Am J Physiol Cell Physiol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 275: C1239-C1246, 1998;
0363-6143/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferrer, M.
Right arrow Articles by González-Manchón, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferrer, M.
Right arrow Articles by González-Manchón, C.
Vol. 275, Issue 5, C1239-C1246, November 1998

Role of the alpha -subunit 326GRV sequence in the surface expression of fibrinogen and vitronectin receptors

Milagros Ferrer, Matilde S. Ayuso, Nora Butta, Roberto Parrilla, and Consuelo González-Manchón

Department of Pathophysiology and Human Molecular Genetics, Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Velázquez 144, 28006-Madrid, Spain

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The platelet GPIIb-GPIIIa heterodimer (integrin alpha IIbbeta 3) binds fibrinogen with high affinity in response to activation by agonists, leading to platelet aggregation and formation of a hemostatic plug. The 326GRV motif in GPIIb is highly conserved in the alpha -subunit of other integrins, suggesting that it might play an important functional role. Moreover, Arg327right-arrowHis substitution in GPIIb has been associated with defective platelet surface expression of GPIIb-IIIa and thrombasthenic phenotype. This work aimed at elucidating whether the absence of Arg327 or its substitution by His was responsible for the impaired surface expression of GPIIb-IIIa complexes. Transfection of cDNA encoding [Ala327]GPIIb, [Gln327]GPIIb, or [Phe327]GPIIb into Chinese hamster ovary cells inherently expressing GPIIIa permitted surface exposure of GPIIb-IIIa complexes, whereas [Glu327]GPIIb did not. These observations indicate that it is not the loss of [Arg327]GPIIb but the presence of His327 or a negatively charged residue like Glu at position 327 of GPIIb that prevents the surface exposure of GPIIb-IIIa heterodimers. In contrast, changing Gln344, the homologue to Arg327 in the alpha -subunit of the vitronectin receptor, to His did not prevent the surface expression of alpha v-GPIIIa complexes. Thus the conformational constraint imposed by His327 seems to be rather specific for the heterodimerization and/or processing of GPIIb-IIIa complexes.

GPIIb; GPIIb-IIIa; integrins; mutagenesis

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

THE PLATELET PLASMA membrane GPIIb-GPIIIa complex (integrin alpha IIbbeta 3) is a calcium-dependent heterodimer that binds fibrinogen and other adhesive RGD molecules with high affinity upon activation by agonists, leading to cell aggregation and formation of a hemostatic plug. Quantitative or qualitative changes in the platelet GPIIb-IIIa complexes are the underlying etiopathogenic mechanism of the Glanzmann's thrombasthenia (11), an autosomal recessive platelet disorder that causes lifelong mucocutaneous bleeding (10). The platelets from these patients fail to aggregate either spontaneously (13, 27) or in response to physiological agonists like thrombin, ADP, epinephrine, or collagen (3). The knowledge of the sequence and structural organization of the GPIIb and GPIIIa genes has permitted mutations associated with thrombasthenic phenotypes to be unveiled. So far, four missense homozygous mutations have been reported in GPIIb with the result of distinct functional repercussions. Three of them were associated with type I thrombasthenia, characterized by the absence of platelet GPIIb-IIIa (4, 19, 26). The fourth one, a G1074right-arrowA transition that changes Arg327 for His, was almost simultaneously reported (8, 24) and later on functionally characterized by two groups (7, 25). This mutation causes a type II thrombasthenia, characterized by a platelet GPIIb-IIIa content ~20% of the normal values. The Arg327 of GPIIb lies within a sequence that is highly conserved in the alpha -subunit of most integrins (Fig. 1). However, unlike the flanking Gly and Val residues that are invariable, Arg is replaced by Glu in some integrins. This observation prompted us to investigate whether the deleterious effect of [His327]GPIIb was caused by either the absence of Arg327 or the presence of His at that position. The present work provides experimental evidence indicating that substitution of Arg327 for Ala327, Gln327, or Phe327 does not prevent the surface expression of GPIIb in transfected Chinese hamster ovary (CHO) cells, indicating that the presence of His327 and not the loss of [Arg327]GPIIb might be responsible for the deficient surface expression of GPIIb-IIIa complexes in human platelets. In contrast, we found that replacement of Gln344, the homologue to Arg327 in the alpha v-subunit of the vitronectin receptor, with His did not prevent the surface expression of alpha v-GPIIIa (alpha vbeta 3) complexes in transfected cells. The functional importance of the GPIIb residues flanking Arg327, Gly326, and Val328 has also been investigated in experiments in which recombinant cDNAs encoding [Ala326]GPIIb or [Ala328]GPIIb were stably transfected into CHO cells.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1.   Homology of the region encompassing Arg327-GPIIb in alpha -subunits from several integrins. Arrow points to Arg327 in GPIIb. Numbering corresponds to that of human GPIIb. Similarity searches of the region of human GPIIb encompassing the 326GRV sequence were performed with the program BLAST (1) from the National Center of Biotechnology Information (Bethesda, MD). AA, amino acid; FNR, fibronectin receptor.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cloning and sequencing of PCR amplified fragments. Amplification of DNA was carried out with Taq polymerase according to the protocol recommended by Perkin-Elmer Cetus (Norwalk, CT). MgCl2 concentration and annealing temperature were optimized for each pair of primers. Each amplification cycle consisted of 1 min of denaturation at 94°C, 1 min of annealing at 55°C, and 2 min of extension at 72°C. Portions of the PCR products were analyzed by agarose gel electrophoresis and, after purification, were cloned in a T vector (16). At least 10 positive clones from each amplification were selected, and their sequence was determined (21) with the T7 sequencing kit of Pharmacia Biotech (Uppsula, Sweden). Sequence analysis was carried out as described by Marck (17).

Construction of mammalian expression vectors with normal or mutant GPIIb or alpha v-cDNAs. GPIIb cDNA with a Gright-arrowA substitution at position 1074 was prepared by the splicing by overlap extension PCR procedure (14). Two sets of oligonucleotide primers were designed to amplify overlapping fragments encompassing the Bsm I-Acc I (961-1371) segment of GPIIb cDNA: Bsm I (sense) (955-979) primer: 5'-TATTTTGG GCATTCAGTCGCTGTCA-3'; primer-2 (antisense) (1086-1065): AACAAATACACA<UNL>T</UNL>GCCCCACT; primer-1 (sense) (1065-1086): 5'-AGTGGGGC<UNL>A</UNL>TGTGTATTTGTTC-3'; and Acc I (antisense) (1382-1359) primer: 5'-TTGTCATCGATGTCTACGGCACCT-3'. Bases substituted to generate mutations in overlapping primers are underlined. Briefly, in a first step, a 15-cycle primary PCR reaction of each fragment was performed using normal GPIIb cDNA as template. Second, after Klenow treatment to remove extra 3' bases, a portion of the PCR products bearing overlapping complementary ends were used to prime on each other and be amplified with the primers hybridizing at the nonoverlapping ends. The amplified DNA carrying the mutation was digested with Bsm I and Acc I and ligated in a vector containing the normal GPIIb cDNA previously digested with the same restriction enzymes. GPIIb mutants in which Ala was substituted for Gly326, Arg327, or Val328 were prepared as described above, using the following pairs of overlapping primers: sense, 5'-GAAGTGG<UNL>C</UNL>GCGTGTGTATTTG-3' and antisense, GAACAAATACACA CGC<UNL>G</UNL>CCAC; sense, 5'-GCCGAAGTGGGG<UNL>AAA</UNL>GTGTAT-3' and antisense, 5'-ATACAC<UNL>TTT</UNL>CCCCACTTC-3'; and sense, GTGGGGCGTG<UNL>C</UNL>GTATTTGTTC and antisense, 5'-CAGGAACAAATAC<UNL>G</UNL>CACGCC-3', respectively. Bases substituted to generate mutations in overlapping primers are underlined. Normal and mutated cDNAs were subcloned into the Hind III site of pCEP4 (Invitrogen), a mammalian expression vector carrying the hygromycin resistant gene as a selection marker.

cDNAs encoding [His327]GPIIb, [Glu327]GPIIb, [Gln327]GPIIb, and [Phe327]GPIIb mutants were constructed by converting the codon for Arg327 (CGT) to CAT (His), GAA (Glu), CAA (Gln), and TTT (Phe), respectively, using oligonucleotide-directed mutagenesis as described above. Normal and mutated cDNAs were then subcloned into the Hind III site of pcDNA3 (Invitrogen).

The cDNA encoding the normal human alpha v-subunit of the vitronectin receptor was subcloned into the Hind III site of pCEP4. Construction of pCEP4-[His344]alpha v was performed using the strategy described for the GPIIb subunit, with the primers: alpha v-sense (846-866) 5'-GGTTTATATTTATGATGGGA-3' and alpha v (mutated)-antisense (1046-1026) 5'-AGACACTGAGAC<UNL>A</UNL>TGCCCCA-3' to yield a fragment of 199 bp; and alpha v (mutated)-sense (1025-1045) 5'-TGGGGCA<UNL>T</UNL>GT CTCAGTGTCT-3' and alpha v-antisense (1330-1310) 5'-TATCTGTGGCTCCTTTCATT-3' to yield a 305-bp product. Bases substituted to generate mutation in overlapping primers are underlined. Portions of these PCRs were used as a template to amplify the final product with the nonoverlapping primers. After digestion with Afl III and Sph I, the resulting fragment was substituted for the same sequence in the normal alpha v-cDNA.

Nucleotide sequence analysis was performed to confirm the proper insertion of the amplified mutant products into the normal GPIIb and alpha v-cDNAs and the absence of errors potentially caused by the Taq polymerase.

Cell culture and transfection. A CHO cell line stably expressing human glycoprotein IIIa (CHO-GPIIIa cells) was obtained from Dr. N. Kieffer. This cell line was obtained by cotransfection of dehydrofolate reductase-deficient CHO cells with human GPIIIa-cDNA carried by the expression vector pBJ1, derived from the plasmid pcDL-SRalpha 296 (23), and the expression plasmid pDHFR, carrying the DHFR gene. Cells were grown in DMEM containing 10% fetal calf serum. Stable transfections with 5 µg of either pCEP4-GPIIb, pCEP4-[His327]GPIIb, pCEP4-[Ala327]GPIIb, pCEP4-[Ala326]GPIIb, pCEP4-[Ala328]GPIIb, pCEP4-[Gln344]alpha v, or pCEP4-[His344]alpha v were performed by the calcium phosphate precipitation procedure (20). The transfected cells were fed with medium containing 200 µg/ml hygromycin every 3-4 days. Clones from surviving cells were harvested with the aid of cloning rings and transferred to individual dishes for further analysis. In transient transfection analysis, CHO-GPIIIa cells were incubated with 5 µg of either pcDNA3-GPIIb, pcDNA3-Glu327, pcDNA3-Gln327, or pcDNA3-Phe327 construct in the presence of 100 µg/ml DEAE-dextran and 100 µM chloroquine diphosphate. After 4 h, cells were exposed to 10% DMSO for 6 min and rinsed with PBS, completed medium was added, and incubation was continued for 72 h.

Flow cytometric analysis. Cells were harvested using 0.5 mM EDTA in PBS, washed two times with PBS, resuspended at a density of 106 cells/100 µl, and incubated for 20 min at 4°C with monoclonal antibodies specific to GPIIb (M3), GPIIIa (P37; see Ref. 18), or alpha v (MAB1976). Next, cells were washed and resuspended in 50 µl of PBS containing a 1:20 dilution of FITC-conjugated F(ab')2 fragment of rabbit anti-mouse Ig (Dako) followed by incubation at 4°C for 20 min. Finally, the cells were washed with PBS and diluted at 2.5 × 106 cells/ml, and the surface fluorescence was analyzed in a Coulter flow cytometer, model EPICS XL.

Biotin labeling and immunoprecipitation analysis of GPIIb-IIIa complexes from CHO-GPIIIa cells stably or transiently transfected with normal or mutant forms of GPIIb-cDNA. CHO-GPIIIa cells were transfected with cDNA encoding normal [Arg327]GPIIb, [Glu327]GPIIb, [Gln327]GPIIb, or [Phe327]GPIIb. Seventy-two hours after transfection, cells were harvested, washed two times with PBS, and incubated in 2 ml of PBS containing 2.5 mM biotin-NHS (D-biotin-N-hydroxysuccinimide ester; Boehringer Mannheim) for 30 min. Cells were washed with PBS and treated for 30 min at 4°C with lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM phenylmethylsulfonyl fluoride, 1% Triton X-100, 0.05% Tween 20, and 0.03% sodium azide). The lysates were centrifuged 15 min at 13,000 g, and the solubilized material was precleared by incubation for 1 h at 4°C with protein A-Sepharose CL-4B (Pharmacia Biotech). Protein A-Sepharose was removed by centrifugation and GPIIb-IIIa complexes precipitated by incubating 18 h at 4°C with the specific monoclonal antibodies directed against GPIIIa (P37) or GPIIb (M3), followed by incubation for 2 h at 4°C with a polyclonal anti-mouse Ig. Next, the immunoprecipitates were incubated for 2 h with protein A-Sepharose CL-4B beads, washed with lysis buffer, collected by centrifugation, and eluted by incubating 10 min at 100°C in 50 µl of 2× reducing loading buffer (116.5 mM Tris · HCl, pH 6.8, 12% glycerol, 3.5% SDS, 0.8% beta -mercaptoethanol). The samples were centrifuged, and the supernatants were electrophoresed in 0.1% SDS-7.5% polyacrylamide slab gels. Proteins were transferred to a nitrocellulose membrane and incubated in a 1:3,000 dilution of avidin-horseradish peroxidase (Bio-Rad Laboratories, Hercules, CA) for 1 h at room temperature. The biotin-containing materials were detected by incubation in PBS containing 0.015% H202 and 0.5 mg/ml of 4-chloro-1-naphtol.

For biotin labeling and detection of total (surface and intracellular) GPIIb-IIIa complexes, detergent lysates of CHO-GPIIIa cells transiently transfected with cDNA encoding normal [Arg327]GPIIb, [His327]GPIIb, or [Glu327]GPIIb were incubated with 2.5 mM biotin-NHS for 1 h at room temperature, followed by immunoprecipitation with specific monoclonal antibodies as described above.

Detection of GPIIb-mRNA or alpha v-mRNA in transfected cells. Total RNA from stably transfected CHO cells was extracted by the guanidinium thiocyanate method (5a). First-strand cDNA synthesis of the GPIIb subunit was carried out with Moloney murine leukemia virus reverse transcriptase according to described protocols (20), using the oligonucleotide GPIIb [antisense (1513-1489): CACAGCTTCTCACAGCAGGATTCAG]. cDNA was used as template for the amplification of a 427-bp fragment using the oligonucleotides GPIIb [sense (955-979): TATTTTGGGCATTCAGTCGCTGTCA] and GPIIb [antisense (1382-1359): TTGTCATCGATGTCTACGGCACCT]. To detect alpha v-mRNA, the first cDNA strand was synthesized using the oligonucleotide alpha v-antisense (1330-1310) 5'-TATCTGTGGCTCCTTTCATT-3'. A 487-bp fragment was amplified using as template this cDNA and the primers alpha v-sense [(846-866) 5'-GGTTTATATTTATGATGGGA-3'] and alpha v-antisense [(1330-1310) 5'-TATCTGTGGCTCCTTTCATT-3']. The PCR products were purified, and the primary sequence was determined in an automatic sequencer from Applied Biosystems, according to protocols recommended by the manufacturer. For both GPIIb and alpha v-subunits, PCR products were only detected from reverse transcribed RNA, ruling out that plasmidic DNA could have been used as template.

Materials. Restriction enzymes were obtained from Boehringer (Mannheim, Germany), and DNA sequencing reagents were from Pharmacia Biotech. The pCEP4 and pcDNA3 expression vectors were from Invitrogen (San Diego, CA). Most other reagents were purchased from Sigma Chemical (St. Louis, MO) or from Merck (Darmstadt, Germany). [35S]dATP (specific activity 1,000 Ci/mmol) was from Amersham Ibérica (Madrid, Spain). Monoclonal antibodies specific for GPIIIa (P37) and GPIIb (M3) were a gift from Dr. J. González. The monoclonal antibody MAB1976, specific for alpha v-GPIIIa, was purchased from Chemicon (Temecula, CA).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mutational analysis of residue 327 of human GPIIb. cDNAs encoding [Arg327]-, [His327]-, or [Ala327]GPIIb were cloned into the expression plasmid pCEP4 that contains the hygromycin resistance gene as a selection marker. These constructs were stably transfected into CHO cells. Hygromycin-resistant clones were harvested, and the presence of mRNA-GPIIb was determined by RT-PCR analysis.

Unlike cells transfected only with human GPIIIa-cDNA, in which surface expression of heterodimers of this glycoprotein and endogenous alpha -subunits (alpha v) of the vitronectin receptor is observed, we failed to detect surface expression of GPIIb in cells transfected only with the plasmid containing the human GPIIb-cDNA (Fig. 2A). Thus the functional capacity of the different forms of GPIIb-cDNA was studied by transfecting them into a CHO cell line stably expressing human GPIIIa on the cell surface, thereafter referred to as CHO-GPIIIa cells. When these cells were transfected with normal [Arg327]GPIIb cDNA, we observed surface expression of GPIIb (Fig. 2B) and an enhanced fluorescence of GPIIIa (results not shown), indicating that GPIIIa availability is not a limiting factor for the surface expression of GPIIb-IIIa complexes under our experimental conditions. Figure 2B shows the surface fluorescence analysis of cells stably transfected with cDNA encoding either normal or mutated, His327 or Ala327, forms of GPIIb. At least 30 clones from each experimental condition, selected from different transfection experiments, were analyzed. In agreement with a previous report (7), [His327]GPIIb failed to express at the surface of CHO cells. In contrast, when Arg327 was replaced by Ala327, we observed normal surface expression of GPIIb-IIIa complexes.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   Flow cytometric analysis of plasma membrane GPIIb in Chinese hamster ovary (CHO)-GPIIIa cells stably transfected with cDNAs encoding either normal or mutant forms of GPIIb. CHO cells stably expressing human GPIIIa were transfected with void pCEP4 plasmid (A), with cDNA encoding normal [Arg327]GPIIb, [His327]GPIIb, or [Ala327]GPIIb (B), with [Ala326]GPIIb or [Gly326]GPIIb (C), and with [Val328]GPIIb or [Ala328]GPIIb (D). Cells derived from hygromycin-resistant clones were harvested, and the surface expression of GPIIb-IIIa was analyzed by flow cytometry as described in MATERIALS AND METHODS. In A, expression of GPIIb-IIIa heterodimers was analyzed with antibodies specific for GPIIIa [monoclonal antibody (mAb) P37] or GPIIb (mAb M3). In B-D, expression levels of GPIIb-IIIa complexes analyzed with mAb M3 can be seen. At least 30 clones from different transfection experiments were analyzed for each experimental condition. Tracings are single representative experiments. For the sake of clarity, the original plots have been redrawn.

The use of the expression plasmid pCEP4, which contains both the hygromycin-resistant gene plus the GPIIb-cDNA, ensures the effectiveness of the transfection in the selected clones. Nevertheless, the presence of GPIIb-mRNA was further verified by RT-PCR analysis of total RNA from transfected cells. Reverse-transcribed GPIIb cDNA was used as template for the amplification of a 427-bp fragment as described in MATERIALS AND METHODS. The PCR products were electrophoresed in 3% agarose gels (Fig. 3), and the identity of the amplification product was further verified by restriction analysis using Nla III digestion to yield a 364-bp fragment (not shown). mRNA-GPIIb was detected in all of the clones analyzed regardless of whether or not GPIIb was expressed on the cell surface.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3.   Detection of GPIIb-mRNA in transfected CHO cells. Total RNA was obtained from CHO-GPIIIa stably transfected with normal or mutant forms of GPIIb. Synthesis of the first-strand cDNA was performed as described in MATERIALS AND METHODS. PCR amplifications were performed in 40 cycles of 0.5 min at 94°C, 1 min at 60°C, and 1.5 min at 72°C, with 2.5 mM MgCl2, and the products were resolved in 3% agarose. L: 1-kb DNA ladder; lane 1: amplification using as template cells transfected with void plasmid; lanes 2 and 6: PCR products from cells transfected with normal [Arg327]GPIIb; lanes 3-5: PCR products from cells transfected with mutant [Ala326]GPIIb, [Ala327]GPIIb, and [His327]GPIIb, respectively.

The importance of residue 327 of GPIIb was further investigated by transient transfection analysis of cDNA encoding Arg327-, Glu327-, Gln327-, or [Phe327]GPIIb into CHO-GPIIIa cells. Seventy-two hours after transfection, the intact cells were labeled with biotin, and the GPIIb-IIIa complexes were immunoprecipitated from the cell lysates with monoclonal antibodies directed against either GPIIb or GPIIIa. The results of these experiments are depicted in Fig. 4. As expected, cells transfected with a void pcDNA3 plasmid show immunoprecipitated GPIIIa and a slower moving band, presumably corresponding to endogenous alpha -subunits; in contrast, no immunoprecipitable material was detected when an antibody directed against GPIIb was used. Cells transfected with normal [Arg327]GPIIb showed immunoprecipitated GPIIb and GPIIIa bands with an antibody against either GPIIIa or GPIIb. Similar results were obtained in cells transfected with either [Gln327]- or [Phe327]GPIIb although the rate of expression does not seem to be as efficient as that of the normal GPIIb. In contrast, cells transfected with GPIIb carrying a charged amino acid as Glu at position 327 failed to express GPIIb-IIIa complexes at the cell surface.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 4.   Immunoprecipitation of biotin-labeled surface GPIIb-IIIa complexes from transiently transfected CHO-IIIa cells. CHO cells stably expressing human GPIIIa were transiently transfected with cDNAs encoding human normal [Arg327]GPIIb, [Glu327]GPIIb, [Gln327]GPIIb, or [Phe327]GPIIb. Intact cells were labeled with D-biotin N-hydroxysuccinimide ester (biotin-NHS), and the GPIIb-IIIa complexes were immunoprecipitated with specific monoclonal antibodies directed against GPIIIa and GPIIb. Immunoprecipitates were electrophoresed in 0.1% SDS-7.5% polyacrylamide slab under reducing conditions and electrotransferred to nitrocellulose membranes. After incubation with a 1:3,000 dilution of avidin-horseradish peroxidase, the biotin-labeled GPIIb and GPIIIa were visualized by incubation in PBS containing 0.015% H202 and 0.5 mg/ml of 4-chloro-1-naphtol.

To determine whether the lack of surface exposure of [His327]GPIIb or [Glu327]GPIIb was due to a lack of glycoprotein expression, we incubated with biotin total cell lysates from CHO-IIIa cells transfected with cDNA encoding either mutant protein before the immunoprecipitation of GPIIb-IIIa complexes (Fig. 5). The pattern of bands obtained from cells transfected with either a void plasmid or with normal GPIIb was similar to those previously shown in surface-labeled cells. Immunoprecipitation with anti-GPIIIa showed GPIIIa accompanied by endogenous alpha -subunits in cells expressing either [His327]GPIIb or [Glu327]GPIIb; however, immunoprecipitation with anti-GPIIb yielded exclusively a band migrating like proGPIIb and virtual absence of GPIIIa and GPIIb or a faint band migrating like GPIIIa in cells expressing [Glu327]GPIIb or [His327]GPIIb, respectively (Fig. 5). According to this observation, the lack of surface exposure of [His327]GPIIb or [Glu327]GPIIb is not the result of a lack of expression of these subunits under our experimental conditions.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 5.   Immunoprecipitation analysis of biotin-labeled total GPIIb-IIIa complexes from transiently transfected CHO-IIIa cells. CHO cells stably expressing human GPIIIa were transiently transfected with cDNAs encoding human normal [Arg327]GPIIb, [His327]GPIIb, or [Glu327]GPIIb. Total cell lysates were labeled with biotin-NHS and the GPIIb-IIIa complexes immunoprecipitated with specific monoclonal antibodies directed against either GPIIIa or GPIIb and processed as described in the legend to Fig. 4.

Expression of [Ala326]- or [Ala328]GPIIb in CHO cells. As indicated in Fig. 1, Gly326 and Val328 in GPIIb are conserved in the alpha -subunits of integrins; therefore, we found of interest to investigate the functional consequence of their substitution. CHO-GPIIIa cells were transfected with cDNA encoding Gly326, Ala326, Val328, or Ala328 forms of GPIIb. The cytofluorimetric analysis of more than 30 hygromycin-resistant clones shows a normal expression of [Ala328]GPIIb, whereas [Ala326] GPIIb was not detectable at the cell surface (Fig. 2, C and D).

Mutation analysis of the human alpha v-glycoprotein. Gln344 in the alpha -subunit (alpha v) of the human vitronectin receptor is homologous to Arg327 in GPIIb; therefore, we found of interest to investigate whether the replacement of Gln344 by His could perturb the surface expression of alpha v-GPIIIa. For this purpose, we transfected the plasmid pCEP4-[His344]alpha v into CHO-GPIIIa cells. Figure 6 shows that, in contrast to GPIIb, the presence of His344 in the alpha v-subunit does not prevent the surface expression of alpha v-GPIIIa complexes. Moreover, the average mean fluorescence channel in these cells was even higher than in cells transfected with the plasmid pCEP4-[Gln344]alpha v carrying the cDNA encoding the normal form of alpha v. The presence of the mutated [His344]alpha v-mRNA in the transfected cells was verified by PCR amplification of reversed-transcribed RNA and direct sequencing of the PCR products.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   Flow cytometric analysis of alpha v and GPIIIa in CHO cells transfected with cDNA encoding either human normal [Gln344]alpha v or [His344]alpha v. CHO cells stably expressing human GPIIIa (CHO-GPIIIa cells) were transfected with cDNAs encoding either human normal [Gln344]alpha v or [His344]alpha v as described in MATERIALS AND METHODS. Hygromycin-resistant clones were harvested, and the surface expression of alpha v and GPIIIa was analyzed by flow cytometry. Top: surface expression of endogenous alpha v and GPIIIa in CHO-GPIIIa cells. NC, negative control, cells exposed only to FITC-conjugated rabbit F(ab')2 anti-mouse IgG. Middle and bottom: surface expression of alpha v and GPIIIa in cells transfected with either the normal or the mutated form of alpha v, respectively. At least 25 clones from 2 different transfection experiments were analyzed for each experimental condition using the indicated monoclonal antibodies. Tracings are single representative experiments. For the sake of clarity, the original plots have been redrawn.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In agreement with previous results (7, 25), transfection of [His327]GPIIb-cDNA into CHO cells stably expressing GPIIIa (CHO-GPIIIa cells) showed subnormal amounts of GPIIb-IIIa at the cell surface (Fig. 2B). The possibility of defective transfections can be ruled out since similar amounts of GPIIb-mRNA have been amplified by PCR using as template cDNA reverse transcribed from total RNA obtained from cells stably transfected with either normal or mutant [His327]GPIIb (Fig. 3). Arg327right-arrowHis substitution is the fourth reported case of Glanzmann thrombasthenia with a single point mutation in GPIIb in which the entire open reading frame is conserved and therefore can be translated into a full-length protein. The present case shares with the previously reported Gly273right-arrowAsp (19), Gly418right-arrowAsp (26), and Glu324right-arrowLys (4) homozygous mutations that maturation and/or transport of the GPIIb-IIIa complex is impeded. However, unlike these three missense mutations that were associated with type I, [His327]GPIIb is responsible for type II Glanzmann thrombasthenia (7). Most probably, the pathogenic mechanism underlying these cases is that the substituted residue prevents the proper protein conformation required for intracellular maturation and/or trafficking of the GPIIb-IIIa complex. His327 lies between the second and the third calcium binding domains and is only 13 residues away from the binding domain of the gamma -chain dodecapeptide of fibrinogen. Thus this might provide an explanation for the remarkably low fibrinogen content (<= 1%) found in thrombasthenic individuals homozygous for this mutation (7). The presence of residue 327 between the second and third calcium binding sites poses the question as to whether the pathogenic mechanism of [His327]GPIIb is related to changes in the calcium binding capacity and therefore in the ability to maintain subunit association (5, 6, 9, 15, 22). Moreover, calcium occupancy of GPIIb appears to be essential for an effective fibrinogen binding (12). We have recently shown by immunoprecipitation analysis of recombinant [His327]GPIIb-GPIIIa complexes expressed in CHO cells that this mutation does not impede subunit association (7). Thus even though calcium binding properties of [His327]GPIIb were perturbed, subunit dimerization does not seem to be impeded.

The data reported herein demonstrate that Arg327 in GPIIb is not essential for surface expression of recombinant GPIIb-IIIa complexes in CHO cells since its substitution for other amino acids did not prevent the surface expression of heterodimers (Figs. 2 and 4). Replacement of Arg327 by hydrophobic residues like Ala or Phe permitted the surface exposure of GPIIb-IIIa. Unlike His, the presence of other polar residues like Gln at position 327 also resulted in surface expression of GPIIb-IIIa. The latter observation is consistent with the presence of Gln instead of Arg at a similar position in the alpha -subunits of other integrins (Fig. 1). In contrast, GPIIb containing a negatively charged amino acid like Glu at that position failed to expose at the cell surface. Immunoprecipitation analysis of GPIIb-IIIa complexes from total cell lysates of CHO-IIIa cells transfected with either [His327]GPIIb or [Glu327]GPIIb demonstrated accumulation of proGPIIb (Fig. 5), ruling out that the lack of surface exposure was due to a lack of GPIIb expression. Moreover, the endoproteolytic cleavage of intracellular proGPIIb to form the heavy and light chains of GPIIb requires its association to GPIIIa (2); thus, the accumulation of proGPIIb suggests a failure of [His327]GPIIb and [Glu327]GPIIb to form stable heterodimers with GPIIIa.

These observations indicate that it is not the absence of Arg327 but the presence of His that causes a deficient rate of expression of GPIIb-IIIa complexes in the thrombasthenic phenotypes. On these grounds, it seems plausible to conclude that the presence of Arg is not essential at that position. However, the constraints imposed by the presence of either the imidazolic group of His or a negatively charged residue seem to be incompatible with a functional adequate conformation of GPIIb. Similarly, the lack of exposure of GPIIb-IIIa by replacing Ala for Gly326 (Fig. 2C) suggests that the great flexibility conferred by this small residue is essential to warrant a normal functional conformation of GPIIb. In contrast, Ala substitution for the highly conserved Val328 did not alter the surface expression of GPIIb-IIIa complexes (Fig. 2D). Because the available structural information of the GPIIb-IIIa heterodimer is very limited, these data provide further insights toward the understanding of the structural-functional relationship of this glycoprotein and the factors controlling the surface exposure of GPIIb-IIIa.

The 326GRV sequence in GPIIb is conserved among the integrin alpha -subunits, suggesting it might play an important function. In the alpha -subunit of the vitronectin receptor, alpha v-GPIIIa integrin, Gln344 is found instead of Arg at a similar position (Fig. 1). Nevertheless, substitution of Arg327 for Gln in GPIIb did not alter the surface exposure of GPIIb-IIIa (Fig. 3), indicating that 326GRV or 326GQV performs a similar function in this subunit. We have recently demonstrated that [His327]GPIIb prevents the surface expression of normal GPIIb-IIIa heterodimers in transfected CHO cells but not the expression of the GPIIIa associated with endogenous alpha v-subunits (7). This observation suggested that the mutated GPIIb did not compete with alpha v to form heterodimers with GPIIIa and therefore the G(R,Q)V sequence does not play the same role in subunit interaction in heterodimers alpha v-GPIIIa and GPIIb-IIIa. To further investigate this point, we transfected cDNA encoding either normal [Gln344]alpha v or mutated [His344]alpha v into CHO-GPIIIa cells. In both conditions, the surface fluorescence of alpha v-GPIIIa complexes was significantly increased above the basal control cells expressing human GPIIIa associated with endogenous alpha v-subunits, indicating that availability of GPIIIa was not a rate-limiting step for the surface expression of alpha v-GPIIIa complexes under our experimental conditions. The presence of either normal or mutated human alpha v-mRNA in transfected cells was verified by RT-PCR analysis and sequencing of the amplification products, precluding a possible experimental artifact. Thus the surface expression of [His344]alpha v-GPIIIa demonstrates that, unlike [His327]GPIIb, the conformation of [His344]alpha v is compatible with its normal association with GPIIIa and further processing. This might explain the lack of effect of [His327]GPIIb in perturbing the surface expression of endogenous alpha v-subunits.

To summarize, it is not the absence of Arg327 but the presence of His327 in GPIIb that is responsible for a deficient platelet membrane exposure of GPIIb-IIIa complexes that leads to thrombasthenic phenotype. The substitution of a hydrophobic or a polar amino acid other than His for Arg327 in GPIIb permitted surface exposure of GPIIb-IIIa but a negatively charged amino acid did not, indicating that electrostatic forces at that point may be of importance to determine a functional conformation.

    ACKNOWLEDGEMENTS

The monoclonal antibodies used in this study were a gift from Drs. María Victoria Alvarez and José González. CHO cells stably expressing human GPIIIa (CHO-GPIIIa cells) were kindly provided by Dr. N. Kieffer.

    FOOTNOTES

This work has been supported in part by grants from the Fondo de Investigaciones Sanitarias (96/2014), Comunidad Autónoma de Madrid (CO7191), European Community concerted action contract no. BMH1-CT93-1685, and Dirección General de Investigación Científica y Técnica (PB94-1544). M. Ferrer was the recipient of a predoctoral fellowship from the Comunidad Autónoma de Madrid.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: R. Parrilla, Centro de Investigaciones Biológicas (CSIC), Velázquez 144, 28006-Madrid, Spain (E-mail: rparrilla{at}fresno.csic.es).

Received 9 April 1998; accepted in final form 23 June 1998.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. Basic local alignment search tool. J. Mol. Biol. 215: 403-410, 1990[Medline].

2.   Bennett, J. S., M. A. Koldziej, G. Vilaire, and M. Poncz. Determinants of the intracellular fate of truncated forms of the platelet glycoproteins IIb and IIIa. J. Biol. Chem. 268: 3580-3585, 1993[Abstract/Free Full Text].

3.   Bennett, J. S., and G. Vilaire. Exposure of platelet fibrinogen receptors by ADP and epinephrine. J. Clin. Invest. 64: 1393-1401, 1979.

4.   Bourre, E., O. Peyruchaud, P. Bray, R. Combrié, P. Nurden, and A. T. Nurden. A point mutation in the gene for platelet GPIIb leads to a substitution in a highly conserved amino acid located between the second and the third Ca2+-binding domain (Abstract). Blood 86: 452a, 1995.

5.   Brass, L. F., S. J. Shattil, T. J. Kunicki, and J. S. Bennett. Effect of calcium on the stability of the platelet membrane glycoprotein IIb-IIIa complex. J. Biol. Chem. 260: 7875-7881, 1985[Abstract/Free Full Text].

5a.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

6.   D'Souza, S. E., M. H. Ginsberg, T. A. Burke, and E. F. Plow. The ligand binding site of the platelet integrin receptor GPIIb-IIIa is proximal to the second calcium binding domain of its alpha subunit. J. Biol. Chem. 265: 3440-3446, 1990[Abstract/Free Full Text].

7.   Ferrer, M., M. Fernández, C. González-Manchón, J. González, M. S. Ayuso, and R. Parrilla. A mutant (Arg327right-arrowHis) GPIIb associated with thrombasthenia exerts a dominant negative effect in stably transfected CHO cells. Thromb. Haemost. 76: 292-301, 1996[Medline].

8.   Ferrer, M., M. Fernández, C. González-Manchón, G. Iruin, M. S. Ayuso, and R. Parrilla. Identification of a Gright-arrowA transition that substitutes GPIIb Arg358 by His358 in a case of thrombasthenia of Glanzmann. In: Advances in Gene Technology: Molecular Biology and Human Disease, edited by W. J. Whelan, F. Ahmad, L. Baumbach, H. Bialy, S. Black, K. Davies, J. Hodgson, R. R. Howell, F. Huijing, and W. A. Scott. Oxford, UK: IRL, 1994, p. 12.

9.   Fujimura, K., and D. R. Phillips. Calcium cation regulation of glycoprotein IIb-IIIa complex formation in platelet plasma membranes. J. Biol. Chem. 258: 10247-10252, 1983[Abstract/Free Full Text].

10.   George, J. N., J. P. Caen, and A. T. Nurden. Glanzmann's thrombasthenia: the spectrum of clinical disease. Blood 75: 1383-1395, 1990[Free Full Text].

11.   Glanzmann, E. Hereditare hemorrhagische thrombasthenie: ein beitrag zur pathologie der blut plattchen. J. Kinderkr. 88: 113-141, 1918.

12.   Gulino, D., C. Boudignon, L. Y. Zhang, E. Concord, M.-J. Rabiet, and G. Marguerie. Ca2+-binding properties of the platelet glycoprotein IIb-ligand interacting domain. J. Biol. Chem. 267: 1001-1007, 1992[Abstract/Free Full Text].

13.   Hardisty, R. M., K. M. Dormandy, and R. A. Hutton. Thrombasthenia: studies on three cases. Br. J. Haematol. 10: 371-387, 1964[Medline].

14.   Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61-68, 1989[Medline].

15.   Kunicki, T. J., D. Pidard, J.-P. Rosa, and T. A. Nurden. The formation of Ca2+-dependent complexes of platelet membrane glycoproteins IIb and IIIa in solution as determined by crossed immunoelectrophoresis. Blood 58: 268-278, 1981[Abstract/Free Full Text].

16.   Marchuk, D., M. Drumm, A. Saulino, and F. S. Collins. Construction of T-vectors: a rapid and general system for direct cloning of unmodified PCR products (Abstract). Nucleic Acids Res. 19: 1154, 1991[Free Full Text].

17.   Marck, C. A "C" program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers. Nucleic Acids Res. 16: 1829-1836, 1988[Abstract/Free Full Text].

18.   Méndez, J. A., M. V. Alvarez, J. A. Aznarez, and J. González-Rodríguez. Two fold simmetry of human fibrinogen proved at the beta -chain distal domain by monoclonal immunoelectronmicroscopy image analysis. Biochemistry 35: 634-637, 1996[Medline].

19.   Poncz, M., S. Rifat, B. S. Coller, P. J. Newman, S. J. Shattil, T. Parrella, P. Fortina, and J. S. Bennett. Glanzmann thrombasthenia secondary to a Gly273right-arrowAsp mutation adjacent to the first calcium-binding domain of platelet glycoprotein IIb. J. Clin. Invest. 93: 172-179, 1994.

20.   Sambrook, J., E. F. Fritsch, and T. Maniatis. Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.

21.   Sanger, F., S. Nicklen, and A. R. Coulson. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467, 1977[Abstract/Free Full Text].

22.   Shattil, S. J., L. F. Brass, J. S. Bennett, and P. Pandhi. Biochemical and functional consequences of dissociation of the platelet membrane glycoprotein IIb-IIIa complex. Blood 66: 92-98, 1985[Abstract/Free Full Text].

23.   Takebe, Y., M. Seiki, J.-I. Fujisawa, P. Hoy, K. Yokota, K.-I. Arai, M. Yoshida, and N. Arai. SRalpha promoter: an efficient and versatile mammalian expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell. Biol. 8: 466-472, 1988[Abstract/Free Full Text].

24.   Wilcox, D. A., J. Gill, and P. J. Newman. Glanzmann thrombasthenia resulting from a single amino acid substitution flanking the fibrinogen gamma -chain dodecapepetide binding domain on GPIIb (Abstract). Blood 82: 210a, 1993.

25.   Wilcox, D. A., C. M. Paddock, S. Lyman, J. C. Gill, and P. J. Newman. Glanzmann thrombasthenia resulting from a single amino acid substitution between the second and third calcium-binding domains of GPIIb. Role of the GPIIb amino terminus in integrin subunit association. J. Clin. Invest. 95: 1553-1560, 1995.

26.   Wilcox, D. A., J. L. Wautier, D. Pidard, and P. J. Newman. A single amino acid substitution flanking the fourth calcium binding domain of alpha-IIb prevents maturation of the alpha IIbbeta 3 integrin complex. J. Biol. Chem. 269: 4450-4457, 1994[Abstract/Free Full Text].

27.   Zucker, M. B., J. H. Pert, and M. W. Hilgartner. Platelet function in a patient with thrombasthenia. Blood 28: 524-534, 1966[Abstract/Free Full Text].


Am J Physiol Cell Physiol 275(5):C1239-C1246
0002-9513/98 $5.00 Copyright © 1998 the American Physiological Society




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferrer, M.
Right arrow Articles by González-Manchón, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferrer, M.
Right arrow Articles by González-Manchón, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online