, because with 3-min CO2 exposure Gj only drops to 43.5%. R220 does not seem to play any inhibitory role, because sensitivity of 4R/N#3 is very similar to that of 5R/N. In contrast, R223 and R224 have no inhibitory power or may even potentiate gating sensitivity, inasmuch as 4R/N#4 and 4R/N#5 seem to be slightly more sensitive than 5R/N.

The gating sensitivity to CO2 of mutant 4R/N#2 (only R219 preserved, Figs. 2B and 3) was greater than that of wild-type Cx32 and 4R/N#1 (Fig. 3). With 4R/N#2, Gj dropped to 43.5 ± 5.9% (n = 6) with 3 min of CO2 exposure (Figs. 2B and 3) and to 0.42 ± 0.1% (n = 5) with 15 min of CO2 exposure (Figs. 2B and 3), at a maximum uncoupling rate of ~19.6%/min (Fig. 2B).

In contrast, the gating sensitivity to CO2 of mutants 4R/N#3 (only R220 preserved, Figs. 2C and 3), 4R/N#4 (only R223 preserved, Figs. 2D and 3), and 4R/N#5 (only R224 preserved, Figs. 2E and 3) was as great as or greater than that of 5R/N (Fig. 3). With 4R/N#3, Gj dropped to 5.6 ± 3.5% (n = 3) with 3 min of CO2 exposure and to 2.8 ± 2.9% (n = 3) with 15 min of CO2 exposure, at a maximum uncoupling rate of 22.2% (Figs. 2C and 3). With 4R/N#4 (Figs. 2D and 3) and 4R/N#5 (Figs. 2E and 3), Gj dropped to ~0% with 3 or 15 min of CO2 exposure, at maximum uncoupling rates of 22.2 and 25%/min, respectively (Fig. 2, D and E).

Transjunctional voltage gating in oocyte pairs expressing wild-type Cx32 or R/N mutants. The voltage dependence of Gj was determined by measuring Gj max, defined as the steady-state junctional conductance at a Vj of ±20 mV, and Gj ss, measured at the end of each Vj pulse. To illustrate the relationship between Gj ss and Vj, Gj ss/Gj max was plotted with respect to Vj (Fig. 4C), and the curve was fitted to a two-state Boltzmann distribution (Fig. 4, A and B).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   Relationship between normalized junctional conductances (Gj ss/ Gj max, where Gj ss is steady-state Gj) and junctional voltage (Vj) and 2-state Boltzmann fit in oocyte pairs expressing Cx32 (A and C), 5R/N (A and C), or 4R/N mutants (B and C) subjected to a family of transjunctional voltages of ±120 mV in 20-mV steps. Voltage sensitivity of 5R/N and 4R/N mutant channels is very similar to that of wild-type Cx32 channels. For Boltzmann parameters see Table 3. C: Gj-Vj relationship (means ± SE) for each step of Vj gradient (±120 mV) and average of Boltzmann fit (solid line).

The voltage sensitivity of the six R/N mutants did not differ significantly from that of wild-type Cx32 (Fig. 4, A and B) in terms of V0, the Vj at which the voltage-sensitive conductance is one-half of the maximal value; Gj min, the theoretical minimum normalized Gj; and n, the number of charges moving through the entire applied field (Table 3). Nor were significant changes observed in Vj-dependent inactivation kinetics. With Vj = ±120 mV, Gj decreased after a double-exponential decay with a fast time constant of ~1.5 s and a slow time constant of ~100 s in wild-type Cx32 and mutant 5R/N (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
Table 3.   Parameters of Boltzmann fit

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

This study shows that the positive charge of arginine residues located near the NH2-terminal end (CT1) of the COOH-terminal chain of Cx32 modulates the chemical gating sensitivity of gap junction channels. Two of the five R residues present (R215 and R219) have inhibitory function, whereas the other three (R220, R223, and R224) have no effect or may slightly enhance gating sensitivity. This conclusion is based on a comparison, in terms of magnitude and rate of Gj decrease with exposure to 100% CO2, between oocyte pairs expressing wild-type Cx32 and oocyte pairs expressing mutants in which the R residues of CT1 were entirely replaced with K, H, or N residues or replaced four at a time with N residues.

In a previous study (21) we reported a dramatic increase in CO2 gating sensitivity with replacement of the five R residues of the CT1 domain of Cx32 with polar-neutral residues (N or T). This observation suggested that the positively charged nature of the CT1 domain might be inhibitory to chemical gating sensitivity. However, the possibility that the inhibitory function was related to the arginine residue per se, rather than to its positive charge, could not be discarded. The present study proves that the positive charge of some of the R residues of CT1 is indeed the reason for their inhibitory influence on CO2 gating sensitivity, because replacement of R with other basic residues, K or H, did not change gating sensitivity. Because intracellular pH (pHi) of the normal oocyte is ~7.6 (11) and the imidazole group of histidine (in proteins) becomes protonated (assumes positive charge) at pH 6.7-7.1 (7), we thought that the mutant 5R/H might display a two-stage gating behavior, inasmuch as the presence of H residues could make the inhibitory function of CT1 pH sensitive. We thought that, with CO2, Gj might drop rapidly at first, inasmuch as H residues would still be neutral, and that as pHi drops below 7 the H residues would become protonated and their positive charge would start inhibiting CO2 sensitivity (as R residues do), slowing down the rate of Gj drop. Had this been the case, one would also have expected the maximum rate and magnitude of Gj drop to increase compared with Cx32 and mutant 5R/K. The fact that mutant 5R/H behaved just like Cx32 and 5R/K indicates that H residues become protonated early in the process, before the gating mechanism is activated. Indirectly, this is consistent with the observation that pHi decreases and bottoms significantly earlier than does Gj (11, 21).

Previous evidence (21) suggested that R215 is the strongest inhibitor of CO2 gating sensitivity, that the R219-R220 complex has less inhibitory power than R215, and that the R223-R224 complex may partly counteract the inhibitory activity of R215 and the R219-220 complex. That study, however, did not determine the individual function of R219, R220, R223, and R224. The present study shows that between R219 and R220 only R219 has some, but low, inhibitory power, because 4R/N#2 (R219 preserved) is less sensitive than 5R/N (no R preserved), whereas R220 causes no inhibition, inasmuch as 4R/N#3 (R220 preserved) is virtually as sensitive as 5R/N. Neither R223 nor R224 seems to cause any inhibition, because 4R/N#4 (R223 preserved) and 4R/N#5 (R224 preserved) are as sensitive as, or possibly even more sensitive than, 5R/N. Evidence for very high CO2 sensitivity of 4R/N#4 and 4R/N#5 (R223 or R224 preserved), which appears even greater than that of 5R/N, is consistent with our previous observation (21) that these residues, when present together, can mildly counteract the inhibitory power of R215 or the R219-R220 complex.

The inhibitory function of CT1 may involve charge interaction between acidic residues of the NH2-terminal end of the cytoplasmic loop (CL1) and basic residues of CT1 (10, 22), as well as hydrophobic interactions, inasmuch as in both domains several hydrophobic residues are present near the charged residues. However, the possibility that more global conformational changes in Cx32 take place cannot be ruled out. Indeed, it should be stressed that whether there was any form of interaction between CT1 and CL is based entirely on circumstantial evidence. If CT1 and CL interact with each other electrostatically and hydrophobically, CT1 could function as a latch that keeps the channel open by immobilizing CL, a potential gating element. The gating process could somehow break the CL1-CT1 interaction, enabling CL to move toward the channel pore. This model may also be supported by our preliminary evidence for increased gating sensitivity to CO2 with the mutation of an acidic residue of CL1 (E102) to R and of two hydrophobic residues of CL1 (M105 and L106) to polar uncharged residues (unpublished data). It is worth noting that in alpha -helical conformation (the likely structure of these domains) the inhibitory arginines of CT1 (R215 and R219) and all the acidic residues of CL1 (El02, E109, and D113) are located on the same side of their respective helices together with hydrophobic residues, which would facilitate electrostatic and hydrophobic interactions between the two domains.

The absence of obvious changes in Vj sensitivity with the removal of positive charges of CT1 indicates that this domain has no obvious function in voltage gating. A number of studies have reported a participation of the NH2 terminus and first outer loop regions in voltage gating (12, 18). Our previous work with Cx32/Cx38 chimeras has demonstrated a participation of the NH2 terminus and CL1 (19, 20). Recently, a preliminary study (1) reported a change in Vj sensitivity of Cx32 and Cx43 with CT deletion, in particular a loss of fast inactivation kinetics. However, this change may be related to other charged domains of CT, because in our study neither of the kinetics of the double-exponential Gj decay changed significantly in the mutant 5R/N with respect to wild-type Cx32.

On the basis of data from Cx32 mutants expressed in Xenopus oocyte pairs, we conclude that positive charges of the NH2-terminal end of the COOH-terminal chain modulate the gating sensitivity of gap junction channels to CO2. Of the five basic residues present, R215 is a very strong inhibitor of CO2 gating sensitivity and R219 is a weak inhibitor, whereas R220, R223, and R224 do not inhibit or may, in fact, slightly enhance sensitivity. Potential electrostatic and hydrophobic interactions between this basic COOH-terminal domain and the acidic/hydrophobic surface of a cytoplasmic loop domain are being proposed. If it is present, this interaction could inhibit chemical gating sensitivity by restraining the mobility of the cytoplasmic loop, a potential gating structure.

    ACKNOWLEDGEMENTS

We are grateful to Dr. Eric C. Beyer (University of Chicago) for providing the cDNA clone for the rat liver Cx32 and to Lillian M. Peracchia for excellent technical help.

    FOOTNOTES

This study was supported by National Institute of General Medical Sciences Grant GM-20113.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: C. Peracchia, Dept. of Pharmacology and Physiology, School of Medicine and Dentistry, University of Rochester, 601 Elmwood Ave., Rochester, NY 14642-8711.

Received 3 February 1998; accepted in final form 20 July 1998.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.  Barrio, L. C., C. Castro, and A. Revilla. Fast inactivation of Cx32 and Cx43 junctions mediated by the carboxy-terminal domain. Proc. Int. Gap Junction Conf. Key Largo, FL, 1997, p. 38.

2.   Bruzzone, R., T. W. White, and D. L. Paul. Expression of chimeric connexins reveals new properties of the formation and gating behavior of gap junction channels. J. Cell Sci. 107: 955-967, 1994[Abstract].

3.   Ek, J. F., M. Delmar, R. Perzova, and S. M. Taffet. Role of histidine 95 on pH gating of the cardiac gap junction protein connexin43. Circ. Res. 74: 1058-1064, 1994[Abstract/Free Full Text].

4.   Ek-Vitorin, J. F., G. Calero, G. E. Morley, W. Coombs, S. M. Tafet, and M. Delmar. pH regulation of connexin43: molecular analysis of the gating particle. Biophys. J. 71: 1273-1284, 1996[Medline].

5.   Hermans, M. M. P., P. Kortekaas, H. J. Jongsma, and M. B. Rook. The role of histidine residues on pH sensitivity of the gap junction protein connexin 43 (Abstract). Mol. Biol. Cell 7: 91A, 1996.

6.   Liu, S., S. Taffet, L. Stoner, M. Delmar, M. L. Vallano, and J. Jalife. A structural basis for the unequal sensitivity of the major cardiac and liver gap junctions to intracellular acidification: the carboxyl tail length. Biophys. J. 64: 1422-1433, 1993[Medline].

7.   Means, G. E., and R. E. Feeney. Chemical Modification of Proteins. San Francisco, CA: Holden-Day, 1971, p. 11-20.

8.   Morley, G. E., S. M. Taffet, and M. Delmar. Intramolecular interactions mediate pH regulation of connexin43 channels. Biophys. J. 70: 1294-1302, 1996[Medline].

9.   Paul, D. L. Molecular cloning of cDNA for rat liver gap junction protein. J. Cell Biol. 103: 123-134, 1986[Abstract/Free Full Text].

10.   Peracchia, C., and X. G. Wang. Connexin domains relevant to the chemical gating of gap junction channels. Braz. J. Med. Biol. Res. 30: 577-590, 1997[Medline].

11.   Peracchia, C., X. Wang, L. Li, and L. L. Peracchia. Inhibition of calmodulin expression prevents low-pH-induced gap junction uncoupling in Xenopus oocytes. Pflügers Arch. 431: 379-387, 1996[Medline].

12.   Rubin, J. B., V. K. Verselis, M. V. L. Bennett, and T. A. Bargiello. Molecular analysis of voltage dependence of heterotypic gap junctions formed by connexins 26 and 32. Biophys. J. 62: 183-195, 1992.

13.   Sambrook, J., E. Fritsch, and T. Maniatis. Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989.

14.   Spray, D. C., and J. M. Burt. Structure-activity relations of the cardiac gap junction channel. Am. J. Physiol. 258 (Cell Physiol. 27): C195-C205, 1990[Abstract/Free Full Text].

15.   Spray, D. C., A. L. Harris, and M. V. L. Bennett. Gap junctional conductance is a simple and sensitive function of intracellular pH. Science 211: 712-715, 1981[Abstract/Free Full Text].

16.   Spray, D. C., A. L. Harris, and M. V. Bennett. Equilibrium properties of a voltage-dependent junctional conductance. J. Gen. Physiol. 77: 77-93, 1981[Abstract/Free Full Text].

17.   Turin, L., and A. E. Warner. Carbon dioxide reversibly abolishes ionic communication between cells of early amphibian embryo. Nature 270: 56-57, 1977[Medline].

18.   Verselis, V. K., C. S. Ginter, and T. A. Bargiello. Opposite voltage gating polarities of two closely related connexins. Nature 368: 348-351, 1994[Medline].

19.   Wang, X. G., L. Q. Li, L. L. Peracchia, and C. Peracchia. Chimeric evidence for a role of the connexin cytoplasmic loop in gap junction channel gating. Pflügers Arch. 431: 844-852, 1996[Medline].

20.   Wang, X. G., and C. Peracchia. Connexin32/38 chimeras suggest a role for the second half of the inner loop in gap junction gating by low pH. Am. J. Physiol. 271 (Cell Physiol. 40): C1743-C1749, 1996[Abstract/Free Full Text].

21.   Wang, X. G., and C. Peracchia. Positive charges of the initial C-terminus domain of Cx32 inhibit gap junction gating sensitivity to CO2. Biophys. J. 73: 798-806, 1997[Medline].

22.   Wang, X. G., and C. Peracchia. Domains of connexin32 relevant to CO2-induced channel gating. In: Gap Junctions, edited by R. Werner. Amsterdam: IOS, 1998, p. 35-39.

23.   Werner, R., E. Levine, C. Rabadan-Diehl, and G. Dahl. Gating properties of connexin32 cell-cell channels and their mutants expressed in Xenopus oocytes. Proc. R. Soc. Lond. B Biol. Sci. 243: 5-11, 1991[Medline].


Am J Physiol Cell Physiol 275(5):C1384-C1390
0002-9513/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
T. W. White, M. Srinivas, H. Ripps, A. Trovato-Salinaro, D. F. Condorelli, and R. Bruzzone
Virtual cloning, functional expression, and gating analysis of human connexin31.9
Am J Physiol Cell Physiol, September 1, 2002; 283(3): C960 - C970.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Peracchia, X. G. Wang, and L. L. Peracchia
Is the chemical gate of connexins voltage sensitive? Behavior of Cx32 wild-type and mutant channels
Am J Physiol Cell Physiol, June 1, 1999; 276(6): C1361 - C1373.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. I Grichtchenko, I. Choi, X. Zhong, P. Bray-Ward, J. M. Russell, and W. F. Boron
Cloning, Characterization, and Chromosomal Mapping of a Human Electroneutral Na+-driven Cl-HCO3 Exchanger
J. Biol. Chem., March 9, 2001; 276(11): 8358 - 8363.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X. G.
Right arrow Articles by Peracchia, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X. G.
Right arrow Articles by Peracchia, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online