|
|
||||||||
Department of Pharmacology and Physiology, School of Medicine and Dentistry, University of Rochester, Rochester, New York 14642-8711
| |
ABSTRACT |
|---|
|
|
|---|
Connexin32 (Cx32) mutants were studied by double voltage clamp in Xenopus oocytes to determine the role of basic COOH-terminal residues in gap junction channel gating by CO2 and transjunctional voltage. Replacement of five arginines with N (5R/N) or T residues in the initial COOH-terminal domain (CT1) of Cx32 enhanced CO2 sensitivity. The positive charge, rather than the R residue per se, is responsible for the inhibitory role of CT1, because mutants replacing the five R residues with K (5R/K) or H (5R/H) displayed CO2 sensitivity comparable to that of wild-type Cx32. Mutants replacing R with N residues four at a time (4R/N) showed that CO2 sensitivity is strongly inhibited by R215 and mildly by R219, whereas R220, R223, and R224 may slightly increase sensitivity. Neither the 5R/N nor the 4R/N mutants differed in voltage sensitivity from wild-type Cx32. The possibility that inhibition of gating sensitivity results from electrostatic interactions between CT1 and the cytoplasmic loop is discussed as part of a model that envisions the cytoplasmic loop of Cx32 as a key element of chemical gating.
cell communication; cell junctions; connexins; channels; acidification; Xenopus oocytes
| |
INTRODUCTION |
|---|
|
|
|---|
GAP JUNCTIONS ARE CELL contact membrane domains that mediate direct cell-cell communication by metabolic and electrical signals. Gap junction communication accounts for functional synchrony in phenomena such as contraction of the uterus and myocardium and multiple nerve cell firing and is believed to play a role in cellular homeostasis, growth, and differentiation (for review see Ref. 2).
A functional gap junction channel is composed of two hemichannels (connexons) representing hexamers of transmembrane proteins known as connexins, a protein family of over a dozen members. Connexins contain four transmembrane regions, linked by two extracellular and a cytoplasmic loop (CL), a short NH2 terminus (NT), and a COOH terminus (CT) of variable length. Connexin sequences are highly conserved aside from CL and CT regions, which vary significantly in length and composition. Connexin-specific sequences may account for the functional individuality of connexins.
Gap junction channels are mostly in an open state but can close in response to changes in cytosolic Ca2+ or H+ concentration, resulting in cell-cell uncoupling (for review see Ref. 10). Coupled cells reversibly uncouple electrically and metabolically from each other with exposure to 100% CO2 (14, 16), but the molecular mechanism of CO2-induced channel gating is still unclear. The CT chain has been suggested to play a role in determining the CO2 gating sensitivity of connexin43 (Cx43) (6), and a ball-and-chain model for Cx43 CO2 gating has been proposed (4, 8). In contrast, connexin32 (Cx32) mutants missing 84% of CT are as sensitive to CO2 as wild-type Cx32 (21, 23). Spray and Burt (14) proposed that low-pH-induced uncoupling follows protonation of histidine (H) residues. A role in determining the CO2 sensitivity of Cx43 has been attributed to H95 (3), a residue located at the beginning of CL in most connexins, and preliminary data suggest that two other H residues of Cx43 (H126 and H142) modulate in opposite ways the CO2 effects (5). However, in Cx32 the replacement of H126 with R did not affect CO2 sensitivity (20).
We have used site-directed mutagenesis and chimeric construction techniques to characterize, in Xenopus oocyte pairs, domains of Cx32 and connexin38 (Cx38) potentially involved in CO2-induced channel gating (19, 20). Cx32, the principal rat liver connexin, is poorly sensitive to CO2, whereas Cx38, the connexin expressed by Xenopus embryos, is very sensitive to CO2. Our data indicate that the second half of CL (CL2) contains a domain relevant for CO2 gating sensitivity, because a Cx32 chimera containing CL2 of Cx38 is as sensitive to CO2 as Cx38, (20). The NT chain does not appear to be relevant, whereas the potential role of the CT chain could not be tested, because the relevant chimeras did not express functional channels (19). Recently, the potential role of the CT of Cx32 was tested with CT deletions and basic residue mutations (21). This study showed that whereas CT deletion by 84% has no effect, replacement of the five basic residues (R215, R219, R220, R223, and R224) of the initial CT domain (CT1) with neutral residues (N or T) dramatically enhances Cx32 sensitivity to CO2. The five R residues ranked as follows in inhibiting CO2 gating sensitivity: R215 > R219 and R220 > R223 and R224 (21). To further analyze the functional significance of the R residues of CT1 and to determine whether it is the positive charge of the R residues, rather than the R residues per se, that inhibits CO2 gating sensitivity, the present study has tested individual R residue mutations and replacements of R residues with other positively charged residues (K or H).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Site-directed mutagenesis. Molecular biology protocols were generally as described by Sambrook et al. (13). The cDNA of Cx32 (9) was used in the construction of DNA mutants. The strategy employed to create all the Cx32 mutants has been previously described (19). All the mutants were verified by DNA sequence analysis (Table 1).
|
Oligonucleotide sequences.
Oligonucleotides were synthesized by a DNA synthesizer (model 393, ABI,
Foster City, CA). The sequences used to produce mutants, with letters
in italics and underlined representing mutated nucleotides, are as
follows: (5R/N),
5'-CCTTGCGGGAGGGCGGATTGGA
CTGAGC
;
(5R/K),
5'-CTTGCGGGAGGGCGGATTGGA
CTGAGC
GGCACAGGCC
GATGATGAGGTACACCACCTC; (5R/H),
5'-CTTGCGGGAGGGCGGATTGGAG
GG
GCTGAGCA
GG
GGGCACAGGC
GGATGATGAGGTACACCACCTC; (4R/N#1),
5'-GAGC
TGGCACAGGCCCGGATGATGAGGTACACCAC;(4R/N#2 sense),
5'-CTCATCATC
GCCTGTGCCCGC
GCTCAG
TCC; (4R/N#2 antisense),
5'-GGA
TGTTCTGAGC
GCGGGCACAGGC
GATGATGAG; (4R/N#3 sense),
5'-CATCATC
GCCTGTGCC
CGTGCTCAG
TCCAATCC; (4R/N#3 antisense),
5'-GGATTGGA
CTGAGCACG
GGCACAGGC
GATGATG; (4R/N#4 sense),
5'-CTGTGCC
GCTCAGCGC
TCCAATCCGCCCTCC; (4R/N#4 antisense),
5'-GGAGGGCGGATTGGA
GCGCTGAGC
GGCACAG; (4R/N#5 sense),
5'-GTGCC
GCTCAG
CGCTCCAATCCGCCCTCCCGC; (4R/N#5 antisense),
5'GCGGGAGGGCGGATTGGAGCG
CTGAGC
GGCAC.
Preparation of cRNA. Wild-type and mutated forms of Cx32 cDNA were subcloned into pBluescript (Stratagene, Menasha, WI) or pGEM 3Z (Promega, Madison, WI) and used for in vitro synthesis of cRNA. cRNAs were transcribed from linearized plasmid using T7 or SP6 mMESSAGE mMACHINE (Ambion, Austin, TX) in the presence of the cap analog m7G(5')ppp(5')G (Ambion).
Oocyte preparation and microinjection.
Oocytes were prepared as described previously (11). Briefly, adult
female frogs (Xenopus laevis) were
anesthetized with 0.3% tricaine (MS-222), and the oocytes were
surgically removed from the abdominal incision. The oocytes were placed
in ND 96 medium containing (in mM) 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, and 5 HEPES, with pH
adjusted to 7.6 with NaOH. Oocytes at stage V or VI were subsequently
defolliculated twice for 45 min each in 2 mg/ml collagenase (Sigma
Chemical, St. Louis, MO) in
Ca2+-free OR2 solution consisting
of (in mM) 82.5 NaCl, 2.5 KCl, 1 MgCl2, and 5 HEPES,
with pH adjusted to 7.6 with NaOH, at room temperature. The
defolliculated oocytes were injected with 46 nl of 0.25 µg/µl
antisense oligonucleotide complementary to endogenous Xenopus Cx38:
5'-GCTTTAGTAATTCCCATCCTGCCATGTTTC-3' [commencing at
nt
5 of Cx38 cDNA sequence (1)] by means of a nanoject apparatus (Drummond, Broomall, PA). The antisense oligonucleotide blocks completely the endogenous junctional communication within 48 h.
At 48-72 h postinjection, 46 nl of wild-type or mutated cRNA
(0.02-0.1 µg/µl) were injected into oocytes at the vegetal pole, and the oocytes were incubated overnight at 18°C. The oocytes were mechanically stripped of their vitelline layer in a hypertonic medium (11) and paired at the vegetal poles in ND 96 medium. Oocyte
pairs were studied electrophysiologically 0.5-2 h after pairing.
Uncoupling protocol.
The oocyte chamber was continuously perfused at a flow rate of 0.6 ml/min by a peristaltic pump (Dyamax model RP-1, Rainin Instrument,
Woburn, MA). The superfusion solution was ejected by a 22-gauge needle
placed near the edge of the conical well containing the oocyte pair.
The level of the solution in the chamber was maintained constant by
continuous suction. Electrical uncoupling of oocyte pairs was induced
by 3 or 15 min of superfusion (0.6 ml/min) of
Cl
-free saline
(Cl
replaced with
methanesulfonate) continuously gassed with 100% CO2. The
Cl
-free saline contained
(in mM) 75 NaOH, 10 KOH, 4 Ca(OH)2, 5 Mg(OH)2, and 10 MOPS, with pH
adjusted to 7.2 with methanesulfonic acid. The
Cl
-free saline was used to
prevent an increase in membrane current caused by the opening of
Ca2+-activated
Cl
channels during exposure
to 100% CO2 (11), which could
interfere with junction current
(Ij)
measurement.
Double voltage-clamp recording.
All the experiments were performed using the standard double
voltage-clamp procedure for measuring junction conductance
(Gj) (16)
according to a previously published protocol (11). Briefly, microelectrodes were pulled from borosilicate glass capillaries (1.2 mm
OD, 0.68 mm ID; Kwik fill, W-P Instruments, New Haven, CT) by means of
a Brown-Flaming micropipette puller (Sutter Instruments, San Francisco,
CA). The microelectrodes, filled with a 3 M KCl solution, had a low tip
resistance (0.5-1 M
in ND 96 medium), such that, even in oocyte
pairs with significantly different initial Gj (Table
2), similar percent drops in
Gj with
CO2 were attained. The bath was
grounded with a silver-silver chloride reference electrode connected to
the superfusion chamber via an agar bridge. After the insertion of a
current and a voltage microelectrode in each of the two oocytes, both
oocytes were initially voltage clamped to the same holding potential
(Vm), similar
to their resting membrane potential, so that no
Ij would flow at
rest (Ij = 0 pA). A junction potential
(Vj) gradient
was created by imposing a +20-mV voltage step
(V1) of 2-s
duration every 30 s to oocyte 1 while maintaining V2 at
Vm; thus
Vj = V1. The
negative-feedback current (I2), injected
by the clamp amplifier in oocyte 2 for
maintaining V2
constant at Vm,
was used to calculate
Gj, inasmuch as
it is identical in magnitude to
Ij but of
opposite sign (Ij =
I2); Gj = Ij/Vj.
Pulse generation and data acquisition were performed by means of a
computer equipped with pClamp software and Labmaster TL-1A/D-D/A
interface (Axon Instruments, Foster City, CA).
|
20 mV. Voltage steps of
20 mV (±120-mV maximum) and 20-s duration were then applied to
either oocyte of the pair, while the other was maintained at
20
mV. To illustrate the relationship between steady-state
Gj
(Gj ss) and Vj, the
normalized Gj
(Gj ss/Gj max,
where
Gj max is
maximal Gj) was
plotted with respect to
Vj. The curve was
fitted to a two-state Boltzmann distribution of the following form:
(Gj ss
Gj min)/(Gj max
Gj ss) = exp[
A(Vj
V0)],
where V0 is the Vj at which the
voltage-sensitive conductance is one-half of the maximal value,
Gj min is
the theoretical minimum normalized
Gj, and
A = nq/kT is a constant expressing voltage
sensitivity in terms of number of equivalent gating charges
(n) moving through the entire
applied field, where q is the electron
charge, k is the Boltzmann constant,
and T is the temperature in Kelvin.
| |
RESULTS |
|---|
|
|
|---|
Effect of arginine mutation to lysine or histidine on CO2 gating sensitivity of Cx32. In a previous study we reported that replacement of five R residues of CT1 (R215, R219, R220, R223, and R224) with N or T greatly enhances the CO2 gating sensitivity of Cx32 (21). To determine whether it is the positive charge of the R residue or the R residue per se that inhibits CO2 gating sensitivity, in the present study the five R residues of CT1 were replaced with another basic residue, K (mutant 5R/K), or with H (mutant 5R/H), a residue that assumes a positive charge at acidic pH.
With 3-min CO2 exposures, Gj dropped to 89.4 ± 3.9% (mean ± SE, n = 3) with 5R/K (Fig. 1A, see Fig. 3) and to 90.6 ± 6.7% (n = 3) with 5R/H (Fig. 1B, see Fig. 3). With 15-min exposures to 100% CO2, Gj dropped to 58.8 ± 6.0% (n = 5) with 5R/K (Fig. 1A, see Fig. 3) and to 43.6 ± 9.0% (n = 4) with 5R/H (Fig. 1B, see Fig. 3). Thus 5R/K and 5R/H channels displayed low CO2 sensitivity, virtually identical to that of Cx32 (see Fig. 3). In both mutants, maximum uncoupling and recoupling rates (Fig. 1) were also similar to those of wild-type Cx32 [~9%/min (21)], but the uncoupling rate differed greatly from that of the mutant 5R/N [~18%/min (21)].
|
Effect of four arginine mutations to asparagine residues on CO2 gating sensitivity. To test the role of individual positive charges of CT1 in CO2 gating sensitivity, the R residues were mutated four at a time to N residues (4R/N#1, 4R/N#2, 4R/N#3, 4R/N#4, and 4R/N#5, Table 1). On exposure to 100% CO2, only the mutant 4R/N#1 (only R215 preserved) reproduced precisely the uncoupling behavior of wild-type Cx32. 4R/N#1 (Figs. 2A and 3) and wild-type Cx32 (Fig. 3) behaved almost identically not only in uncoupling magnitude, but also in uncoupling and recoupling rates. Gj of 4R/N#1 channels dropped to 86.5 ± 9.7% (n = 4) with 3 min of CO2 exposure and to 38.5 ± 7.2% (n = 5) with 15 min of CO2 exposure, at a maximum uncoupling rate of 6.9%/min (Figs. 2A and 3).
|
|
Transjunctional voltage gating in oocyte pairs expressing wild-type Cx32 or R/N mutants. The voltage dependence of Gj was determined by measuring Gj max, defined as the steady-state junctional conductance at a Vj of ±20 mV, and Gj ss, measured at the end of each Vj pulse. To illustrate the relationship between Gj ss and Vj, Gj ss/Gj max was plotted with respect to Vj (Fig. 4C), and the curve was fitted to a two-state Boltzmann distribution (Fig. 4, A and B).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
This study shows that the positive charge of arginine residues located near the NH2-terminal end (CT1) of the COOH-terminal chain of Cx32 modulates the chemical gating sensitivity of gap junction channels. Two of the five R residues present (R215 and R219) have inhibitory function, whereas the other three (R220, R223, and R224) have no effect or may slightly enhance gating sensitivity. This conclusion is based on a comparison, in terms of magnitude and rate of Gj decrease with exposure to 100% CO2, between oocyte pairs expressing wild-type Cx32 and oocyte pairs expressing mutants in which the R residues of CT1 were entirely replaced with K, H, or N residues or replaced four at a time with N residues.
In a previous study (21) we reported a dramatic increase in CO2 gating sensitivity with replacement of the five R residues of the CT1 domain of Cx32 with polar-neutral residues (N or T). This observation suggested that the positively charged nature of the CT1 domain might be inhibitory to chemical gating sensitivity. However, the possibility that the inhibitory function was related to the arginine residue per se, rather than to its positive charge, could not be discarded. The present study proves that the positive charge of some of the R residues of CT1 is indeed the reason for their inhibitory influence on CO2 gating sensitivity, because replacement of R with other basic residues, K or H, did not change gating sensitivity. Because intracellular pH (pHi) of the normal oocyte is ~7.6 (11) and the imidazole group of histidine (in proteins) becomes protonated (assumes positive charge) at pH 6.7-7.1 (7), we thought that the mutant 5R/H might display a two-stage gating behavior, inasmuch as the presence of H residues could make the inhibitory function of CT1 pH sensitive. We thought that, with CO2, Gj might drop rapidly at first, inasmuch as H residues would still be neutral, and that as pHi drops below 7 the H residues would become protonated and their positive charge would start inhibiting CO2 sensitivity (as R residues do), slowing down the rate of Gj drop. Had this been the case, one would also have expected the maximum rate and magnitude of Gj drop to increase compared with Cx32 and mutant 5R/K. The fact that mutant 5R/H behaved just like Cx32 and 5R/K indicates that H residues become protonated early in the process, before the gating mechanism is activated. Indirectly, this is consistent with the observation that pHi decreases and bottoms significantly earlier than does Gj (11, 21).
Previous evidence (21) suggested that R215 is the strongest inhibitor of CO2 gating sensitivity, that the R219-R220 complex has less inhibitory power than R215, and that the R223-R224 complex may partly counteract the inhibitory activity of R215 and the R219-220 complex. That study, however, did not determine the individual function of R219, R220, R223, and R224. The present study shows that between R219 and R220 only R219 has some, but low, inhibitory power, because 4R/N#2 (R219 preserved) is less sensitive than 5R/N (no R preserved), whereas R220 causes no inhibition, inasmuch as 4R/N#3 (R220 preserved) is virtually as sensitive as 5R/N. Neither R223 nor R224 seems to cause any inhibition, because 4R/N#4 (R223 preserved) and 4R/N#5 (R224 preserved) are as sensitive as, or possibly even more sensitive than, 5R/N. Evidence for very high CO2 sensitivity of 4R/N#4 and 4R/N#5 (R223 or R224 preserved), which appears even greater than that of 5R/N, is consistent with our previous observation (21) that these residues, when present together, can mildly counteract the inhibitory power of R215 or the R219-R220 complex.
The inhibitory function of CT1 may
involve charge interaction between acidic residues of the
NH2-terminal end of the
cytoplasmic loop (CL1) and basic
residues of CT1 (10, 22), as well
as hydrophobic interactions, inasmuch as in both domains several hydrophobic residues are present near the charged residues. However, the possibility that more global conformational changes in Cx32 take
place cannot be ruled out. Indeed, it should be stressed that whether
there was any form of interaction between
CT1 and CL is based entirely on
circumstantial evidence. If CT1
and CL interact with each other electrostatically and hydrophobically, CT1 could function as a latch that
keeps the channel open by immobilizing CL, a potential gating element.
The gating process could somehow break the
CL1-CT1
interaction, enabling CL to move toward the channel pore. This model
may also be supported by our preliminary evidence for increased gating
sensitivity to CO2 with the
mutation of an acidic residue of
CL1 (E102) to R and of two
hydrophobic residues of CL1 (M105
and L106) to polar uncharged residues (unpublished data). It is worth
noting that in
-helical conformation (the likely structure of these
domains) the inhibitory arginines of CT1 (R215 and R219) and all the
acidic residues of CL1 (El02, E109, and D113) are located on the same side of their respective helices together with hydrophobic residues, which would facilitate electrostatic and hydrophobic interactions between the two domains.
The absence of obvious changes in Vj sensitivity with the removal of positive charges of CT1 indicates that this domain has no obvious function in voltage gating. A number of studies have reported a participation of the NH2 terminus and first outer loop regions in voltage gating (12, 18). Our previous work with Cx32/Cx38 chimeras has demonstrated a participation of the NH2 terminus and CL1 (19, 20). Recently, a preliminary study (1) reported a change in Vj sensitivity of Cx32 and Cx43 with CT deletion, in particular a loss of fast inactivation kinetics. However, this change may be related to other charged domains of CT, because in our study neither of the kinetics of the double-exponential Gj decay changed significantly in the mutant 5R/N with respect to wild-type Cx32.
On the basis of data from Cx32 mutants expressed in Xenopus oocyte pairs, we conclude that positive charges of the NH2-terminal end of the COOH-terminal chain modulate the gating sensitivity of gap junction channels to CO2. Of the five basic residues present, R215 is a very strong inhibitor of CO2 gating sensitivity and R219 is a weak inhibitor, whereas R220, R223, and R224 do not inhibit or may, in fact, slightly enhance sensitivity. Potential electrostatic and hydrophobic interactions between this basic COOH-terminal domain and the acidic/hydrophobic surface of a cytoplasmic loop domain are being proposed. If it is present, this interaction could inhibit chemical gating sensitivity by restraining the mobility of the cytoplasmic loop, a potential gating structure.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Dr. Eric C. Beyer (University of Chicago) for providing the cDNA clone for the rat liver Cx32 and to Lillian M. Peracchia for excellent technical help.
| |
FOOTNOTES |
|---|
This study was supported by National Institute of General Medical Sciences Grant GM-20113.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: C. Peracchia, Dept. of Pharmacology and Physiology, School of Medicine and Dentistry, University of Rochester, 601 Elmwood Ave., Rochester, NY 14642-8711.
Received 3 February 1998; accepted in final form 20 July 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Barrio, L. C., C. Castro, and A. Revilla. Fast
inactivation of Cx32 and Cx43 junctions mediated by the
carboxy-terminal domain. Proc. Int. Gap Junction Conf.
Key Largo, FL, 1997, p. 38.
2.
Bruzzone, R.,
T. W. White,
and
D. L. Paul.
Expression of chimeric connexins reveals new properties of the formation and gating behavior of gap junction channels.
J. Cell Sci.
107:
955-967,
1994[Abstract].
3.
Ek, J. F.,
M. Delmar,
R. Perzova,
and
S. M. Taffet.
Role of histidine 95 on pH gating of the cardiac gap junction protein connexin43.
Circ. Res.
74:
1058-1064,
1994
4.
Ek-Vitorin, J. F.,
G. Calero,
G. E. Morley,
W. Coombs,
S. M. Tafet,
and
M. Delmar.
pH regulation of connexin43: molecular analysis of the gating particle.
Biophys. J.
71:
1273-1284,
1996[Medline].
5.
Hermans, M. M. P.,
P. Kortekaas,
H. J. Jongsma,
and
M. B. Rook.
The role of histidine residues on pH sensitivity of the gap junction protein connexin 43 (Abstract).
Mol. Biol. Cell
7:
91A,
1996.
6.
Liu, S.,
S. Taffet,
L. Stoner,
M. Delmar,
M. L. Vallano,
and
J. Jalife.
A structural basis for the unequal sensitivity of the major cardiac and liver gap junctions to intracellular acidification: the carboxyl tail length.
Biophys. J.
64:
1422-1433,
1993[Medline].
7.
Means, G. E.,
and
R. E. Feeney.
Chemical Modification of Proteins. San Francisco, CA: Holden-Day, 1971, p. 11-20.
8.
Morley, G. E.,
S. M. Taffet,
and
M. Delmar.
Intramolecular interactions mediate pH regulation of connexin43 channels.
Biophys. J.
70:
1294-1302,
1996[Medline].
9.
Paul, D. L.
Molecular cloning of cDNA for rat liver gap junction protein.
J. Cell Biol.
103:
123-134,
1986
10.
Peracchia, C.,
and
X. G. Wang.
Connexin domains relevant to the chemical gating of gap junction channels.
Braz. J. Med. Biol. Res.
30:
577-590,
1997[Medline].
11.
Peracchia, C.,
X. Wang,
L. Li,
and
L. L. Peracchia.
Inhibition of calmodulin expression prevents low-pH-induced gap junction uncoupling in Xenopus oocytes.
Pflügers Arch.
431:
379-387,
1996[Medline].
12.
Rubin, J. B.,
V. K. Verselis,
M. V. L. Bennett,
and
T. A. Bargiello.
Molecular analysis of voltage dependence of heterotypic gap junctions formed by connexins 26 and 32.
Biophys. J.
62:
183-195,
1992.
13.
Sambrook, J.,
E. Fritsch,
and
T. Maniatis.
Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989.
14.
Spray, D. C.,
and
J. M. Burt.
Structure-activity relations of the cardiac gap junction channel.
Am. J. Physiol.
258 (Cell Physiol. 27):
C195-C205,
1990
15.
Spray, D. C.,
A. L. Harris,
and
M. V. L. Bennett.
Gap junctional conductance is a simple and sensitive function of intracellular pH.
Science
211:
712-715,
1981
16.
Spray, D. C.,
A. L. Harris,
and
M. V. Bennett.
Equilibrium properties of a voltage-dependent junctional conductance.
J. Gen. Physiol.
77:
77-93,
1981
17.
Turin, L.,
and
A. E. Warner.
Carbon dioxide reversibly abolishes ionic communication between cells of early amphibian embryo.
Nature
270:
56-57,
1977[Medline].
18.
Verselis, V. K.,
C. S. Ginter,
and
T. A. Bargiello.
Opposite voltage gating polarities of two closely related connexins.
Nature
368:
348-351,
1994[Medline].
19.
Wang, X. G.,
L. Q. Li,
L. L. Peracchia,
and
C. Peracchia.
Chimeric evidence for a role of the connexin cytoplasmic loop in gap junction channel gating.
Pflügers Arch.
431:
844-852,
1996[Medline].
20.
Wang, X. G.,
and
C. Peracchia.
Connexin32/38 chimeras suggest a role for the second half of the inner loop in gap junction gating by low pH.
Am. J. Physiol.
271 (Cell Physiol. 40):
C1743-C1749,
1996
21.
Wang, X. G.,
and
C. Peracchia.
Positive charges of the initial C-terminus domain of Cx32 inhibit gap junction gating sensitivity to CO2.
Biophys. J.
73:
798-806,
1997[Medline].
22.
Wang, X. G.,
and
C. Peracchia.
Domains of connexin32 relevant to CO2-induced channel gating.
In: Gap Junctions, edited by R. Werner. Amsterdam: IOS, 1998, p. 35-39.
23.
Werner, R.,
E. Levine,
C. Rabadan-Diehl,
and
G. Dahl.
Gating properties of connexin32 cell-cell channels and their mutants expressed in Xenopus oocytes.
Proc. R. Soc. Lond. B Biol. Sci.
243:
5-11,
1991[Medline].
This article has been cited by other articles:
![]() |
T. W. White, M. Srinivas, H. Ripps, A. Trovato-Salinaro, D. F. Condorelli, and R. Bruzzone Virtual cloning, functional expression, and gating analysis of human connexin31.9 Am J Physiol Cell Physiol, September 1, 2002; 283(3): C960 - C970. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Peracchia, X. G. Wang, and L. L. Peracchia Is the chemical gate of connexins voltage sensitive? Behavior of Cx32 wild-type and mutant channels Am J Physiol Cell Physiol, June 1, 1999; 276(6): C1361 - C1373. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. I Grichtchenko, I. Choi, X. Zhong, P. Bray-Ward, J. M. Russell, and W. F. Boron Cloning, Characterization, and Chromosomal Mapping of a Human Electroneutral Na+-driven Cl-HCO3 Exchanger J. Biol. Chem., March 9, 2001; 276(11): 8358 - 8363. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |