|
|
||||||||
Departments of 1 Geriatrics and 2 Anatomy, University of Arkansas for Medical Sciences, and Geriatric Research, Education, and Clinical Center, McClellan Department of Veterans Affairs Hospital, Little Rock, Arkansas 72205
| |
ABSTRACT |
|---|
|
|
|---|
Muscles of spinal cord-transected rats exhibit severe atrophy and a shift toward a faster phenotype. Exercise can partially prevent these changes. The goal of this study was to investigate early events involved in regulating the muscle response to spinal transection and passive hindlimb exercise. Adult female Sprague-Dawley rats were anesthetized, and a complete spinal cord transection lesion (T10) was created in all rats except controls. Rats were killed 5 or 10 days after transection or they were exercised daily on motor-driven bicycles starting at 5 days after transection and were killed 0.5, 1, or 5 days after the first bout of exercise. Structural and biochemical features of soleus and extensor digitorum longus (EDL) muscles were studied. Atrophy was decreased in all fiber types of soleus and in type 2a and type 2x fibers of EDL after 5 days of exercise. However, exercise did not appear to affect fiber type that was altered within 5 days of spinal cord transection: fibers expressing myosin heavy chain 2x increased in soleus and EDL, and extensive coexpression of myosin heavy chain in soleus was apparent. Activation of satellite cells was observed in both muscles of transected rats regardless of exercise status, evidenced by increased accumulation of MyoD and myogenin. Increased expression was transient, except for MyoD, which remained elevated in soleus. MyoD and myogenin were detected both in myofiber and in satellite cell nuclei in both muscles, but in soleus, MyoD was preferentially expressed in satellite cell nuclei, and in EDL, MyoD was more readily detectable in myofiber nuclei, suggesting that MyoD and myogenin have different functions in different muscles. Exercise did not affect the level or localization of MyoD and myogenin expression. Similarly, Id-1 expression was transiently increased in soleus and EDL upon spinal cord transection, and no effect of exercise was observed. These results indicate that passive exercise can ameliorate muscle atrophy after spinal cord transection and that satellite cell activation may play a role in muscle plasticity in response to spinal cord transection and exercise. Finally, the mechanisms underlying maintenance of muscle mass are likely distinct from those controlling myosin heavy chain expression.
satellite cells; MyoD; myogenin; Id-1; myosin heavy chain isoforms; dystrophin
| |
INTRODUCTION |
|---|
|
|
|---|
ADULT SKELETAL MUSCLE is a dynamic tissue capable of changing phenotype depending on functional demands placed on it. External factors such as use and disuse, motor neuron activity, oxygen and nutrient supply, mechanical stimulation, and changes in hormonal levels can alter muscle fiber physiological, biochemical, and functional characteristics. After spinal cord injury, significant changes occur in muscles distal to the site of injury. Severe atrophy concurrent with a decrease in fiber cross-sectional area and elevated fatigability due to an increase in fibers expressing myosin heavy chain (MHC) 2b is observed in human patients as well as in experimental animals (26, 32). Our previous work showed that pedaling exercise on a motor-driven bicycle for 60-90 days can partially prevent the atrophy and fiber-type conversion in spinal cord-transected rats (30). Also, in a recent study, it was shown that stepping exercise can revert MHC expression to control values in soleus muscle of spinalized cats (34).
A number of studies suggest that satellite cells may be involved in the hypertrophic response of skeletal muscle to external stimuli (1, 31, 37). Satellite cells are the myogenic stem cells of mammalian skeletal muscle; they are located under the basal lamina, but outside the sarcolemma, and they are implicated in the repair of injured skeletal muscle (for reviews, see Refs. 3, 14). The activation of satellite cells has been shown to occur after overload in muscles, endurance training, eccentric exercise, and even after a single bout of treadmill running (1, 4, 8, 20). The activation of satellite cells after exercise and in overload models occurs fairly rapidly and can be observed as early as 24 h after the stimulus (13). Accordingly, conditions leading to atrophy such as hindlimb suspension in growing animals are associated with a decrease in satellite cell number and proliferative capacity (9). Satellite cells are thought to be activated upon injury to muscles, and many exercise models indeed cause damage to the muscle fibers. It has even been suggested that damage is necessary for satellite cell activation during exercise effects (23, 37). However, other studies have shown that some damage occurs after a single bout of exercise, but subsequent activation of satellite cells is greater than necessary to repair damage (8), suggesting that the extent of satellite cell activation and muscle damage do not necessarily correlate (20). Therefore, other mechanisms in addition to damage may be responsible for the activation of satellite cells.
Muscle regulatory factors are likely to play a role in the response of muscle to external stimuli, contributing to changes in gene expression characteristic of muscle plasticity. The four myogenic regulatory factors (MRF) MyoD, myogenin, MRF-4, and myf-5 are involved in inducing muscle-specific gene expression during embryogenesis (for review, see Ref. 28). Their role in developing muscle has been studied extensively, but it is less clear the role MRF play in adult skeletal muscle. MRF are induced in adult skeletal muscle upon denervation (11), stretch and electrical stimulation (21), and after injury (12) in both satellite cells and myofiber nuclei. In fact, MyoD and myogenin expression have been used as a marker of satellite cell activation in models where muscle damage is prevalent (13, 24). However, MyoD and myogenin expression in satellite cells upon loss of electrical activity without signs of degeneration, as is the case with spinal cord transection, has not been reported. In normal adult skeletal muscle, mRNA of all four MRF accumulate to low levels; however, whereas myf-5 and MRF-4 are expressed to the same level in muscles of different fiber types, MyoD and myogenin show differential expression between muscles with varying fiber type composition (18, 19, 41). MyoD is mainly expressed in muscles containing type 2 MHC, and myogenin is expressed to a greater extent in muscles primarily expressing type 1 MHC. Interestingly, expression of Id-1 (inhibitor of DNA binding), an ubiquitous helix-loop-helix protein which antagonizes the actions of MRF, is increased under disuse conditions that lead to muscular atrophy (15).
The goal of the present study was to determine if MyoD, myogenin, and Id-1 are potential regulators of changes in muscle gene expression that occur in response to spinal cord transection and during exercise after transection in the rat. MyoD and myogenin were studied because of their differential expression between muscles with different fiber type compositions and their inducibility with changes in functional demand. Furthermore, with the use of MyoD and myogenin as markers, the role of satellite cells in muscle plasticity was examined to attempt to understand the mechanisms whereby passive cycling exercise affected muscle fiber phenotype. We have chosen to look at time points shortly after the transection and after the onset of exercise, because we suspect that important changes occur rapidly and may be missed at later time points. To compare and contrast muscles with different fiber type composition, different function and from different locations, slow soleus and fast extensor digitorum longus (EDL) muscles were investigated.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals and Experimental Protocol
All procedures were performed in accordance with institutional guidelines for the use and care of animals. Adult female Sprague-Dawley rats (180-220 g) were randomly divided into six groups (n = 5-7); control rats did not undergo surgery and were not exercised. Rats in the remaining five groups underwent a complete transection of the thoracic (T10) spinal cord by creation of an aspiration lesion 1-2 mm in length while under anesthesia with ketamine (60 mg/kg) and xylazine (10 mg/kg). Manual expression of the urinary bladder was carried out three times daily, and rats received penicillin G procaine every 3 days. Rats in two groups did not exercise and were killed 5 days (tx5) or 10 days (tx10) after transection. Rats in the remaining three groups were subjected to pedaling exercise on a motor-driven bicycle for two times 30 min each day with a 10-min interval, beginning 5 days after spinal cord transection. Rats in group tx5e0.5, tx6e1, and tx10e5 were killed 0.5, 1, and 5 days after the first bout of exercise, respectively, such that tx5e0.5 and tx6e1 are comparable to tx5 and tx10e5 to tx10 with regard to time elapsed after transection. Animals were killed with an overdose of pentobarbital sodium. Blood for serum creatine kinase (CK) determination was collected by heart puncture. Soleus and EDL muscles were carefully dissected and snap frozen at resting length in liquid nitrogen and stored at
70°C. The soleus is a slow muscle composed of 85%
fibers expressing type 1 MHC and 15% type 2a, is situated in the
posterior compartment of the hindlimb, and functions as a postural
muscle. The EDL is a muscle that is composed of 52% of fibers
expressing MHC type 2b, 28% type 2a, and 28% type 2x with a small
percentage expressing MHC type 1. It is situated in the anterior
compartment, and it functions as an extensor of the toes during
walking. Soleus and EDL muscles from one hindlimb were used for RNA
quantitation, and muscles from the other hindlimb were used for
immunohistochemistry.
RNA Quantitation
Total RNA was isolated from muscles using the guanidium thiocyanate-phenol-chloroform extraction method as described by Chomczynski and Sacchi (6). Briefly, muscles were homogenized in 4 M guanidium thiocyanate, 25 mM sodium citrate, 0.5% sarcosyl, and 0.1 M 2-mercaptoethanol, pH 7.0, with three drops of antifoam A (Sigma, St. Louis, MO). Sodium acetate (2 M NaAc, pH 4.0), phenol, and chloroform were added, and samples were mixed after each addition. Samples were centrifuged at 10,000 g to separate the phases. RNA was precipitated out of the aqueous phase overnight at
20°C with isopropanol. After centrifugation,
the pellet was suspended in water and further precipitated in 0.3 M
NaAc (pH 5.2) and ethanol overnight at
20°C. After
centrifugation, the pellet was resuspended in water, and RNA was
quantitated spectrophometrically. Ten micrograms total RNA were
electrophoresed through 1% agarose/2.0% formaldehyde HEPES/EDTA-buffered gels and separated for 2-3 h at 70 V. RNA was
then transferred in 10× SSC (1.5 M NaCl, 0.15 M sodium citrate, pH 7.0) to a nylon membrane (Zeta-Probe, Bio-Rad, Richmond, CA) using a
blotting unit (BIOS, New Haven, CT) and ultraviolet cross-linked using
a Stratalinker (Stratagene, La Jolla, CA).
Membranes were sequentially hybridized with the following probes: MyoD,
myogenin, Id-1, MHC type 1, MHC type 2a, MHC type 2x, MHC type 2b, and
actin. The actin probe used recognizes all actin transcripts. All
probes, except Id-1 and MHC type 1, have been described previously
(19). The Id-1 probe was a 1.0-kb EcoR
I/BamH I fragment from pMH18
R (2).
The MHC type 1 probe was an antisense oligonucleotide complementary to
the 3'-untranslated region of rat MHC 1 mRNA with the
following sequence:
GCTCCAGGTCTCAGGGCTTCACAGGCATCCTTAGGGTTGGGTAGAGCAAG. Stripping of the filters between hybridizations was performed by
washing filters two times for 20 min in 0.1× SSC/0.5% SDS at 95°C. Labeling of the probes was performed using the random prime method (Decaprime II kit, Ambion, Austin, TX) for MyoD, myogenin, Id-1,
and actin, and using terminal deoxynucleotide transferase labeling
(TdT, GIBCO) for MHC type 1, MHC type 2a, MHC type 2x, and MHC type 2b.
For random prime labeled probes, membranes were prehybridized for 5 min
at 65°C and hybridized overnight at 42°C using the following
hybridization mixture: 50% formamide, 250 mM
NaH2PO4
(pH 7.4), 1 mM EDTA, 250 mM NaCl, 100 µg/ml salmon sperm DNA, and 7%
SDS. Membranes were washed two times for 10 min in 0.1× SSC and
0.1% SDS at room temperature and two times for 30 min in 0.1×
SSC and 1% SDS at 65°C. TdT-labeled probes were prehybridized for
1 h at 42°C and hybridized overnight at 42°C in 6× SSPE
(NaCl, NaPO4, and EDTA, pH 7.4),
5× Denhardt's solution, 0.1% SDS, and 50 µg/ml salmon sperm
DNA. Membranes were washed two times for 20 min in 6× SSC at room
temperature and two times for 20 min in 6× SSC at 42°C.
Membranes were then exposed to a phosphorscreen for quantitation on a
PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Density of bands
was normalized to density of the bands probed with actin, which did not
change with transection or exercise compared with 18S RNA and
glyceraldehyde-3-phosphate dehydrogenase (data not shown).
Immunocytochemistry
Consecutive soleus and EDL muscle sections were cut on a cryostat (8 µm) and stored at
20°C. Sections were rehydrated and incubated with antibodies against different MHC isoforms. Table 1 describes the specificity of the
different MHC antibodies for determination of fiber type. A4.951 was
generously supplied by H. Blau (Stanford University, San Francisco, CA;
Ref. 17), and SC.71, BF.F3, and BF.35 were provided by S. Schiaffino
(University of Padova, Padua, Italy; Ref. 35). 212F was donated by P. Merrifield (University of Western Ontario, London, Ontario, Canada;
Ref. 29). Sections were washed and incubated with either alkaline phosphatase-conjugated anti-mouse secondary antibody (IgG, Zymed, San
Francisco, CA) for A4.951, BF.35, SC.71, and 212F or with biotin-conjugated anti-mouse secondary antibody (IgM, Zymed) and further with streptavidin-alkaline phosphatase (Zymed) for BF.F3. Alkaline phophatase substrate (Vector, Burlingame, CA) was added for
color development. EDL sections stained with A4.951 were counterstained with Contrast Blue (KPL, Gaithersburg, MD) to visualize the fibers. Sections were dehydrated and coverslipped. Fibers positive for A4.951
(MHC type 1), SC.71 (MHC type 2a), and BF.F3 (MHC type 2b) were
identified as expressing their corresponding MHC isoforms. Type 2x
fibers were identified as fibers positive for 212F (MHC type 2b and
2x), but not for BF.F3 (MHC type 2b). Fibers coexpressing different MHC
isoforms could be identified as being positive for more than one
antibody, except for fibers coexpressing 2b and 2x, which could not be
positively identified because of a lack of a specific antibody for MHC
type 2x only.
|
Analysis of the muscle sections was performed as follows. Muscles were viewed and visualized on a computer screen using a Zeiss Axioskop microscope, a Power Macintosh (7200/120), a videocamera, and NIH Image software (version 1.60). For the soleus, 200 muscle fibers were analyzed from the midregion of the muscle by measuring their individual cross-sectional area. For the EDL, 100 muscle fibers from the superficial and 100 fibers from the deep region were measured, because of muscle fiber diversity in the different regions in this muscle. In consecutive sections stained with the individual antibodies, the same region was analyzed, such that the same fibers could be identified and labeled on the sections. Fibers were counted as positive whenever a definite red color was detected (from the alkaline phosphatase reaction). Coexpression of MHC isoforms was found, and thus the percentage of MHC reported does not represent percentage fiber type but percentage of fibers expressing a certain MHC. Consecutive muscle sections were stained with hematoxylin and eosin.
Double staining of sections with dystrophin and MyoD or myogenin was performed as follows. Sections were cut at 8 µm and reacted with 0.25% hydrogen peroxide to block endogenous peroxidase activity. Dystrophin antibody (mouse anti-human dystrophin, NCL-DYS2, Vector) was applied diluted 1:4 in PBS. An alkaline phosphatase-conjugated IgG secondary antibody (Zymed) was applied followed by incubation with alkaline phosphatase substrate for color development. Sections were then fixed in 2% paraformaldehyde in PBS and permeabilized using 1% Igepal CA-630 (Sigma) to allow access of antibodies to the nucleus. All subsequent washes and incubations were performed with 0.1% Igepal. MyoD and myogenin antibodies at a concentration of 2-5 ng/µl were applied to the sections and incubated for 1 h. MyoD antibody (5.8A) was donated by P. Houghton (St. Jude Hospital, Memphis, TN; Ref. 10), and myogenin (F5d) was supplied by W. Wright (UT Southwestern, Dallas, TX; Ref. 7). An IgG1 biotin-conjugated secondary antibody (Zymed) was applied at a dilution of 1:100. After incubation, streptavidin-horseradish peroxidase (Zymed) was added, and peroxidase substrate (Vector) was applied for color development. Sections were dehydrated and coverslipped and examined with a light microscope (Olympus, BH-2).
Serum CK Activity Determination
Serum CK activity was determined using a kit from Sigma Diagnostics (procedure no. 520). CK activity is expressed as micromoles per minute per liter.Statistics
To test for statistically significant differences, ANOVA was used; in case of significant differences, the Tukey multiple comparisons test was applied. Statistical significance was assumed at P < 0.05.| |
RESULTS |
|---|
|
|
|---|
Fiber Cross-Sectional Area
Transection. Figure 1 shows that spinal cord transection caused a rapid and progressive decrease in total muscle fiber cross-sectional area of all fiber types combined in both soleus and EDL muscles. There was a significant decline in total fiber area 5 days after transection and a further significant decrease 10 days after transection, so that soleus total cross-sectional area was 40% and EDL was 53% of the control area. Table 2 summarizes the effect of transection on cross-sectional area of the different fiber types. In the soleus, fibers expressing type 1 or type 2a MHC decreased significantly in size within 5 days of transection. Both type 1 and type 2a fibers continued to atrophy, but only type 1 fibers showed a further significant decrease after 10 days. There also was an appearance of fibers expressing type 2x MHC with spinal transection in soleus muscles. In EDL muscles, the decrease in cross-sectional area in fibers expressing types 2a, 2x, and 2b MHC only reached significance at 10 days after transection, and the rare fibers expressing type 1 MHC in EDL failed to decrease in size. Thus the soleus atrophied more rapidly and to a greater extent than the EDL.
|
|
Exercise. Figure 2A shows that 5 days of exercise (tx10e5) in soleus muscles was associated with a significant increase in total cross-sectional area to nearly control values. Exercise had no significant effect on total cross-sectional area of EDL muscle fibers. Also, muscles analyzed 0.5 or 1 day after the first bout of exercise did not show a change in total muscle fiber cross-sectional area in either soleus or EDL compared with transected alone (Fig. 2B). Exercise appeared to exert a differential effect on fibers expressing different MHC (Table 2). Whereas in the soleus muscle exercise decreased atrophy of fibers expressing all three MHC, in the EDL, only fibers expressing type 2a and type 2x were significantly influenced by exercise. The fact that fibers expressing type 2b MHC were not affected by exercise may account for the fact that no overall significant change in cross-sectional area was observed in the EDL, since type 2B fibers account for >50% of the fibers in the normal EDL.
|
Expression of MHC Isoforms
Transection. The most significant observation with regard to expression of MHC protein is that soleus and EDL muscles of transected rats showed an increase in the number of fibers expressing type 2x MHC between 5 and 10 days after transection (Table 3). Appearance of fibers expressing type 2x MHC coincided with coexpression of MHC isoforms in fibers in soleus (Table 3). In EDL muscles, there was also an increase in fibers expressing type 2x MHC, but the increase in coexpression did not reach significance. However, because no type 2x MHC-specific antibody is currently available, the coexpression in EDL muscles is likely underestimated. Thus most fibers expressing type 2x MHC also were expressing type 2a or type 2b MHC. The increase in fibers expressing type 2x MHC with transection was correlated with changes seen at the RNA level analyzed by Northern blot (Fig. 3, Table 4). In the soleus (Fig. 3A, Table 4), there was a significant increase in type 2x MHC mRNA even 5 days after transection and a further increase after 10 days. Noteworthy is the fact that mRNA encoding type 2a and type 2b MHC also were elevated in soleus 10 days after transection, although this could not be detected at the protein level (Table 4). In EDL muscles, only type 2x MHC message was elevated 10 days after transection, and no other changes were observed at the mRNA level (Fig. 3B, Table 4).
|
|
|
Exercise. Exercise did not significantly change the expression of MHC at either the protein or the mRNA level when compared with transection alone (Tables 3 and 4).
mRNA Expression of Transcription Factors
Transection. The mRNA levels of MyoD, myogenin, and Id-1 were analyzed by Northern blot. Representative lanes are shown in Fig. 3, and data are summarized in Table 5. MyoD, myogenin, and Id-1 were all elevated compared with control at 5 days after transection in both soleus (Fig. 3A) and EDL (Fig. 3B) muscles (summarized in Table 5). MyoD, which was barely detectable in control soleus, was increased 10-fold in the soleus and 5-fold in the EDL. Myogenin increased ~7.5-fold in the soleus but showed a >50-fold increase in EDL, where it is normally expressed at low levels. Id-1 showed a threefold increase in both soleus and EDL. At 10 days after transection, the only transcription factor whose mRNA was still elevated was MyoD in soleus muscles. Myogenin and Id-1 in soleus and EDL and MyoD in EDL were all decreased to levels not significantly different from controls.
|
Exercise. There was no effect of exercise on the expression of MyoD, myogenin, and Id-1 mRNA. Exercise did not change the levels of mRNA of any of the measured transcription factors at either 0.5 and 1 day or at 5 days after the first bout of exercise when compared with transection alone (Table 5).
Protein Expression of MyoD and Myogenin and Satellite Cell Activation
Muscle sections were analyzed immunocytochemically with antibodies to MyoD and myogenin. In Fig. 4, representative sections of soleus (A-C) and EDL (D-F) muscles immunoreacted with myogenin antibody are shown. In control muscles (Fig. 4, A and D), myogenin and MyoD (data not shown) accumulated to low levels. Both myogenin (Fig. 4, B and E) and MyoD (data not shown) positive nuclei increased within 5 days after transection. MyoD (data not shown) and myogenin (Fig. 4, C and F) levels remained elevated at 10 days after transection in contrast to results obtained at the RNA level. Representative positive nuclei are indicated with arrows in Fig. 4, B, C, E, and F. Exercise did not appear to change the expression of MyoD and myogenin significantly (data not shown).
|
Grounds et al. (13) have suggested that MyoD and myogenin are useful markers of activated satellite cells. They found that mRNA encoding these two transcription factors accumulated in mononuclear cells as soon as 6 h after injury. To determine if MyoD and myogenin were expressed in satellite cells after transection and subsequent exercise, suggesting satellite cell activation, we utilized a double staining technique (24). Satellite cells are anatomically very closely associated with the muscle fibers, and thus satellite cell nuclei are hard to distinguish from myonuclei. An antibody against dystrophin, a protein component of the sarcolemma, allowed us to distinguish MyoD or myogenin positive nuclei outside the sarcolemma in satellite cells from MyoD or myogenin positive myofiber nuclei residing within the sarcolemma. As shown in Fig. 5, transected soleus muscles (B and C) reacted with myogenin antibody more strongly than control soleus (A). Myogenin was detected equally well in both myonuclei (Fig. 5, B and C, solid arrows) and satellite cell nuclei (open arrows) of soleus muscle after transection. The same observation was made for myogenin staining in EDL muscles of transected animals (data not shown). Exercise did not change this staining pattern for myogenin in either muscle. MyoD staining showed a different pattern of accumulation. In EDL, MyoD was observed predominantly in myonuclei (Fig. 5E, solid arrow), but in soleus muscles, MyoD was detected in satellite cell nuclei more often than in myonuclei after transection (Fig. 5D, open arrow). As with myogenin, no changes in accumulation of MyoD could be observed with exercise (data not shown). These observations suggest that satellite cell activation, as assessed by expression of MyoD or myogenin in satellite cell nuclei, occurs in muscles from spinal cord-transected rats independent of exercise.
|
Assessment of Muscle Damage
Hematoxylin and eosin. Sections of all EDL and soleus muscles were stained with hematoxylin and eosin and visually analyzed by light microscopy for signs of degeneration and possible regeneration. No abnormalities could be observed in any of the muscles. No differences in appearance were seen between the experimental groups and controls, indicating that no overt damage to the muscle fibers occurred due to either transection or exercise (data not shown).
Serum CK.
Muscle CK is an enzyme that leaks out of the muscle upon damage to the
sarcolemma and can be measured in the serum. In this study, serum CK
levels were measured and used as an indicator of damage to the muscle
membrane. No differences in serum CK levels were found between the
experimental groups and control (in
µmol · min
1 · l
1:
control, 317.5 ± 51.3; tx5, 559.4 ± 187.2; tx10, 394.8 ± 110.3; tx5e1, 312.5 ± 78.3; tx5e2, 282.9 ± 70.2; tx10e5, 410.7 ± 96.0). This suggests that no overt structural muscle damage has
occurred as a consequence of either the transection lesion or exercise.
| |
DISCUSSION |
|---|
|
|
|---|
Spinal cord transection results in rapid and dramatic loss of muscle mass. This trend is reversed by short daily bouts of passive cycling exercise. After only 5 days of exercise, a decrease in atrophy in all fiber types of soleus muscle and in type 2a and type 2x fibers of EDL muscle was observed. Recently, it was reported that step training in cats and rats with spinal cord transections ameliorated atrophy in soleus muscle (34, 40). However, these animals underwent 3-6 mo of training. The present study demonstrates that after spinal cord transection, muscles respond rapidly, even to passive exercise. Noteworthy is that exercise in our study was started shortly after transection while in other studies the start of exercise was delayed (34, 40). Interestingly, there was a differential effect of exercise on muscle fibers expressing different MHC isoforms. In EDL muscles, fibers expressing MHC 2b did not benefit from the exercise to the same extent as 2a- and 2x-expressing fibers, whereas in the soleus, all fibers benefited from exercise. It has been demonstrated that slow oxidative fibers are particularly sensitive to decreased neuromuscular activity (33), and therefore, these muscle fibers may also benefit most from the imposed exercise that likely restores some of the electrical activity to the muscles.
After spinal cord transection, there was an increased expression of type 2x MHC measured both at the mRNA and protein levels in both soleus, a slow muscle, and EDL, a fast muscle. It is generally accepted that inactivity causes muscles to shift to a faster phenotype (25), and this has been demonstrated in the soleus after spinal cord transection (38). Fast muscles have not been as extensively studied, and their response appears more complicated, differing in different models of inactivity. For example, plantaris muscles subjected to microgravity increased in type 2b MHC mRNA (5), but denervated plantaris muscles showed an increase in types 1 and 2a MHC isoforms, with 2x MHC not being affected (16). Thus the presence of an intact nerve appears to be more essential than the actual activity state for fast muscles, but not for slow. It is possible that type 2x MHC is an intermediate isoform expressed in fibers going through a transition whether these muscles are fast or slow. This possibility is supported by our data showing an increase in fibers coexpressing MHC isoforms mainly in soleus muscle and by other studies in which elevated expression of type 2x MHC and coexpression was observed in a variety of models of muscle inactivity (22, 38, 39). It is noteworthy that an increase in type 2b MHC mRNA was seen in the soleus after transection, indicating that this muscle is indeed going through a slow to fast transition. Exercise did not affect the expression of MHC isoforms at this early time point, even though exercise decreased atrophy. Therefore, the effect of exercise on fiber size may be mediated through different mechanisms from the changes exercise induces on MHC isoforms, which appear to require extended periods of exercise (34). It is possible that the electrical activity associated with exercise is sufficient to decrease atrophy, perhaps by allowing satellite cells to fuse in or to decrease the loss of myonuclei; however, the restoration of MHC expression may require additional factors or a higher level of electrical activity.
Analysis of muscle regulatory factor expression, markers of satellite cell activation (13, 24), allowed us to determine if satellite cells played a role in the response of muscles to spinal cord transection and exercise. We found that satellite cells expressed MyoD and myogenin after transection regardless of exercise status, suggesting that transection alone resulted in satellite cell activation. MyoD and myogenin expression is known to increase in myofiber nuclei and satellite cell nuclei after cessation of electrical activity due to denervation (11, 27, 42). However, denervation causes degeneration and regeneration, which are known to lead to satellite cell activation. The present study demonstrates that these regulatory factors are expressed in satellite cells after a decrease in neuromuscular activity without evidence of degeneration. These results are unexpected, since it has been shown that factors inducing atrophy decrease satellite cell and myofiber nuclear number, e.g., spinal isolation decreased myonuclear numbers (1) and hindlimb suspension reduced the number and proliferative capacity of satellite cells in growing muscles (9). Because activated satellite cells are normally assumed to divide and contribute to new myonuclei, it is not clear why in muscles of transected rats satellite cells were activated and what the signals for this activation might be. One possibility, that is yet to be tested, is that the satellite cells express MyoD and myogenin but never enter the cell cycle or contribute to new myonuclei. Accordingly, Smith et al. (36) showed that MyoD is expressed in satellite cells before proliferation was observed; myogenin, however, appeared after cell division. Although we did not detect a change in MyoD and myogenin expression in response to exercise, these factors may have different functions in satellite cells of transected only versus transected and exercised muscles. Moreover, exercise may alter MyoD and myogenin expression in satellite cells through a different mechanism from transection alone, but the response may be masked in the current experimental paradigm.
It has been reported that MyoD and myogenin are differentially expressed in slow vs. fast muscles, myogenin being more abundant in the former and MyoD in the latter (19, 41). In this study, we show that MyoD and myogenin react differently to transection in slow vs. fast muscles. Whereas MyoD mRNA was elevated to essentially the same extent in soleus and EDL, myogenin was significantly more elevated in the EDL. In addition, MyoD mRNA remained elevated only in soleus, where the protein was more readily detected in satellite cells than in myofiber nuclei. In contrast, in the EDL MyoD showed preferential accumulation in myofiber nuclei. In both muscles, myogenin was detected in satellite and myofiber nuclei to the same extent. It thus seems that these two transcription factors may have different functions depending on cell type (satellite cell or myofiber) and on the muscle in which they are expressed. This idea is supported by a recent study showing that MyoD is expressed in slow fibers of slow muscles, but not in slow fibers of fast muscles, suggesting that distinct mechanisms are utilized to regulate gene expression in muscles of different fiber type compositions (18).
Factors that interact with MyoD and myogenin might alter their function during muscle atrophy. Id-1 has been implicated as a mediator of atrophy (15), and in this study, Id-1 indeed appeared to be involved in the response to transection, since its expression transiently increased in all muscles after transection regardless of exercise status. However, Id-1 did not decrease on initiation of exercise and amelioration of atrophy. Thus signals leading to Id-1 expression during atrophy may be competing with signaling pathways activated in response to exercise that maintain or restore muscle mass.
In summary, short-term passive exercise decreased atrophy occurring with spinal cord transection, but there was no evidence of MHC transitions with exercise, indicating that different mechanisms may underlie the maintenance of mass vs. MHC isoform expression. Furthermore, satellite cell activation occurred with spinal cord transection as measured by an increased expression of MyoD and myogenin. The exact role that MyoD and myogenin play in this model is unclear; however, it is likely that the two factors have different functions in muscle with varying fiber types. Future studies should be directed at elucidating the signals responsible for satellite cell activation and their role in mediating the beneficial effects of exercise on muscle.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Institutes of Health Grants AR-08432 (to E. E. Dupont-Versteegden) and HD-35096 (to J. D. Houlé and C. A. Peterson).
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: C. Peterson, Dept. of Geriatrics, VA Hospital, Research 151, 4300 West 7th St., Little Rock, AR 72205.
Received 19 March 1998; accepted in final form 29 June 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Allen, D. L.,
S. R. Monke,
R. J. Talmadge,
R. R. Roy,
and
V. R. Edgerton.
Plasticity of myonuclear number in hypertrophied and atrophied mammalian skeletal muscle fibers.
J. Appl. Physiol.
78:
1969-1976,
1995
2.
Benezra, R.,
R. L. Davis,
D. Lockshon,
D. L. Turner,
and
H. Weintraub.
The protein Id: a negative regulator of helix-loop-helix DNA binding proteins.
Cell
61:
49-59,
1990[Medline].
3.
Bischoff, R.
The satellite cell and muscle regeneration
In: Myology. Basic and Clinical, edited by A. G. Engel,
and C. Franzini-Armstrong. New York: McGraw-Hill, 1994, p. 97-118.
4.
Cabric, M.,
and
N. T. James.
Morphometric analyses on the muscles of exercise trained and untrained dogs.
Am. J. Anat.
166:
359-368,
1983[Medline].
5.
Caiozzo, V. J.,
F. Haddad,
M. J. Baker,
R. E. Herrick,
N. Prietto,
and
K. M. Baldwin.
Microgravity-induced transformations of myosin isoforms and contractile properties of skeletal muscle.
J. Appl. Physiol.
81:
123-132,
1996
6.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
7.
Cusella-De Angelis, M. G.,
G. Lyons,
C. Sonnino,
L. De Angelis,
E. Vivarelli,
K. Farmer,
W. E. Wright,
M. Molinaro,
M. Bouche,
and
M. Buckingham.
MyoD, myogenin independent differentiation of primordial myoblasts in mouse somites.
J. Cell Biol.
116:
1243-1255,
1992
8.
Darr, K. C.,
and
E. Schultz.
Exercise-induced satellite cell activation in growing and mature skeletal muscle.
J. Appl. Physiol.
63:
1816-1821,
1987
9.
Darr, K. C.,
and
E. Schultz.
Hindlimb suspension suppresses muscle growth and satellite cell proliferation.
J. Appl. Physiol.
67:
1827-1834,
1989
10.
Dias, P.,
D. M. Parham,
D. N. Shapiro,
S. J. Tapscott,
and
P. J. Houghton.
Monoclonal antibodies to the myogenic regulatory protein MyoD1: epitope mapping and diagnostic utility.
Cancer Res.
52:
6431-6439,
1992
11.
Eftimie, R.,
H. R. Brenner,
and
A. Buonanno.
Myogenin and MyoD join a family of skeletal muscle genes regulated by electrical activity.
Proc. Natl. Acad. Sci. USA
88:
1349-1353,
1991
12.
Eppley, Z. A.,
J. Kim,
and
B. Russell.
A myogenic regulatory gene, qmf1, is expressed by adult myonuclei after injury.
Am. J. Physiol.
265 (Cell Physiol. 34):
C397-C405,
1993
13.
Grounds, M. D.,
K. L. Garrett,
M. C. Lai,
W. E. Wright,
and
M. W. Beilharz.
Identification of skeletal muscle precursor cells in vivo by use of MyoD1 and myogenin probes.
Cell Tissue Res.
267:
99-104,
1992[Medline].
14.
Grounds, M. D.,
and
Z. Yablonka-Reuveni.
Molecular and cell biology of skeletal muscle regeneration
In: Molecular and Cell Biology of Muscular Dystrophy, edited by T. Partridge. London: Chapman & Hall, 1993, p. 210-256.
15.
Gundersen, K.,
and
J. P. Merlie.
Id-1 as a possible transcriptional mediator of muscle disuse atrophy.
Proc. Natl. Acad. Sci. USA
91:
3647-3651,
1994
16.
Haddad, F.,
C. Arnold,
M. Zeng,
and
K. Baldwin.
Interaction of thyroid state and denervation on skeletal myosin heavy chain expression.
Muscle Nerve
20:
1487-1496,
1997[Medline].
17.
Hughes, S. M.,
M. Cho,
I. Karsch-Mizrachi,
M. Travis,
L. Silberstein,
A. Leinwand,
and
H. M. Blau.
Three slow myosin heavy chains sequentially expressed in developing mammalian skeletal muscle.
Dev. Biol.
158:
183-199,
1993[Medline].
18.
Hughes, S. M.,
K. Koishi,
M. Rudnicki,
and
A. M. Maggs.
MyoD protein is differentially accumulated in fast and slow skeletal muscle fibres and required for normal fibre type balance in rodents.
Mech. Dev.
61:
151-163,
1997[Medline].
19.
Hughes, S. M.,
J. M. Taylor,
S. J. Tapscott,
C. M. Gurley,
W. J. Carter,
and
C. A. Peterson.
Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones.
Development
118:
1137-1147,
1993[Abstract].
20.
Jacobs, S. C. J. M.,
J. H. J. Wokke,
P. R. Bar,
and
A. L. Bootsma.
Satellite cell activation after muscle damage in young and adult rats.
Anat. Rec.
242:
329-336,
1995[Medline].
21.
Jacobs-El, J.,
M. Zhou,
and
B. Russell.
MRF4, myf-5, and myogenin mRNAs in the adaptive responses of mature rat muscle.
Am. J. Physiol.
268 (Cell Physiol. 37):
C1045-C1052,
1995
22.
Jankala, H.,
V. Harjola,
N. E. Petersen,
and
M. Harkonen.
Myosin heavy chain mRNA transforms to faster isoforms in immobilized skeletal muscle: a quantitative PCR study.
J. Appl. Physiol.
82:
977-982,
1997
23.
Kasper, C. E.,
T. P. White,
and
L. C. Maxwell.
Running during recovery from hindlimb suspension induces transient muscle injury.
J. Appl. Physiol.
68:
533-539,
1990
24.
Koishi, K.,
M. Zhang,
I. S. McLennan,
and
A. J. Harris.
MyoD protein accumulates in satellite cells and is neurally regulated in regenerating myotubes and skeletal muscle fibers.
Dev. Dyn.
202:
244-254,
1995[Medline].
25.
Lieber, R. L.
Skeletal muscle adaptation to decreased use.
In: Skeletal Muscle Structure and Function, edited by R. L. Lieber. Baltimore, MD: Williams & Wilkins, 1992, p. 210-259.
26.
Lieber, R. L.,
J. O. Friden,
A. R. Hargens,
and
E. R. Feringa.
Long-term effects of spinal cord transection on fast and slow rat skeletal muscle. II. Morphometric properties.
Exp. Neurol.
91:
435-448,
1986[Medline].
27.
Neville, C. M.,
M. Schmidt,
and
J. Schmidt.
Response of myogenic determination factors to cessation and resumption of electrical activity in skeletal muscle: a possible role for myogenin in denervation supersensitivity.
Cell. Mol. Neurobiol.
12:
511-527,
1992[Medline].
28.
Olson, E. N.,
and
W. H. Klein.
bHLH factors in muscle development: dead lines and commitments, what to leave in and what to leave out.
Genes Dev.
8:
1-8,
1994
29.
Pin, C. L.,
and
P. A. Merrifield.
Embryonic and fetal rat myoblasts express different phenotypes after differentiation in vitro.
Dev. Genet.
14:
356-368,
1993[Medline].
30.
Reese, N. B.,
J. D. Houlé,
C. A. Peterson,
C. M. Gurley,
C. L. Berry,
R. D. Skinner,
and
E. Garcia-Rill.
Effects of fetal spinal cord (FSC) implants and exercise on muscle atrophy in chronic spinal rats.
Soc. Neurosci. Abstr.
20:
1706,
1994.
31.
Rosenblatt, J. D.,
D. Yong,
and
D. J. Parry.
Satellite cell activity is required for hypertrophy of overloaded adult rat muscle.
Muscle Nerve
17:
608-613,
1994[Medline].
32.
Round, J. M.,
F. M. D. Barr,
B. Moffat,
and
D. A. Jones.
Fibre areas and histochemical fibre types in the quadriceps muscle of paraplegic subjects.
J. Neurol. Sci.
116:
207-211,
1993[Medline].
33.
Roy, R. R.,
K. M. Baldwin,
and
V. R. Edgerton.
The plasticity of skeletal muscle: effects of neuromuscular activity.
In: Exercise Sport Science Reviews, edited by J. Holloszy. Baltimore, MD: Williams & Wilkins, 1991, p. 269-312.
34.
Roy, R. R.,
R. J. Talmadge,
J. A. Hodgson,
H. Zhong,
K. M. Baldwin,
and
V. R. Edgerton.
Training effects on soleus of cats spinal cord transected (T12-13) as adults.
Muscle Nerve
21:
63-71,
1998[Medline].
35.
Schiaffino, S.,
L. Gorza,
S. Sartore,
L. Saggin,
S. Ausoni,
M. Vianello,
K. Gundersen,
and
T. Lomo.
Three myosin heavy chain isoforms in type 2 skeletal muscle fibres.
J. Muscle Res. Cell Motil.
10:
197-205,
1989[Medline].
36.
Smith, C. K., II,
M. J. Janney,
and
R. E. Allen.
Temporal expression of myogenic regulatory genes during activation, proliferation, and differentiation of rat skeletal muscle satellite cells.
J. Cell. Physiol.
159:
379-385,
1994[Medline].
37.
Snow, M. H.
Satellite cell response in rat soleus muscle undergoing hypertrophy due to surgical ablation of synergists.
Anat. Rec.
227:
437-446,
1990[Medline].
38.
Talmadge, R. J.,
R. R. Roy,
and
V. R. Edgerton.
Prominence of myosin heavy chain hybrid fibers in soleus muscle of spinal cord-transected rats.
J. Appl. Physiol.
78:
1256-1265,
1995
39.
Talmadge, R. J.,
R. R. Roy,
and
V. R. Edgerton.
Distribution of myosin heavy chain isoforms in non-weight-bearing rat soleus muscle fibers.
J. Appl. Physiol.
81:
2540-2546,
1996
40.
Talmadge, R. J.,
R. R. Roy,
and
V. R. Edgerton.
Hindlimb step training effects soleus mass but not myosin heavy chain profile of spinal cord transected rats (Abstract).
Physiologist
39:
A39,
1996.
41.
Voytik, S. L.,
M. Przyborski,
S. F. Badylak,
and
S. F. Konieczny.
Differential expression of muscle regulatory factor genes in normal and denervated adult rat hindlimb muscles.
Dev. Dyn.
198:
214-224,
1993[Medline].
42.
Witzemann, V.,
and
B. Sakmann.
Differential regulation of MyoD and myogenin mRNA levels by nerve induced muscle activity.
FEBS Lett.
282:
259-264,
1991[Medline].
This article has been cited by other articles:
![]() |
P. Negredo, J.-L. L. Rivero, B. Gonzalez, A. Ramon-Cueto, and R. Manso Slow- and fast-twitch rat hind limb skeletal muscle phenotypes 8 months after spinal cord transection and olfactory ensheathing glia transplantation J. Physiol., May 15, 2008; 586(10): 2593 - 2610. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Huey, R. R. Roy, H. Zhong, and C. Lullo Time-dependent changes in caspase-3 activity and heat shock protein 25 after spinal cord transection in adult rats Exp Physiol, March 1, 2008; 93(3): 415 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C. Dreyer, E. L. Glynn, H. L. Lujan, C. S. Fry, S. E. DiCarlo, and B. B. Rasmussen Chronic paraplegia-induced muscle atrophy downregulates the mTOR/S6K1 signaling pathway J Appl Physiol, January 1, 2008; 104(1): 27 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Primeaux, M. Tong, and G. M. Holmes Effects of chronic spinal cord injury on body weight and body composition in rats fed a standard chow diet Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1102 - R1109. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Urso, Y.-W. Chen, A. G. Scrimgeour, P. C. Lee, K. F. Lee, and P. M. Clarkson Alterations in mRNA expression and protein products following spinal cord injury in humans J. Physiol., March 15, 2007; 579(3): 877 - 892. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. W. Harris, C. T. Putman, M. Rank, L. Sanelli, and D. J. Bennett Spastic Tail Muscles Recover From Myofiber Atrophy and Myosin Heavy Chain Transformations in Chronic Spinal Rats J Neurophysiol, February 1, 2007; 97(2): 1040 - 1051. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Dupont-Versteegden, B. A. Strotman, C. M. Gurley, D. Gaddy, M. Knox, J. D. Fluckey, and C. A. Peterson Nuclear translocation of EndoG at the initiation of disuse muscle atrophy and apoptosis is specific to myonuclei Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1730 - R1740. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Kosek, J.-s. Kim, J. K. Petrella, J. M. Cross, and M. M. Bamman Efficacy of 3 days/wk resistance training on myofiber hypertrophy and myogenic mechanisms in young vs. older adults J Appl Physiol, August 1, 2006; 101(2): 531 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-s. Kim, D. J. Kosek, J. K. Petrella, J. M. Cross, and M. M. Bamman Resting and load-induced levels of myogenic gene transcripts differ between older adults with demonstrable sarcopenia and young men and women J Appl Physiol, December 1, 2005; 99(6): 2149 - 2158. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Reid Response of the ubiquitin-proteasome pathway to changes in muscle activity Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1423 - R1431. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Leeuwenburgh, C. M. Gurley, B. A. Strotman, and E. E. Dupont-Versteegden Age-related differences in apoptosis with disuse atrophy in soleus muscle Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2005; 288(5): R1288 - R1296. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Carroll, J. D. Fluckey, R. H. Williams, D. H. Sullivan, and T. A. Trappe Human soleus and vastus lateralis muscle protein metabolism with an amino acid infusion Am J Physiol Endocrinol Metab, March 1, 2005; 288(3): E479 - E485. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Gallegly, N. A. Turesky, B. A. Strotman, C. M. Gurley, C. A. Peterson, and E. E. Dupont-Versteegden Satellite cell regulation of muscle mass is altered at old age J Appl Physiol, September 1, 2004; 97(3): 1082 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishido, K. Kami, and M. Masuhara In vivo expression patterns of MyoD, p21, and Rb proteins in myonuclei and satellite cells of denervated rat skeletal muscle Am J Physiol Cell Physiol, August 1, 2004; 287(2): C484 - C493. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Siu, D. A. Donley, R. W. Bryner, and S. E. Alway Myogenin and oxidative enzyme gene expression levels are elevated in rat soleus muscles after endurance training J Appl Physiol, July 1, 2004; 97(1): 277 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Otis, R. R. Roy, V. R. Edgerton, and R. J. Talmadge Adaptations in metabolic capacity of rat soleus after paralysis J Appl Physiol, February 1, 2004; 96(2): 584 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haddad, R. R. Roy, H. Zhong, V. R. Edgerton, and K. M. Baldwin Atrophy responses to muscle inactivity. II. Molecular markers of protein deficits J Appl Physiol, August 1, 2003; 95(2): 791 - 802. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Bamman, V. J. Hill, G. R. Adams, F. Haddad, C. J. Wetzstein, B. A. Gower, A. Ahmed, and G. R. Hunter Gender Differences in Resistance-Training-Induced Myofiber Hypertrophy Among Older Adults J. Gerontol. A Biol. Sci. Med. Sci., February 1, 2003; 58(2): B108 - 116. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-M. Chen, N. S. Stott, and H. K. Smith Effects of botulinum toxin A injection and exercise on the growth of juvenile rat gastrocnemius muscle J Appl Physiol, October 1, 2002; 93(4): 1437 - 1447. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Talmadge, R. R. Roy, V. J. Caiozzo, and V. R. Edgerton Mechanical properties of rat soleus after long-term spinal cord transection J Appl Physiol, October 1, 2002; 93(4): 1487 - 1497. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Staib, S. J. Swoap, and S. K. Powers Diaphragm contractile dysfunction in MyoD gene-inactivated mice Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2002; 283(3): R583 - R590. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Alway, H. Degens, D. A. Lowe, and G. Krishnamurthy Increased myogenic repressor Id mRNA and protein levels in hindlimb muscles of aged rats Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2002; 282(2): R411 - R422. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Dupont-Versteegden, R. J. L. Murphy, J. D. Houle, C. M. Gurley, and C. A. Peterson Mechanisms leading to restoration of muscle size with exercise and transplantation after spinal cord injury Am J Physiol Cell Physiol, December 1, 2000; 279(6): C1677 - C1684. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Adams, F. Haddad, and K. M. Baldwin Time course of changes in markers of myogenesis in overloaded rat skeletal muscles J Appl Physiol, November 1, 1999; 87(5): 1705 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Dupont-Versteegden, R. J. L. Murphy, J. D. Houle, C. M. Gurley, and C. A. Peterson Activated satellite cells fail to restore myonuclear number in spinal cord transected and exercised rats Am J Physiol Cell Physiol, September 1, 1999; 277(3): C589 - C597. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Dupont-Versteegden, M. Knox, C. M. Gurley, J. D. Houle, and C. A. Peterson Maintenance of muscle mass is not dependent on the calcineurin-NFAT pathway Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1387 - C1395. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |