Vol. 275, Issue 5, C1239-C1246, November 1998
Role of the
-subunit
326GRV sequence in the surface
expression of fibrinogen and vitronectin receptors
Milagros
Ferrer,
Matilde S.
Ayuso,
Nora
Butta,
Roberto
Parrilla, and
Consuelo
González-Manchón
Department of Pathophysiology and Human Molecular Genetics, Centro
de Investigaciones Biológicas, Consejo Superior de
Investigaciones Científicas, Velázquez 144, 28006-Madrid,
Spain
 |
ABSTRACT |
The platelet GPIIb-GPIIIa heterodimer (integrin
IIb
3)
binds fibrinogen with high affinity in response to activation by
agonists, leading to platelet aggregation and formation of a hemostatic plug. The 326GRV motif in GPIIb is
highly conserved in the
-subunit of other integrins, suggesting that
it might play an important functional role. Moreover,
Arg327
His substitution in
GPIIb has been associated with defective platelet surface expression of
GPIIb-IIIa and thrombasthenic phenotype. This work aimed at elucidating
whether the absence of Arg327 or
its substitution by His was responsible for the impaired surface expression of GPIIb-IIIa complexes. Transfection of cDNA encoding [Ala327]GPIIb,
[Gln327]GPIIb, or
[Phe327]GPIIb into
Chinese hamster ovary cells inherently expressing GPIIIa permitted
surface exposure of GPIIb-IIIa complexes, whereas [Glu327]GPIIb did not.
These observations indicate that it is not the loss of
[Arg327]GPIIb but the
presence of His327 or a negatively
charged residue like Glu at position 327 of GPIIb that prevents the
surface exposure of GPIIb-IIIa heterodimers. In contrast, changing
Gln344, the homologue to
Arg327 in the
-subunit of the
vitronectin receptor, to His did not prevent the surface expression of
v-GPIIIa
complexes. Thus the conformational constraint imposed by
His327 seems to be rather specific
for the heterodimerization and/or processing of GPIIb-IIIa
complexes.
GPIIb; GPIIb-IIIa; integrins; mutagenesis
 |
INTRODUCTION |
THE PLATELET PLASMA membrane GPIIb-GPIIIa complex
(integrin
IIb
3)
is a calcium-dependent heterodimer that binds fibrinogen and other
adhesive RGD molecules with high affinity upon activation by agonists,
leading to cell aggregation and formation of a hemostatic plug.
Quantitative or qualitative changes in the platelet GPIIb-IIIa complexes are the underlying etiopathogenic mechanism of the
Glanzmann's thrombasthenia (11), an autosomal recessive platelet
disorder that causes lifelong mucocutaneous bleeding (10). The
platelets from these patients fail to aggregate either spontaneously
(13, 27) or in response to physiological agonists like thrombin, ADP,
epinephrine, or collagen (3). The knowledge of the sequence and
structural organization of the GPIIb and GPIIIa genes has permitted
mutations associated with thrombasthenic phenotypes to be
unveiled. So far, four missense homozygous mutations have been reported in GPIIb with the result of distinct functional repercussions. Three of them were associated with type I
thrombasthenia, characterized by the absence of platelet GPIIb-IIIa (4,
19, 26). The fourth one, a
G1074
A transition that
changes Arg327 for His, was almost
simultaneously reported (8, 24) and later on functionally characterized
by two groups (7, 25). This mutation causes a type II thrombasthenia,
characterized by a platelet GPIIb-IIIa content ~20% of the normal
values. The Arg327 of GPIIb lies
within a sequence that is highly conserved in the
-subunit of most
integrins (Fig. 1). However, unlike the flanking Gly and
Val residues that are invariable, Arg is replaced by Glu in some
integrins. This observation prompted us to investigate whether the
deleterious effect of
[His327]GPIIb was
caused by either the absence of
Arg327 or the presence of His at
that position. The present work provides experimental evidence
indicating that substitution of
Arg327 for
Ala327,
Gln327, or
Phe327 does not prevent the
surface expression of GPIIb in transfected Chinese hamster ovary (CHO)
cells, indicating that the presence of
His327 and not the loss of
[Arg327]GPIIb might be
responsible for the deficient surface expression of GPIIb-IIIa
complexes in human platelets. In contrast, we found that replacement of
Gln344, the homologue to
Arg327 in the
v-subunit of the vitronectin
receptor, with His did not prevent the surface expression of
v-GPIIIa
(
v
3)
complexes in transfected cells. The functional importance of the GPIIb
residues flanking Arg327,
Gly326, and
Val328 has also been investigated
in experiments in which recombinant cDNAs encoding
[Ala326]GPIIb or
[Ala328]GPIIb were
stably transfected into CHO cells.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 1.
Homology of the region encompassing
Arg327-GPIIb in -subunits from
several integrins. Arrow points to
Arg327 in GPIIb. Numbering
corresponds to that of human GPIIb. Similarity searches of the region
of human GPIIb encompassing the
326GRV sequence were performed
with the program BLAST (1) from the National Center of Biotechnology
Information (Bethesda, MD). AA, amino acid; FNR, fibronectin
receptor.
|
|
 |
MATERIALS AND METHODS |
Cloning and sequencing of PCR amplified
fragments. Amplification of DNA was carried out with
Taq polymerase according to the protocol recommended by Perkin-Elmer Cetus (Norwalk, CT).
MgCl2 concentration and annealing
temperature were optimized for each pair of primers. Each amplification
cycle consisted of 1 min of denaturation at 94°C, 1 min of
annealing at 55°C, and 2 min of extension at 72°C. Portions of
the PCR products were analyzed by agarose gel electrophoresis and,
after purification, were cloned in a T vector (16). At least 10 positive clones from each amplification were selected, and their
sequence was determined (21) with the T7 sequencing kit of Pharmacia
Biotech (Uppsula, Sweden). Sequence analysis was carried out as
described by Marck (17).
Construction of mammalian expression vectors with normal or mutant
GPIIb or
v-cDNAs.
GPIIb cDNA with a G
A substitution at position 1074 was prepared
by the splicing by overlap extension PCR procedure (14). Two sets
of oligonucleotide primers were designed to amplify overlapping fragments encompassing the Bsm
I-Acc I (961-1371) segment of
GPIIb cDNA: Bsm I (sense)
(955-979) primer: 5'-TATTTTGG GCATTCAGTCGCTGTCA-3'; primer-2 (antisense) (1086-1065):
AACAAATACA
GCCCCACT; primer-1 (sense)
(1065-1086):
5'-AGTGGG
TGTGTATTTGTTC-3';
and Acc I (antisense) (1382-1359)
primer: 5'-TTGTCATCGATGTCTACGGCACCT-3'. Bases substituted to generate mutations in overlapping primers are underlined. Briefly, in a first step, a 15-cycle primary PCR reaction of each
fragment was performed using normal GPIIb cDNA as template.
Second, after Klenow treatment to remove extra 3'
bases, a portion of the PCR products bearing overlapping
complementary ends were used to prime on each other and be
amplified with the primers hybridizing at the nonoverlapping
ends. The amplified DNA carrying the mutation was
digested with Bsm I and
Acc I and ligated in a vector
containing the normal GPIIb cDNA previously digested with the
same restriction enzymes. GPIIb mutants in which Ala was
substituted for Gly326,
Arg327, or
Val328 were prepared as described
above, using the following pairs of overlapping
primers: sense,
5'-GAAGT
GCGTGTGTATTTG-3' and
antisense, GAACAAATACACA C
CCAC; sense,
5'-GCCGAAGTGG
GTGTAT-3' and antisense,
5'-ATAC
CCCCACTTC-3';
and sense, GTGGGGCG
GTATTTGTTC and
antisense,
5'-CAGGAACAAAT
CACGCC-3',
respectively. Bases substituted to generate mutations in overlapping
primers are underlined. Normal and mutated cDNAs were subcloned into
the Hind III site of pCEP4
(Invitrogen), a mammalian expression vector carrying the hygromycin
resistant gene as a selection marker.
cDNAs encoding
[His327]GPIIb,
[Glu327]GPIIb,
[Gln327]GPIIb, and
[Phe327]GPIIb mutants
were constructed by converting the codon for
Arg327 (CGT) to CAT (His), GAA
(Glu), CAA (Gln), and TTT (Phe), respectively, using
oligonucleotide-directed mutagenesis as described above. Normal and
mutated cDNAs were then subcloned into the
Hind III site of pcDNA3
(Invitrogen).
The cDNA encoding the normal human
v-subunit of the vitronectin
receptor was subcloned into the Hind
III site of pCEP4. Construction of
pCEP4-[His344]
v
was performed using the strategy described for the GPIIb subunit, with
the primers:
v-sense
(846-866) 5'-GGTTTATATTTATGATGGGA-3' and
v (mutated)-antisense
(1046-1026)
5'-AGACACTGAG
TGCCCCA-3' to
yield a fragment of 199 bp; and
v (mutated)-sense
(1025-1045) 5'-TGGGG
GT CTCAGTGTCT-3'
and
v-antisense
(1330-1310) 5'-TATCTGTGGCTCCTTTCATT-3' to yield a
305-bp product. Bases substituted to generate mutation in overlapping
primers are underlined. Portions of these PCRs were used as a
template to amplify the final product with the nonoverlapping primers.
After digestion with Afl III and
Sph I, the resulting fragment was
substituted for the same sequence in the normal
v-cDNA.
Nucleotide sequence analysis was performed to confirm the
proper insertion of the amplified mutant products into the normal GPIIb
and
v-cDNAs and the absence of
errors potentially caused by the Taq
polymerase.
Cell culture and transfection. A CHO
cell line stably expressing human glycoprotein IIIa (CHO-GPIIIa cells)
was obtained from Dr. N. Kieffer. This cell line was obtained by
cotransfection of dehydrofolate reductase-deficient CHO
cells with human GPIIIa-cDNA carried by the expression vector pBJ1,
derived from the plasmid pcDL-SR
296 (23), and the expression plasmid
pDHFR, carrying the DHFR gene. Cells were grown in DMEM containing 10%
fetal calf serum. Stable transfections with 5 µg of either
pCEP4-GPIIb,
pCEP4-[His327]GPIIb,
pCEP4-[Ala327]GPIIb,
pCEP4-[Ala326]GPIIb,
pCEP4-[Ala328]GPIIb,
pCEP4-[Gln344]
v,
or
pCEP4-[His344]
v
were performed by the calcium phosphate precipitation procedure (20).
The transfected cells were fed with medium containing 200 µg/ml
hygromycin every 3-4 days. Clones from surviving cells were
harvested with the aid of cloning rings and transferred to individual
dishes for further analysis. In transient transfection analysis,
CHO-GPIIIa cells were incubated with 5 µg of either pcDNA3-GPIIb,
pcDNA3-Glu327,
pcDNA3-Gln327, or
pcDNA3-Phe327 construct in the
presence of 100 µg/ml DEAE-dextran and 100 µM chloroquine
diphosphate. After 4 h, cells were exposed to 10% DMSO for 6 min and
rinsed with PBS, completed medium was added, and incubation was
continued for 72 h.
Flow cytometric analysis. Cells were
harvested using 0.5 mM EDTA in PBS, washed two times with PBS,
resuspended at a density of 106
cells/100 µl, and incubated for 20 min at 4°C with monoclonal antibodies specific to GPIIb (M3), GPIIIa (P37; see Ref. 18), or
v (MAB1976). Next, cells were
washed and resuspended in 50 µl of PBS containing a 1:20 dilution of
FITC-conjugated F(ab')2 fragment
of rabbit anti-mouse Ig (Dako) followed by incubation at 4°C for 20 min. Finally, the cells were washed with PBS and diluted at 2.5 × 106 cells/ml, and the surface
fluorescence was analyzed in a Coulter flow cytometer, model EPICS XL.
Biotin labeling and immunoprecipitation analysis of
GPIIb-IIIa complexes from CHO-GPIIIa cells stably or transiently
transfected with normal or mutant forms of GPIIb-cDNA.
CHO-GPIIIa cells were transfected with cDNA encoding normal
[Arg327]GPIIb,
[Glu327]GPIIb,
[Gln327]GPIIb, or
[Phe327]GPIIb.
Seventy-two hours after transfection, cells were harvested, washed two
times with PBS, and incubated in 2 ml of PBS containing 2.5 mM
biotin-NHS
(D-biotin-N-hydroxysuccinimide
ester; Boehringer Mannheim) for 30 min. Cells were washed with PBS and
treated for 30 min at 4°C with lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM phenylmethylsulfonyl fluoride, 1% Triton X-100,
0.05% Tween 20, and 0.03% sodium azide). The lysates were centrifuged
15 min at 13,000 g, and the
solubilized material was precleared by incubation for 1 h at 4°C
with protein A-Sepharose CL-4B (Pharmacia Biotech). Protein A-Sepharose
was removed by centrifugation and GPIIb-IIIa complexes precipitated by
incubating 18 h at 4°C with the specific monoclonal antibodies
directed against GPIIIa (P37) or GPIIb (M3), followed by incubation for
2 h at 4°C with a polyclonal anti-mouse Ig. Next, the
immunoprecipitates were incubated for 2 h with protein A-Sepharose
CL-4B beads, washed with lysis buffer, collected by centrifugation, and
eluted by incubating 10 min at 100°C in 50 µl of 2×
reducing loading buffer (116.5 mM Tris · HCl, pH 6.8, 12% glycerol, 3.5% SDS, 0.8%
-mercaptoethanol). The samples were centrifuged, and the supernatants were electrophoresed in 0.1% SDS-7.5% polyacrylamide slab gels. Proteins were transferred to a
nitrocellulose membrane and incubated in a 1:3,000 dilution of
avidin-horseradish peroxidase (Bio-Rad Laboratories, Hercules, CA) for
1 h at room temperature. The biotin-containing materials were detected
by incubation in PBS containing 0.015%
H202
and 0.5 mg/ml of 4-chloro-1-naphtol.
For biotin labeling and detection of total (surface and intracellular)
GPIIb-IIIa complexes, detergent lysates of CHO-GPIIIa cells transiently
transfected with cDNA encoding normal
[Arg327]GPIIb,
[His327]GPIIb, or
[Glu327]GPIIb were
incubated with 2.5 mM biotin-NHS for 1 h at room temperature, followed
by immunoprecipitation with specific monoclonal antibodies as described
above.
Detection of GPIIb-mRNA or
v-mRNA in transfected cells.
Total RNA from stably transfected CHO cells was extracted by the
guanidinium thiocyanate method (5a). First-strand cDNA synthesis of the
GPIIb subunit was carried out with Moloney murine leukemia virus
reverse transcriptase according to described protocols (20), using the
oligonucleotide GPIIb [antisense (1513-1489):
CACAGCTTCTCACAGCAGGATTCAG]. cDNA was used as template for the
amplification of a 427-bp fragment using the oligonucleotides GPIIb
[sense (955-979): TATTTTGGGCATTCAGTCGCTGTCA] and GPIIb
[antisense (1382-1359): TTGTCATCGATGTCTACGGCACCT].
To detect
v-mRNA, the first
cDNA strand was synthesized using the oligonucleotide
v-antisense (1330-1310)
5'-TATCTGTGGCTCCTTTCATT-3'. A 487-bp fragment was amplified
using as template this cDNA and the primers
v-sense [(846-866)
5'-GGTTTATATTTATGATGGGA-3'] and
v-antisense [(1330-1310)
5'-TATCTGTGGCTCCTTTCATT-3']. The PCR products were
purified, and the primary sequence was determined in an automatic
sequencer from Applied Biosystems, according to protocols recommended
by the manufacturer. For both GPIIb and
v-subunits, PCR products were
only detected from reverse transcribed RNA, ruling out that plasmidic
DNA could have been used as template.
Materials. Restriction enzymes were
obtained from Boehringer (Mannheim, Germany), and DNA sequencing
reagents were from Pharmacia Biotech. The pCEP4 and pcDNA3 expression
vectors were from Invitrogen (San Diego, CA). Most other reagents were
purchased from Sigma Chemical (St. Louis, MO) or from Merck (Darmstadt,
Germany). [35S]dATP
(specific activity 1,000 Ci/mmol) was from Amersham Ibérica (Madrid, Spain). Monoclonal antibodies specific for GPIIIa (P37) and
GPIIb (M3) were a gift from Dr. J. González. The monoclonal antibody MAB1976, specific for
v-GPIIIa, was purchased from
Chemicon (Temecula, CA).
 |
RESULTS |
Mutational analysis of residue 327 of
human GPIIb. cDNAs encoding
[Arg327]-,
[His327]-, or
[Ala327]GPIIb were
cloned into the expression plasmid pCEP4 that contains the hygromycin
resistance gene as a selection marker. These constructs were stably
transfected into CHO cells. Hygromycin-resistant clones were harvested,
and the presence of mRNA-GPIIb was determined by RT-PCR analysis.
Unlike cells transfected only with human GPIIIa-cDNA, in which surface
expression of heterodimers of this glycoprotein and endogenous
-subunits (
v) of the
vitronectin receptor is observed, we failed to detect surface
expression of GPIIb in cells transfected only with the plasmid
containing the human GPIIb-cDNA (Fig.
2A). Thus the functional capacity of the different forms of GPIIb-cDNA was
studied by transfecting them into a CHO cell line stably expressing human GPIIIa on the cell surface, thereafter referred to as CHO-GPIIIa cells. When these cells were transfected with normal
[Arg327]GPIIb cDNA, we
observed surface expression of GPIIb (Fig.
2B) and an enhanced fluorescence of
GPIIIa (results not shown), indicating that GPIIIa availability is not
a limiting factor for the surface expression of GPIIb-IIIa complexes
under our experimental conditions. Figure
2B shows the surface fluorescence
analysis of cells stably transfected with cDNA encoding either normal
or mutated, His327 or
Ala327, forms of GPIIb. At least
30 clones from each experimental condition, selected from different
transfection experiments, were analyzed. In agreement with a previous
report (7),
[His327]GPIIb failed
to express at the surface of CHO cells. In contrast, when
Arg327 was replaced by
Ala327, we observed normal surface
expression of GPIIb-IIIa complexes.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Flow cytometric analysis of plasma membrane GPIIb in Chinese hamster
ovary (CHO)-GPIIIa cells stably transfected with cDNAs encoding either
normal or mutant forms of GPIIb. CHO cells stably expressing human
GPIIIa were transfected with void pCEP4 plasmid
(A), with cDNA encoding normal
[Arg327]GPIIb,
[His327]GPIIb, or
[Ala327]GPIIb
(B), with
[Ala326]GPIIb or
[Gly326]GPIIb
(C), and with
[Val328]GPIIb or
[Ala328]GPIIb
(D). Cells derived from
hygromycin-resistant clones were harvested, and the surface expression
of GPIIb-IIIa was analyzed by flow cytometry as described in
MATERIALS AND METHODS. In
A, expression of GPIIb-IIIa
heterodimers was analyzed with antibodies specific for GPIIIa
[monoclonal antibody (mAb) P37] or GPIIb (mAb M3). In
B-D,
expression levels of GPIIb-IIIa complexes analyzed with mAb M3 can be
seen. At least 30 clones from different transfection experiments were
analyzed for each experimental condition. Tracings are single
representative experiments. For the sake of clarity, the original plots
have been redrawn.
|
|
The use of the expression plasmid pCEP4, which contains both the
hygromycin-resistant gene plus the GPIIb-cDNA, ensures the effectiveness of the transfection in the selected clones. Nevertheless, the presence of GPIIb-mRNA was further verified by RT-PCR analysis of
total RNA from transfected cells. Reverse-transcribed GPIIb cDNA was
used as template for the amplification of a 427-bp fragment as
described in MATERIALS AND METHODS. The PCR products were
electrophoresed in 3% agarose gels (Fig.
3), and the identity of the amplification product was further verified by restriction analysis using
Nla III digestion to yield a 364-bp
fragment (not shown). mRNA-GPIIb was detected in all of the clones
analyzed regardless of whether or not GPIIb was expressed on the cell
surface.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
Detection of GPIIb-mRNA in transfected CHO cells. Total RNA was
obtained from CHO-GPIIIa stably transfected with normal or mutant forms
of GPIIb. Synthesis of the first-strand cDNA was performed as described
in MATERIALS AND METHODS. PCR amplifications were performed
in 40 cycles of 0.5 min at 94°C, 1 min at 60°C, and 1.5 min at
72°C, with 2.5 mM MgCl2, and
the products were resolved in 3% agarose. L: 1-kb DNA ladder;
lane 1: amplification using as
template cells transfected with void plasmid; lanes
2 and 6: PCR products
from cells transfected with normal
[Arg327]GPIIb;
lanes
3-5: PCR products
from cells transfected with mutant
[Ala326]GPIIb,
[Ala327]GPIIb, and
[His327]GPIIb,
respectively.
|
|
The importance of residue 327 of GPIIb was further investigated by
transient transfection analysis of cDNA encoding
Arg327-,
Glu327-,
Gln327-, or
[Phe327]GPIIb into
CHO-GPIIIa cells. Seventy-two hours after transfection, the intact
cells were labeled with biotin, and the GPIIb-IIIa complexes were
immunoprecipitated from the cell lysates with monoclonal antibodies
directed against either GPIIb or GPIIIa. The results of these
experiments are depicted in Fig. 4. As
expected, cells transfected with a void pcDNA3 plasmid show
immunoprecipitated GPIIIa and a slower moving band, presumably
corresponding to endogenous
-subunits; in contrast, no
immunoprecipitable material was detected when an antibody directed
against GPIIb was used. Cells transfected with normal
[Arg327]GPIIb showed
immunoprecipitated GPIIb and GPIIIa bands with an antibody against
either GPIIIa or GPIIb. Similar results were obtained in cells
transfected with either
[Gln327]- or
[Phe327]GPIIb although
the rate of expression does not seem to be as efficient as that of the
normal GPIIb. In contrast, cells transfected with GPIIb carrying a
charged amino acid as Glu at position 327 failed to express GPIIb-IIIa
complexes at the cell surface.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4.
Immunoprecipitation of biotin-labeled surface GPIIb-IIIa complexes from
transiently transfected CHO-IIIa cells. CHO cells stably expressing
human GPIIIa were transiently transfected with cDNAs encoding human
normal [Arg327]GPIIb,
[Glu327]GPIIb,
[Gln327]GPIIb, or
[Phe327]GPIIb. Intact
cells were labeled with D-biotin
N-hydroxysuccinimide ester
(biotin-NHS), and the GPIIb-IIIa complexes were immunoprecipitated with
specific monoclonal antibodies directed against GPIIIa and GPIIb.
Immunoprecipitates were electrophoresed in 0.1% SDS-7.5%
polyacrylamide slab under reducing conditions and electrotransferred to
nitrocellulose membranes. After incubation with a 1:3,000 dilution of
avidin-horseradish peroxidase, the biotin-labeled GPIIb and GPIIIa were
visualized by incubation in PBS containing 0.015%
H202
and 0.5 mg/ml of 4-chloro-1-naphtol.
|
|
To determine whether the lack of surface exposure of
[His327]GPIIb or
[Glu327]GPIIb was due
to a lack of glycoprotein expression, we incubated with biotin total
cell lysates from CHO-IIIa cells transfected with cDNA encoding either
mutant protein before the immunoprecipitation of GPIIb-IIIa complexes
(Fig. 5). The pattern of bands obtained from cells transfected with either a void plasmid or with normal GPIIb
was similar to those previously shown in surface-labeled cells.
Immunoprecipitation with anti-GPIIIa showed GPIIIa accompanied by
endogenous
-subunits in cells expressing either
[His327]GPIIb or
[Glu327]GPIIb;
however, immunoprecipitation with anti-GPIIb yielded exclusively a band
migrating like proGPIIb and virtual absence of GPIIIa and GPIIb or a
faint band migrating like GPIIIa in cells expressing [Glu327]GPIIb or
[His327]GPIIb,
respectively (Fig. 5). According to this observation, the lack of
surface exposure of
[His327]GPIIb or
[Glu327]GPIIb is not
the result of a lack of expression of these subunits under our
experimental conditions.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5.
Immunoprecipitation analysis of biotin-labeled total GPIIb-IIIa
complexes from transiently transfected CHO-IIIa cells. CHO cells stably
expressing human GPIIIa were transiently transfected with cDNAs
encoding human normal
[Arg327]GPIIb,
[His327]GPIIb, or
[Glu327]GPIIb. Total
cell lysates were labeled with biotin-NHS and the GPIIb-IIIa complexes
immunoprecipitated with specific monoclonal antibodies directed against
either GPIIIa or GPIIb and processed as described in the legend to Fig.
4.
|
|
Expression of [Ala326]- or
[Ala328]GPIIb in CHO cells.
As indicated in Fig. 1, Gly326 and
Val328 in GPIIb are conserved in
the
-subunits of integrins; therefore, we found of interest to
investigate the functional consequence of their substitution. CHO-GPIIIa cells were transfected with cDNA encoding
Gly326,
Ala326,
Val328, or
Ala328 forms of GPIIb. The
cytofluorimetric analysis of more than 30 hygromycin-resistant clones
shows a normal expression of
[Ala328]GPIIb, whereas
[Ala326] GPIIb was
not detectable at the cell surface (Fig. 2,
C and D).
Mutation analysis of the human
v-glycoprotein.
Gln344 in the
-subunit
(
v) of the human vitronectin
receptor is homologous to Arg327
in GPIIb; therefore, we found of interest to investigate whether the
replacement of Gln344 by His could
perturb the surface expression of
v-GPIIIa. For this purpose, we
transfected the plasmid
pCEP4-[His344]
v
into CHO-GPIIIa cells. Figure 6 shows that,
in contrast to GPIIb, the presence of
His344 in the
v-subunit does not prevent the
surface expression of
v-GPIIIa
complexes. Moreover, the average mean fluorescence channel in these
cells was even higher than in cells transfected with the plasmid
pCEP4-[Gln344]
v
carrying the cDNA encoding the normal form of
v. The presence of the mutated
[His344]
v-mRNA
in the transfected cells was verified by PCR amplification of
reversed-transcribed RNA and direct sequencing of the PCR products.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Flow cytometric analysis of v
and GPIIIa in CHO cells transfected with cDNA encoding either human
normal
[Gln344] v
or
[His344] v.
CHO cells stably expressing human GPIIIa (CHO-GPIIIa cells) were
transfected with cDNAs encoding either human normal
[Gln344] v
or
[His344] v
as described in MATERIALS AND METHODS. Hygromycin-resistant
clones were harvested, and the surface expression of
v and GPIIIa was analyzed by
flow cytometry. Top: surface
expression of endogenous v and
GPIIIa in CHO-GPIIIa cells. NC, negative control, cells exposed only to
FITC-conjugated rabbit
F(ab')2 anti-mouse IgG.
Middle and
bottom: surface expression of
v and GPIIIa in cells
transfected with either the normal or the mutated form of
v, respectively. At least 25 clones from 2 different transfection experiments were analyzed for each
experimental condition using the indicated monoclonal antibodies.
Tracings are single representative experiments. For the sake of
clarity, the original plots have been redrawn.
|
|
 |
DISCUSSION |
In agreement with previous results (7, 25), transfection of
[His327]GPIIb-cDNA
into CHO cells stably expressing GPIIIa (CHO-GPIIIa cells) showed
subnormal amounts of GPIIb-IIIa at the cell surface (Fig.
2B). The possibility of defective
transfections can be ruled out since similar amounts of GPIIb-mRNA have
been amplified by PCR using as template cDNA reverse transcribed from
total RNA obtained from cells stably transfected with either normal or
mutant [His327]GPIIb
(Fig. 3). Arg327
His
substitution is the fourth reported case of Glanzmann thrombasthenia with a single point mutation in GPIIb in which the entire open reading
frame is conserved and therefore can be translated into a full-length
protein. The present case shares with the previously reported
Gly273
Asp (19),
Gly418
Asp (26), and
Glu324
Lys (4) homozygous
mutations that maturation and/or transport of the GPIIb-IIIa
complex is impeded. However, unlike these three missense
mutations that were associated with type I,
[His327]GPIIb is
responsible for type II Glanzmann thrombasthenia (7). Most probably,
the pathogenic mechanism underlying these cases is that the substituted
residue prevents the proper protein conformation required for
intracellular maturation and/or trafficking of the GPIIb-IIIa
complex. His327 lies between the
second and the third calcium binding domains and is only 13 residues
away from the binding domain of the
-chain dodecapeptide of
fibrinogen. Thus this might provide an explanation for the remarkably
low fibrinogen content (
1%) found in thrombasthenic individuals
homozygous for this mutation (7). The presence of residue 327 between
the second and third calcium binding sites poses the question as to
whether the pathogenic mechanism of
[His327]GPIIb is
related to changes in the calcium binding capacity and therefore in the
ability to maintain subunit association (5, 6, 9, 15, 22). Moreover,
calcium occupancy of GPIIb appears to be essential for an effective
fibrinogen binding (12). We have recently shown by immunoprecipitation
analysis of recombinant [His327]GPIIb-GPIIIa
complexes expressed in CHO cells that this mutation does not impede
subunit association (7). Thus even though calcium binding properties of
[His327]GPIIb were
perturbed, subunit dimerization does not seem to be impeded.
The data reported herein demonstrate that
Arg327 in GPIIb is not essential
for surface expression of recombinant GPIIb-IIIa complexes in CHO cells
since its substitution for other amino acids did not prevent the
surface expression of heterodimers (Figs. 2 and 4). Replacement of
Arg327 by hydrophobic residues
like Ala or Phe permitted the surface exposure of GPIIb-IIIa. Unlike
His, the presence of other polar residues like Gln at position 327 also
resulted in surface expression of GPIIb-IIIa. The latter observation is
consistent with the presence of Gln instead of Arg at a similar
position in the
-subunits of other integrins (Fig. 1). In contrast,
GPIIb containing a negatively charged amino acid like Glu at that
position failed to expose at the cell surface. Immunoprecipitation
analysis of GPIIb-IIIa complexes from total cell lysates of CHO-IIIa
cells transfected with either
[His327]GPIIb or
[Glu327]GPIIb
demonstrated accumulation of proGPIIb (Fig. 5), ruling out that the
lack of surface exposure was due to a lack of GPIIb expression.
Moreover, the endoproteolytic cleavage of intracellular proGPIIb to
form the heavy and light chains of GPIIb requires its association to
GPIIIa (2); thus, the accumulation of proGPIIb suggests a failure of
[His327]GPIIb and
[Glu327]GPIIb to form
stable heterodimers with GPIIIa.
These observations indicate that it is not the absence of
Arg327 but the presence of His
that causes a deficient rate of expression of GPIIb-IIIa complexes in
the thrombasthenic phenotypes. On these grounds, it seems plausible to
conclude that the presence of Arg is not essential at that position.
However, the constraints imposed by the presence of either the
imidazolic group of His or a negatively charged residue seem to be
incompatible with a functional adequate conformation of GPIIb.
Similarly, the lack of exposure of GPIIb-IIIa by replacing Ala for
Gly326 (Fig.
2C) suggests that the great
flexibility conferred by this small residue is essential to warrant a
normal functional conformation of GPIIb. In contrast, Ala substitution
for the highly conserved Val328
did not alter the surface expression of GPIIb-IIIa complexes (Fig.
2D). Because the available
structural information of the GPIIb-IIIa heterodimer is very limited,
these data provide further insights toward the understanding of the
structural-functional relationship of this glycoprotein and the factors
controlling the surface exposure of GPIIb-IIIa.
The 326GRV sequence in GPIIb is
conserved among the integrin
-subunits, suggesting it might play an
important function. In the
-subunit of the vitronectin receptor,
v-GPIIIa integrin,
Gln344 is found instead of Arg at
a similar position (Fig. 1). Nevertheless, substitution of
Arg327 for Gln in GPIIb did not
alter the surface exposure of GPIIb-IIIa (Fig. 3), indicating that
326GRV or
326GQV performs a similar function
in this subunit. We have recently demonstrated that
[His327]GPIIb prevents
the surface expression of normal GPIIb-IIIa heterodimers in transfected
CHO cells but not the expression of the GPIIIa associated with
endogenous
v-subunits (7). This
observation suggested that the mutated GPIIb did not compete with
v to form heterodimers with
GPIIIa and therefore the G(R,Q)V sequence does not play the same role
in subunit interaction in heterodimers
v-GPIIIa and GPIIb-IIIa. To
further investigate this point, we transfected cDNA encoding either
normal
[Gln344]
v
or mutated
[His344]
v
into CHO-GPIIIa cells. In both conditions, the surface fluorescence of
v-GPIIIa complexes was
significantly increased above the basal control cells expressing human
GPIIIa associated with endogenous
v-subunits, indicating that
availability of GPIIIa was not a rate-limiting step for the surface
expression of
v-GPIIIa
complexes under our experimental conditions. The presence of either
normal or mutated human
v-mRNA
in transfected cells was verified by RT-PCR analysis and sequencing of
the amplification products, precluding a possible experimental
artifact. Thus the surface expression of
[His344]
v-GPIIIa
demonstrates that, unlike
[His327]GPIIb, the
conformation of
[His344]
v
is compatible with its normal association with GPIIIa and further
processing. This might explain the lack of effect of
[His327]GPIIb in
perturbing the surface expression of endogenous
v-subunits.
To summarize, it is not the absence of
Arg327 but the presence of
His327 in GPIIb that is
responsible for a deficient platelet membrane exposure of GPIIb-IIIa
complexes that leads to thrombasthenic phenotype. The substitution of a
hydrophobic or a polar amino acid other than His for
Arg327 in GPIIb permitted surface
exposure of GPIIb-IIIa but a negatively charged amino acid did not,
indicating that electrostatic forces at that point may be of importance
to determine a functional conformation.
 |
ACKNOWLEDGEMENTS |
The monoclonal antibodies used in this study were a gift from Drs.
María Victoria Alvarez and José González. CHO cells stably expressing human GPIIIa (CHO-GPIIIa cells) were kindly provided
by Dr. N. Kieffer.
 |
FOOTNOTES |
This work has been supported in part by grants from the Fondo de
Investigaciones Sanitarias (96/2014), Comunidad Autónoma de
Madrid (CO7191), European Community concerted action contract no.
BMH1-CT93-1685, and Dirección General de Investigación
Científica y Técnica (PB94-1544). M. Ferrer was the
recipient of a predoctoral fellowship from the Comunidad Autónoma
de Madrid.
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: R. Parrilla, Centro de Investigaciones
Biológicas (CSIC), Velázquez 144, 28006-Madrid, Spain
(E-mail: rparrilla{at}fresno.csic.es).
Received 9 April 1998; accepted in final form 23 June 1998.
 |
REFERENCES |
1.
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers,
and
D. J. Lipman.
Basic local alignment search tool.
J. Mol. Biol.
215:
403-410,
1990[Medline].
2.
Bennett, J. S.,
M. A. Koldziej,
G. Vilaire,
and
M. Poncz.
Determinants of the intracellular fate of truncated forms of the platelet glycoproteins IIb and IIIa.
J. Biol. Chem.
268:
3580-3585,
1993[Abstract/Free Full Text].
3.
Bennett, J. S.,
and
G. Vilaire.
Exposure of platelet fibrinogen receptors by ADP and epinephrine.
J. Clin. Invest.
64:
1393-1401,
1979.
4.
Bourre, E.,
O. Peyruchaud,
P. Bray,
R. Combrié,
P. Nurden,
and
A. T. Nurden.
A point mutation in the gene for platelet GPIIb leads to a substitution in a highly conserved amino acid located between the second and the third Ca2+-binding domain (Abstract).
Blood
86:
452a,
1995.
5.
Brass, L. F.,
S. J. Shattil,
T. J. Kunicki,
and
J. S. Bennett.
Effect of calcium on the stability of the platelet membrane glycoprotein IIb-IIIa complex.
J. Biol. Chem.
260:
7875-7881,
1985[Abstract/Free Full Text].
5a.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
6.
D'Souza, S. E.,
M. H. Ginsberg,
T. A. Burke,
and
E. F. Plow.
The ligand binding site of the platelet integrin receptor GPIIb-IIIa is proximal to the second calcium binding domain of its alpha subunit.
J. Biol. Chem.
265:
3440-3446,
1990[Abstract/Free Full Text].
7.
Ferrer, M.,
M. Fernández,
C. González-Manchón,
J. González,
M. S. Ayuso,
and
R. Parrilla.
A mutant (Arg327
His) GPIIb associated with thrombasthenia exerts a dominant negative effect in stably transfected CHO cells.
Thromb. Haemost.
76:
292-301,
1996[Medline].
8.
Ferrer, M.,
M. Fernández,
C. González-Manchón,
G. Iruin,
M. S. Ayuso,
and
R. Parrilla.
Identification of a G
A transition that substitutes GPIIb Arg358 by His358 in a case of thrombasthenia of Glanzmann.
In: Advances in Gene Technology: Molecular Biology and Human Disease, edited by W. J. Whelan,
F. Ahmad,
L. Baumbach,
H. Bialy,
S. Black,
K. Davies,
J. Hodgson,
R. R. Howell,
F. Huijing,
and W. A. Scott. Oxford, UK: IRL, 1994, p. 12.
9.
Fujimura, K.,
and
D. R. Phillips.
Calcium cation regulation of glycoprotein IIb-IIIa complex formation in platelet plasma membranes.
J. Biol. Chem.
258:
10247-10252,
1983[Abstract/Free Full Text].
10.
George, J. N.,
J. P. Caen,
and
A. T. Nurden.
Glanzmann's thrombasthenia: the spectrum of clinical disease.
Blood
75:
1383-1395,
1990[Free Full Text].
11.
Glanzmann, E.
Hereditare hemorrhagische thrombasthenie: ein beitrag zur pathologie der blut plattchen.
J. Kinderkr.
88:
113-141,
1918.
12.
Gulino, D.,
C. Boudignon,
L. Y. Zhang,
E. Concord,
M.-J. Rabiet,
and
G. Marguerie.
Ca2+-binding properties of the platelet glycoprotein IIb-ligand interacting domain.
J. Biol. Chem.
267:
1001-1007,
1992[Abstract/Free Full Text].
13.
Hardisty, R. M.,
K. M. Dormandy,
and
R. A. Hutton.
Thrombasthenia: studies on three cases.
Br. J. Haematol.
10:
371-387,
1964[Medline].
14.
Horton, R. M.,
H. D. Hunt,
S. N. Ho,
J. K. Pullen,
and
L. R. Pease.
Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.
Gene
77:
61-68,
1989[Medline].
15.
Kunicki, T. J.,
D. Pidard,
J.-P. Rosa,
and
T. A. Nurden.
The formation of Ca2+-dependent complexes of platelet membrane glycoproteins IIb and IIIa in solution as determined by crossed immunoelectrophoresis.
Blood
58:
268-278,
1981[Abstract/Free Full Text].
16.
Marchuk, D.,
M. Drumm,
A. Saulino,
and
F. S. Collins.
Construction of T-vectors: a rapid and general system for direct cloning of unmodified PCR products (Abstract).
Nucleic Acids Res.
19:
1154,
1991[Free Full Text].
17.
Marck, C.
A "C" program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers.
Nucleic Acids Res.
16:
1829-1836,
1988[Abstract/Free Full Text].
18.
Méndez, J. A.,
M. V. Alvarez,
J. A. Aznarez,
and
J. González-Rodríguez.
Two fold simmetry of human fibrinogen proved at the
-chain distal domain by monoclonal immunoelectronmicroscopy image analysis.
Biochemistry
35:
634-637,
1996[Medline].
19.
Poncz, M.,
S. Rifat,
B. S. Coller,
P. J. Newman,
S. J. Shattil,
T. Parrella,
P. Fortina,
and
J. S. Bennett.
Glanzmann thrombasthenia secondary to a Gly273
Asp mutation adjacent to the first calcium-binding domain of platelet glycoprotein IIb.
J. Clin. Invest.
93:
172-179,
1994.
20.
Sambrook, J.,
E. F. Fritsch,
and
T. Maniatis.
Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
21.
Sanger, F.,
S. Nicklen,
and
A. R. Coulson.
DNA sequencing with chain terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:
5463-5467,
1977[Abstract/Free Full Text].
22.
Shattil, S. J.,
L. F. Brass,
J. S. Bennett,
and
P. Pandhi.
Biochemical and functional consequences of dissociation of the platelet membrane glycoprotein IIb-IIIa complex.
Blood
66:
92-98,
1985[Abstract/Free Full Text].
23.
Takebe, Y.,
M. Seiki,
J.-I. Fujisawa,
P. Hoy,
K. Yokota,
K.-I. Arai,
M. Yoshida,
and
N. Arai.
SR
promoter: an efficient and versatile mammalian expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat.
Mol. Cell. Biol.
8:
466-472,
1988[Abstract/Free Full Text].
24.
Wilcox, D. A.,
J. Gill,
and
P. J. Newman.
Glanzmann thrombasthenia resulting from a single amino acid substitution flanking the fibrinogen
-chain dodecapepetide binding domain on GPIIb (Abstract).
Blood
82:
210a,
1993.
25.
Wilcox, D. A.,
C. M. Paddock,
S. Lyman,
J. C. Gill,
and
P. J. Newman.
Glanzmann thrombasthenia resulting from a single amino acid substitution between the second and third calcium-binding domains of GPIIb. Role of the GPIIb amino terminus in integrin subunit association.
J. Clin. Invest.
95:
1553-1560,
1995.
26.
Wilcox, D. A.,
J. L. Wautier,
D. Pidard,
and
P. J. Newman.
A single amino acid substitution flanking the fourth calcium binding domain of alpha-IIb prevents maturation of the
IIb
3 integrin complex.
J. Biol. Chem.
269:
4450-4457,
1994[Abstract/Free Full Text].
27.
Zucker, M. B.,
J. H. Pert,
and
M. W. Hilgartner.
Platelet function in a patient with thrombasthenia.
Blood
28:
524-534,
1966[Abstract/Free Full Text].
Am J Physiol Cell Physiol 275(5):C1239-C1246
0002-9513/98 $5.00
Copyright © 1998 the American Physiological Society