|
|
||||||||
Departments of Surgery and Pathology, University of Colorado Health Sciences Center, Denver, Colorado 80262
| |
ABSTRACT |
|---|
|
|
|---|
Lipopolysaccharide (LPS) preconditioning induces cardiac
resistance to subsequent LPS or ischemia. This study tested the
hypothesis that resistance to LPS and resistance to ischemia
are two manifestations of cardiac cross-resistance which may involve
reprogramming of cardiac gene expression. Rats were preconditioned with
a single dose of LPS (0.5 mg/kg ip). Cardiac resistance to LPS was
examined with a subsequent LPS challenge. Cardiac resistance to
ischemia was determined by subjecting hearts to
ischemia-reperfusion. Total RNA was extracted from myocardium
for Northern analysis of mRNAs encoding protooncoproteins, antioxidant
enzymes, and contractile protein isoforms. Rats preconditioned with LPS
1-7 days earlier acquired cardiac resistance to endotoxemic
depression. This resistance temporally correlated with resistance to
ischemia. Pretreatment with cycloheximide (0.5 mg/kg ip)
abolished resistance to both LPS and ischemia. LPS
preconditioning induced the expression of c-jun and
c-fos mRNAs. LPS also transiently
increased mRNAs encoding catalase and Mn-containing superoxide
dismutase. The expression of both
- and
-myosin heavy chain mRNAs
was upregulated, whereas the expression of cardiac
-actin mRNA was
suppressed. We conclude that 1)
LPS induces sustained cardiac resistance to both LPS and ischemia, 2) resistance to
ischemia and resistance to LPS seem to be two mechanistically
indistinct components of cardiac cross-resistance, and
3) the cardiac cross-resistance is
associated with reprogramming of myocardial gene expression.
endotoxin; ischemia; protooncogenes; contractile protein isogenes; mRNA
| |
INTRODUCTION |
|---|
|
|
|---|
ENDOTOXIN (lipopolysaccharide, LPS) exerts profound effects on the myocardium, leading to cardiac contractile depression and cardiac adaptation. We have reported that cardiac contractile dysfunction induced by sublethal LPS is reversible in the rat (25, 28) and that rat heart acquires resistance to subsequent LPS challenge after recovery from endotoxemic depression (28). Previous work from our laboratory (2) has also shown that rat heart acquires functional resistance to ischemia-reperfusion injury after LPS preconditioning. Further studies demonstrate that this cardiac resistance to ischemia is a delayed and sustained protective response, appearing at 24 h and persisting to 7 days after LPS preconditioning, and seems to involve de novo protein synthesis (24, 26, 31). It is likely that resistance to LPS and resistance to ischemia are two components of LPS-induced cardiac cross-resistance. However, it is unclear whether LPS-induced cardiac resistance to LPS is sustained and whether the resistance to LPS temporally correlates with the resistance to ischemia. Furthermore, it is unknown whether LPS-induced cardiac resistance to LPS is sensitive to protein synthesis inhibition as well. The temporal relation between these two cardiac protective responses and their individual sensitivity to protein synthesis inhibition are important to determine whether they are components of cardiac cross-resistance or mechanistically distinct.
The mechanisms underlying LPS-induced cardiac protective responses remain unknown. However, the delayed protection suggests that reprogramming of cardiac gene expression may be involved. Indeed, a variety of stressful stimuli can induce reprogramming of cardiac gene expression, leading to myocardial adaptation to a subsequent stress (8). LPS has numerous biological activities. LPS stimulates the production and release of cytokines by monocytes and macrophages and hence increases the levels of cytokines in circulation and in tissues including myocardium (19, 26). LPS also induces the expression of inducible nitric oxide (NO) synthase in the myocardium and thus increases cardiac NO level (20, 34). These secondary factors induced by LPS may regulate cardiac gene expression.
Indeed, LPS induces the in vivo expression of heat shock protein 70 (HSP70) in the interstitial cells of rat heart, and the cardiac
resistance to LPS is accompanied by increased HSP70 in the myocardium
(28). It is likely that HSP70 is involved in the cardiac resistance to
LPS. However, upregulation of this stress protein may not be the only
mechanism for LPS-induced myocardial protection because heat stress
only provides partial cardiac resistance to LPS while eliciting more
vigorous expression of cardiac HSP70 (28). Furthermore, cytokines,
specifically tumor necrosis factor-
, seem not to be important
contributors to LPS-induced cardiac functional resistance to
ischemia (26). Possibly, cardiac cross-resistance to LPS and
ischemia involves broader molecular adaptation than the
expression of HSP70 and cytokines. Cardiac remodeling induced by stress
involves the expression of protooncogenes (7) and fetal isogenes of
contractile proteins, such as sarcomeric
-actin and myosin heavy
chain (MHC) (18). The influence of LPS on the expression of
protooncogenes and contractile protein isogenes in the myocardium
remains to be determined. LPS has been shown to increase the activities
of myocardial antioxidant enzymes, such as catalase, glutathione
peroxidase (GSH-Px), and superoxide dismutase (SOD) (2, 21, 22). It is
unclear whether the regulation of the activities of these enzymes by
LPS involves the expression of cardiac genes encoding enzyme proteins.
The present study was undertaken 1)
to delineate the temporal relation between LPS-induced cardiac
resistance to endotoxemic depression and cardiac resistance to
ischemia; 2) to examine the influence of protein synthesis inhibition on these two protective responses; 3) to examine the
expression of protooncogenes (c-jun and c-fos), antioxidant enzyme genes
[Cu- and Zn-containing (Cu/Zn) SOD, Mn-containing SOD, catalase,
and GSH-Px] and contractile protein isogenes (
-MHC,
-MHC,
cardiac
-actin, and skeletal
-actin) in the myocardium after LPS
preconditioning; and 4) to delineate
the relation between the expression of these genes with LPS-induced
cardiac protective responses.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals. Male Sprague-Dawley rats, 300-325 g body wt, were purchased from Sasco (Omaha, NE). One hundred and sixteen animals were used in this study. The animals were acclimated in a quarantine room and maintained on a standard pellet diet for 2 wk before initiation of the experiments. All animal experiments were approved by the Animal Care and Research Committee, University of Colorado Health Sciences Center. All animals received humane care in compliance with the "Guide for the Care and Use of Laboratory Animals" [DHEW Publication no. (NIH) 85-23, revised 1985, Office of Science and Health Reports, DRR/NIH, Bethesda, MD 20205].
Chemicals and reagents.
cDNAs complementary to mouse c-fos,
mouse c-jun, human cardiac
-actin,
rat cardiac MHC (both
- and
-isoforms), human Mn-SOD, and 28S
rRNA were obtained from American Type Culture Collection (Rockville,
MD). Rat catalase cDNA (clone pMJ-1010) was a generous gift from Dr.
Shuichi Furuta, Shinshu University, Japan (12). Rat Cu/Zn-SOD cDNA
(clone pGEM-32) was a generous gift from Dr. Linda Clerch, University
of Miami (14). Rat GSH-Px cDNA (clone pBGPx-24) was a generous gift
from Dr. Shinichi Yoshimura, Tokai University, Japan (39).
Oligonucleotide probes to rat
-MHC and rat
-MHC were obtained
from Oncogene Science (Uniondale, NY). Oligonucleotide probes to rat
cardiac
-actin (GGGAGATGGGAGAGGGCCTCAGAGGATTCC, complementary to
nucleotides 39-68 of 3'-untranslated region; Refs. 23,
40) and rat skeletal
-actin (AGAGAGAGCGCGTACACAGACGCGGTGCGC, complementary to nucleotides 1-30 of 3'-untranslated
region; Ref. 40) were synthesized by the Department of Biochemistry,
Colorado State University. Radioactive nucleotides were obtained
from Du Pont-NEN Research Products (Boston, MA). T4 polynucleotide
kinase, DNase, and DNA polymerase were obtained from New England
Biolabs (Boston, MA). LPS (from Salmonella
typhimurium), cycloheximide, and all other chemicals
were obtained from Sigma Chemical (St. Louis, MO).
Experimental protocols. To examine the temporal relation between the cardiac resistance to endotoxemic depression and the cardiac resistance to ischemia, 48 rats were preconditioned with a single dose of LPS (0.5 mg/kg ip). A group of 24 preconditioned rats received a subsequent challenge with the same dose of LPS at 2 h or 1, 3, or 7 days after preconditioning (n = 6 at each time point). Hearts were isolated at 6 h after the second exposure to LPS, and cardiac contractility was assessed by the Langendorff technique and compared with saline control group (a single saline injection 6 h before heart isolation; n = 10) and single LPS group (a single LPS injection 6 h before heart isolation; n = 10). The time course of endotoxemic myocardial depression has been examined by our previous study (28). The maximal contractile depression is at 6 h after administration of this dose of LPS, and cardiac contractility is fully recovered at 24 h. Thus cardiac contractile depression was examined in this study at 6 h after administration of LPS. Another group of 24 preconditioned rats was killed, and hearts were isolated at 2 h or 1, 3, or 7 days after preconditioning (n = 6 at each time point). Isolated hearts were subjected to 25 min of normothermic global ischemia and 40 min of reperfusion. Postischemic functional recovery was compared with that of the saline control group (a single saline injection 2 h to 7 days before heart isolation; n = 12).
To examine the influence of protein synthesis inhibition on LPS preconditioning, 12 rats were pretreated with cycloheximide (0.5 mg/kg ip) 3 h before LPS preconditioning (0.5 mg/kg ip). These animals were divided into two groups at 3 days after LPS preconditioning. One group (n = 6) was used to examine the cardiac resistance to endotoxemic depression by subjecting to subsequent LPS challenge. Another group (n = 6) was used to examine the cardiac resistance to ischemia by subjection to isolated ischemia. Cycloheximide alone (0.5 mg/kg ip) was given to an additional group of 6 rats. Their hearts were isolated 3 days after cycloheximide treatment to examine the influence of this agent on baseline cardiac contractility and postischemic functional recovery. This cycloheximide dose has been demonstrated to abolish LPS-induced cardiac functional resistance to ischemia (26). A group of 18 rats was treated with a single dose of LPS (0.5 mg/kg ip) and killed at 1, 2, 3, 6, or 12 h or 1, 2, 3, or 5 days (n = 2 at each time point) after the treatment. Hearts were rapidly excised and coronary vessels were flushed with 10 ml of cold (4°C) PBS (pH 7.4) by retrograde perfusion through the aortic root. Ventricular (both left and right) tissue was rapidly frozen in liquid nitrogen and stored at
70°C for RNA extraction.
Isolated heart perfusion and assessment of cardiac contractile function. Intrinsic cardiac contractility was determined by a modified isovolumetric Langendorff technique as described elsewhere (25, 28) and expressed as left ventricular developed pressure (LVDP). At 6 h after LPS challenge, beating hearts were rapidly excised into oxygenated Krebs-Henseleit solution containing (in mM) 5.5 glucose, 1.2 CaCl2, 4.7 KCl, 25 NaHCO3, 119 NaCl, 1.17 MgSO4, and 1.18 KH2PO4. Normothermic retrograde perfusion was performed with the same solution in an isovolumetric and nonrecirculating mode. The perfusion buffer was saturated with a gas mixture of 92.5% O2-7.5% CO2 to achieve PO2 of 450 mmHg, PCO2 of 40 mmHg, and pH of 7.4. Perfusion pressure was maintained at 70 mmHg. A latex balloon was inserted through the left atrium into the left ventricle, and the balloon was filled with 0.15-0.20 ml of water to achieve a left ventricular end-diastolic pressure (LVEDP) of 5-10 mmHg (at peak and flat portion of LVEDP-LVDP curve). Pacing wires were fixed to the right atrium, and the heart was paced at 6.0 Hz. The myocardial temperature was maintained by placing the heart in an air-filled tissue chamber, which was kept at 37°C with circulating warm water. Hearts were perfused for 20 min, and LVDP was continuously recorded with a computerized pressure amplifier-digitizer (Maclab 8, AD Instrument, Cupertino, CA).
Global ischemia and reperfusion. The Langendorff technique for global ischemia and reperfusion has been described elsewhere (24, 26, 27). Beating hearts were rapidly excised and arrested in cold Krebs-Henseleit solution. Normothermic retrograde perfusion was performed as mentioned above. A three-way stopcock was mounted above the aorta cannula to create global ischemia. After 15 min of perfusion (equilibration), hearts were subjected to 25 min of normothermic global ischemia, followed by 40 min of reperfusion. During ischemia, hearts were placed in a perfusate-filled organ bath chamber without pacing. The temperature of perfusate in the chamber was maintained at 37°C. LVDP and LVEDP were continuously recorded with the computerized pressure amplifier-digitizer.
RNA extraction and Northern analysis.
Total RNA was extracted by the method of Chomczynski and Sacchi (4)
with slight modification (27, 28). Gel electrophoresis and Northern
blotting were carried out by using the methods previously described
(27, 28). Briefly, ventricular tissue was homogenized in guanidinium
thiocyanate solution, and total RNA was subsequently extracted with
phenol and chloroform. RNA samples (12 µg) were size separated by
electrophoresis on denatured 1% agarose gel and then transferred onto
a nylon membrane using a vacuum transfer apparatus (Stratagene Cloning
Systems, La Jolla, CA). Cross-linking was performed with a ultraviolet
cross-linker (Stratagene Cloning Systems). Oligonucleotide probes were
used to detect mRNAs encoding cardiac
-actin, skeletal
-actin,
cardiac
-MHC, and cardiac
-MHC. The oligonucleotides were labeled
with [
-32P]ATP by
5'-end labeling, and hybridization was performed overnight at
65°C. mRNAs encoding c-jun,
c-fos, Cu/Zn-SOD, Mn-SOD, catalase, GSH-Px, total sarcomeric
-actin mRNA, total MHC mRNA, and 28S rRNA
were detected with cDNA probes. Mouse
c-fos and
c-jun cDNAs and human cardiac
-actin, Mn-SOD, and 28S rRNA cDNAs were applied to hybridize rat
mRNA species because these genes are evolutionarily conserved (6, 15,
23, 32). cDNA probes were labeled with [
-32P]CTP by
nick translation, and hybridization was performed
overnight at 42°C. After hybridization, the membrane was washed
with 0.3 M sodium chloride-0.3 M sodium citrate-0.1% SDS (pH 7.0) for
30 min at 65°C (for membranes probed with oligonucleotide) or
55°C (for membranes probed with cDNA) and then with 0.15 M sodium
chloride-0.15 M sodium citrate-0.1% SDS (pH 7.0) for 10 min at room
temperature. Autoradiography was accomplished with Kodak X-Omat film at
70°C. Densitometric measurement was carried out with a
computerized laser densitometer (Molecular Dynamics, Sunnyvale, CA),
and the density of each band of interest was normalized against its
corresponding 28S rRNA band.
Statistical analysis. Data are expressed as means ± SE. ANOVA was performed, and a difference was accepted as significant when P < 0.05 was verified by Bonferroni-Dunn post hoc analysis.
| |
RESULTS |
|---|
|
|
|---|
Temporal relation between cardiac resistance to LPS and cardiac resistance to ischemia. LVDP was 101 ± 3.6 mmHg in untreated rats. At 6 h after an exposure to LPS, LVDP was attenuated, whereas treatment with saline 6 h before heart isolation did not influence LVDP (Fig. 1). Hearts preconditioned with LPS 1, 3, or 7 days earlier were resistant to the myocardial depressive effect of subsequent LPS. LVDP in these groups was maintained after a subsequent LPS challenge (Fig. 1). However, cardiac resistance to LPS was not present at 2 h after preconditioning.
|
|
Effect of cycloheximide pretreatment on LPS preconditioning. Administration of the protein synthesis inhibitor cycloheximide alone to rats did not affect baseline cardiac contractility (Fig. 3A) or postischemic cardiac functional recovery (Fig. 3B). However, cycloheximide pretreatment abolished the cardiac resistance to subsequent LPS observed at 3 days after LPS preconditioning. At 6 h after a subsequent LPS exposure, LVDP was 62.5 ± 7.2 mmHg in the group treated with cycloheximide plus LPS preconditioning (Fig. 3A), which was not different from the LVDP in the group treated with a single dose of LPS for 6 h (56.8 ± 2.5 mmHg). Similarly, pretreatment with cycloheximide abolished cardiac functional resistance to ischemia observed at 3 days after LPS preconditioning (Fig. 3B). LVDP in the group treated with cycloheximide plus LPS was 46.4 ± 4.4 mmHg (P > 0.05 vs. saline control) at the end of reperfusion, and LVEDP was 42.3 ± 2.8 mmHg (P > 0.05 vs. saline control) at the end of reperfusion.
|
Expressions of c-jun and c-fos mRNAs after LPS preconditioning. The results of Northern analysis showing c-jun and c-fos mRNAs are presented in Fig. 4. In the ventricular myocardium of saline-treated rats, c-fos mRNA was undetectable, whereas a low level of c-jun mRNA was detected. LPS induced bimodal expression of c-jun mRNA in ventricular myocardium. The first peak (5.3-fold of saline control level) was observed at 1 h, and a second peak (8.7-fold of saline control level) manifested at 6 h after LPS treatment. The c-jun mRNA level was still elevated at 24 h. LPS also induced rapid expression of c-fos mRNA in ventricular myocardium; c-fos mRNA was detected at 1 h after LPS treatment. The c-fos mRNA level reached a peak (5.0-fold of saline control level) at 2 h, declined thereafter, and normalized at 24 h.
|
Expression of Cu/Zn-SOD, Mn-SOD, catalase, and GSH-Px mRNAs after LPS preconditioning. Figure 5 shows the results of Northern analysis of Cu/Zn-SOD, Mn-SOD, catalase, and GSH-Px mRNAs. All of these four mRNA species were expressed in ventricular myocardium of saline-treated heart. LPS treatment did not affect the levels of GSH-Px and Cu/Zn-SOD mRNAs. Catalase mRNA increased slightly at 6 h after LPS treatment (1.8-fold of saline control level). Mn-SOD mRNA increased primarily at 6 and 12 h (1.7- and 2.1-fold of saline control level) after LPS treatment, and an additional band with slightly bigger molecular size appeared.
|
Expression of MHC and
-actin isoform mRNAs after LPS
preconditioning.
The synthesized sarcomeric
-actin oligonucleotide probes have high
selectivity. The cardiac
-actin oligonucleotide did not react with
total RNA isolated from rat skeletal muscle but hybridized strongly
with total RNA isolated from neonatal rat heart or adult rat heart
(Fig.
6A). In
contrast, the skeletal
-actin oligonucleotide hybridized strongly
with total RNA isolated from rat skeletal muscle or neonatal rat heart
(Fig. 6A). The results showing
Northern analysis of mRNAs encoding MHC and
-actin isoforms are
presented in Fig. 6, B and
C. In the ventricular myocardium of
saline-treated rats,
-MHC,
-MHC, cardiac
-actin, and skeletal
-actin mRNAs were constitutively expressed. LPS treatment resulted
in differential upregulation of
-MHC and
-MHC mRNAs in
ventricular myocardium.
-MHC mRNA increased primarily at 3-12
h, peaked at 3 h (2.4-fold of saline control level), and normalized at
24 h after LPS treatment.
-MHC mRNA increased at 2 h after LPS
treatment and peaked at 24 h (5.7-fold of saline control level; Fig.
6B). An increase in total MHC mRNAs
at 2-24 h was also detected when the blot was probed with rat
cardiac MHC cDNA which hybridizes with both
- and
-isoforms of
MHC mRNA (Fig. 6B).
-MHC mRNA
remained elevated at 3 days and normalized at 5 days after LPS
treatment (Fig. 6C). LPS treatment
had minimal influence on skeletal
-actin mRNA level in ventricular
myocardium. However, cardiac
-actin mRNA decreased at 6 h after LPS
treatment and declined to 20% of saline control level by 24 h (Fig.
6B). The full-length cardiac
-actin cDNA recognizes both cardiac
-actin mRNA and skeletal
-actin mRNA. It may also cross-react with
-actin mRNA, since an
additional band with slightly bigger molecular size was detected when
the blot was probed with this cDNA. Total
-actin mRNA decreased in a
temporal pattern similar to that of cardiac
-actin mRNA (Fig. 6B), and total
-actin mRNA
remained slightly lower at 5 days, although it was recovering at 3 and
5 days after LPS treatment (Fig.
6C).
|
| |
DISCUSSION |
|---|
|
|
|---|
This study demonstrates that LPS-induced cardiac functional resistance to endotoxemic depression and cardiac functional resistance to ischemia are durable (lasting for days) cardioprotective responses. Cardiac resistance to subsequent LPS and cardiac resistance to ischemia appear to be allied components of LPS-induced cardiac cross-resistance because the two cardioprotective responses are temporally correlated and both are sensitive to protein synthesis inhibition. The development of this cardiac cross-resistance is associated with reprogramming of the expression of cardiac genes encoding protooncoproteins, antioxidant enzymes, and contractile protein isoforms.
Our previous studies (25, 28) have shown that sublethal LPS induces delayed and reversible cardiac contractile dysfunction in the rat. Cardiac contractile dysfunction occurs at 4 h after an exposure to LPS, becomes maximal at 6 h, and is completely recovered at 24 h. Interestingly, rat heart acquires resistance to subsequent LPS challenge after its recovery from endotoxemic depression, and this resistance is manifested as a lack of cardiac contractile dysfunction after a subsequent LPS exposure (28). However, the mechanisms underlying this cardiac resistance remain unknown.
Systemic LPS tolerance is well recognized. Tolerance develops after repeated sublethal doses of LPS and is characterized by an attenuated response to a subsequent LPS challenge. Animals rendered tolerant are resistant to systemic LPS toxicosis in terms of proinflammatory cytokine production (41), pyrogenesis (33), and mortality (11). The results of the present study confirm that LPS tolerance develops in the heart after LPS preconditioning (28). The development of cardiac resistance to LPS is time dependent. The cardiac resistance to endotoxemic contractile depression developed at 24 h and persisted to 7 days after LPS preconditioning. However, the resistance was not induced at 2 h. This time course correlates well with the cardiac resistance to ischemia, which occurs at 24 h and lasts up to 7 days after LPS preconditioning. Furthermore, both resistance to LPS and resistance to ischemia were abolished by protein synthesis inhibition. The results suggest that resistance to LPS and resistance to ischemia after LPS preconditioning are components of LPS-induced cardiac cross-resistance. Thus LPS preconditioning induces a delayed and sustained cardiac cross-resistant state that appears to obligate the synthesis of protective proteins.
The mechanisms of systemic LPS tolerance remain unclear. Several hypotheses have been formulated, including 1) suppression of immunoresponse to LPS by endogenous glucocorticoids (42), 2) reduced production of proinflammatory cytokines by monocytes and macrophages (37), and 3) elevated NO production in macrophages (10). Although all of these mechanisms may indirectly contribute to the attenuated cardiac response to LPS, here we have investigated the myocardial endogenous mechanisms, i.e., myocardial adaptation, in the elaboration of LPS-induced cardiac cross-resistance. We hypothesized that LPS preconditioning induces nonspecific myocardial adaptation resulting from reprogramming of cardiac gene expression and thus renders the heart resistant to subsequent LPS, ischemia, and perhaps other noxious stimuli.
We have reported that LPS preconditioning induces HSP70 in myocardial
interstitial cells of rat heart (28). HSP70 has been shown to inhibit
tumor necrosis factor-
production by LPS-stimulated monocytes or
macrophages (35). Indeed, cardiac HSP70 protects myocardium against
ischemic injury (30) and may be involved in cardiac resistance to LPS
(28). However, heat stress only provides partial cardiac resistance to
LPS, although it elicits more vigorous expression of cardiac HSP70
(28). Thus LPS-induced cardiac cross-resistance may not be explained
exclusively by the induction of HSP70. This cross-resistance may
involve broader molecular adaptation. In this regard, Das et al. (8)
have proposed that myocardial adaptation to stress may involve the
expression of several group genes including protooncogenes, stress
protein genes, and antioxidant enzyme genes. In the present study, we examined the expression of protooncogenes
(c-jun and
c-fos) and antioxidant enzyme genes
(Cu/Zn-SOD, Mn-SOD, catalase, and GSH-Px). We also examined the
expression of MHC and
-actin isogenes (
-MHC,
-MHC, cardiac
-actin, and skeletal
-actin) because the expression of these
genes has been shown to be associated with myocardial adaptation
induced by hemodynamic stress (18).
Both c-jun and c-fos are components of transcription factor AP-1, which regulates the transcription of numerous cardiac genes. It is unknown whether LPS influences cardiac c-jun and c-fos gene expression. By Northern analysis, we noted that LPS preconditioning induced a rapid but transient increase in c-jun and c-fos mRNAs in ventricular myocardium. The transcripts of these two protooncogenes increased at 1 and 2 h after LPS treatment. Interestingly, the expression of c-jun mRNA was temporally bimodal. The first peak was at 1 h, and a second peak manifested at 6 h. Indeed, different forms of stress upregulate the expression of c-jun and c-fos in mammalian cells (7, 18, 27, 36, 38). The rapid expression of c-jun and c-fos mRNAs may be the result of acute systemic and/or cardiac stress after administration of LPS. It is likely that the second phase of c-jun expression is induced by secondary factors, such as cytokines, or by myocardial depression itself. If the latter is true, the second phase expression of c-jun mRNA may serve as a marker of myocardial depression.
The activation of AP-1 and expression of fetal isoforms of
-actin
and MHC indicate cardiac fetal reprogramming (18). In the ventricular
tissue of saline-treated adult rat heart, cardiac
-actin, skeletal
-actin,
-MHC, and
-MHC mRNAs were constitutively expressed.
LPS upregulated the expression of both
-MHC and
-MHC mRNAs in the
ventricular tissue. However, changes in the levels of these two gene
transcripts were temporally divergent.
-MHC mRNA increased
transiently (2-12 h), whereas the increase in
-MHC mRNA was
sustained.
-MHC mRNA level was maximal at 24 h after LPS treatment
when cardiac cross-resistance developed and remained elevated at 3 days. LPS did not affect the level of skeletal
-actin mRNA in the
ventricular myocardium. However, the expression of cardiac
-actin
mRNA was depressed, and cardiac
-actin mRNA decreased to 20% of
control level at 24 h after LPS treatment. Although the significance of
the differential expression of
-actin and MHC isogenes, i.e.,
downregulation of cardiac
-actin mRNA expression and upregulation of
-MHC mRNA expression, is not immediately known from this study, this
gene program is distinct from the gene program exhibited in cardiac
hypertrophy (18) and may be specific to LPS-induced myocardial
adaptation.
Free radicals contribute to ischemia-reperfusion injury (3) and have recently been implicated in LPS-induced organ dysfunction (9). Few studies have examined the influence of LPS on antioxidant enzyme gene transcription in tissues (5, 13). Clerch et al. (5) probed mRNAs encoding antioxidant enzymes in rat lung at 1-6 h after LPS treatment. Mn-SOD mRNA increased, whereas catalase mRNA decreased in the early phase after LPS treatment. Cu/Zn-SOD and GSH-Px mRNAs were unchanged. Ghosh et al. (13) examined antioxidant enzyme gene expression in rat heart, liver, and kidney at 12 and 24 h after treatment with LPS at doses similar to those utilized in the present study. In the heart, Cu/Zn-SOD mRNA decreased at both time points, whereas Mn-SOD and catalase mRNAs increased at 24 h. These investigators (13) also noted that alterations in antioxidant enzyme mRNAs varied with the tissue type and dose of endotoxin examined. LPS preconditioning has been reported to increase antioxidant enzyme (catalase, SOD, and GSH-Px) activities in the myocardium (2, 21, 22). It is unclear from previous studies whether increased myocardial antioxidant enzyme activities are due to enhanced expression of cardiac genes encoding enzyme proteins.
Using Northern analysis at a broader time range, we examined the influence of LPS preconditioning on cardiac mRNAs encoding antioxidant enzymes. Catalase mRNA was increased transiently at 6 h after LPS preconditioning, whereas GSH-Px and Cu/Zn-SOD mRNAs were unchanged. An obvious change is that Mn-SOD mRNA increased at 6 and 12 h after LPS preconditioning. This time course is slightly different from the previous observation by Ghosh et al. (13) that Mn-SOD mRNA increased in the rat heart at 24 h after LPS treatment. It should be pointed out that, in the present study, mRNA level was analyzed in ventricular myocardium rather than in the whole heart. There may be location (ventricle vs. atrium) differences in the expression of myocardial antioxidant enzyme genes. Furthermore, cardiac vessels were thoroughly flushed before collection of the myocardium in the present study. Thus the potential contribution of blood cells was avoided. These differences in sampling may account for the difference between our finding and the previous report (13). An additional band with slightly bigger molecular size also appeared at 6 and 12 h after LPS preconditioning. The Mn-SOD mRNA band of bigger size may be derived by utilization of different transcription termination sites of the Mn-SOD gene. In this regard, Hurt et al. (17) have demonstrated that rat Mn-SOD gene can generate multiple mRNA species due to alternate polyadenylation. Ho et al. (16) have detected six species of Mn-SOD mRNA, ranging from 1.3 to 4.2 kb, in hyperoxic rat lungs. In view of previous studies (21, 22) and the current findings, it is likely that the increase in catalase activity and Mn-SOD activity in the LPS-preconditioned myocardium is, at least partially, due to increased gene transcription. The increase in GSH-Px activity and Cu/Zn-SOD activity may be regulated at posttranscriptional levels.
Taken together, LPS preconditioning increases
c-jun,
c-fos,
-MHC,
-MHC, catalase, and
Mn-SOD mRNAs and decreases cardiac
-actin mRNA in the myocardium.
This broad program of molecular remodeling may play a central role in
the LPS-induced cardiac cross-resistance. Fetal isoform of MHC utilizes
ATP more efficiently for contractile function (1, 29). The increased
expression of
-MHC may lead to phenotypic changes in the myocardium,
resulting in enhanced cardiac resistance to a subsequent insult that
disrupts myocardial energy metabolism. Catalase and Mn-SOD are key
members of the anti-free radical defense and play important roles in
the protection against ischemia-reperfusion injury (21, 22).
Moreover, LPS preconditioning induces the expression of HSP70 in the
myocardium (28). HSP70 is involved in processing newly synthesized
cellular proteins and may play an important role in renaturing
denatured proteins. Together, these molecular remodeling events may
promote the cardiac cross-resistance induced by LPS preconditioning.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported in part by National Institutes of Health Grants HL-44186, HL-43696, GM-08315, and GM-49222.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: X. Meng, Dept. of Surgery, Box C-320, University of Colorado Health Sciences Center, 4200 E. 9th Ave., Denver, CO 80262.
Received 28 January 1998; accepted in final form 24 April 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Achterberg, P. W.,
A. S. Nieukoop,
B. Schoutsen,
and
J. W. de Jong.
Different ATP-catabolism in perfused adult and newborn rat hearts.
Am. J. Physiol.
254 (Heart Circ. Physiol. 23):
H1091-H1098,
1988
2.
Brown, J. M.,
M. A. Grosso,
L. S. Terada,
G. J. Whitman,
A. Banerjee,
C. W. White,
A. H. Harken,
and
J. E. Repine.
Endotoxin pretreatment increases endogenous myocardial catalase activity and decreases ischemia-reperfusion injury of isolated rat hearts.
Proc. Natl. Acad. Sci. USA
86:
2516-2520,
1989
3.
Brown, J. M.,
L. S. Terada,
M. A. Grosso,
G. J. Whitman,
S. E. Velasco,
A. Patt,
A. H. Harken,
and
J. E. Repine.
Xanthine oxidase produces hydrogen peroxide which contributes to reperfusion injury of ischemic isolated rat hearts.
J. Clin. Invest.
81:
1297-1301,
1988.
4.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
5.
Clerch, L. B.,
A. Wright,
D. J. Chung,
and
D. Massaro.
Early divergent lung antioxidant enzyme expression in response to lipopolysaccharide.
Am. J. Physiol.
271 (Lung Cell. Mol. Physiol. 15):
L949-L954,
1996
6.
Curran, T.,
M. B. Gordon,
K. L. Rubino,
and
L. C. Sambucetti.
Isolation and characterization of the c-fos (rat) cDNA and analysis of post-translational modification in vitro.
Oncogene
2:
79-84,
1987[Medline].
7.
Das, D. K.,
R. M. Engelman,
and
Y. Kimura.
Molecular adaptation of cellular defenses following preconditioning of the heart by repeated ischemia.
Cardiovasc. Res.
27:
578-584,
1993
8.
Das, D. K.,
N. Maulik,
and
I. I. Moraru.
Gene expression in acute myocardial stress. Induction by hypoxia, ischemia, reperfusion, hyperthermia and oxidative stress.
J. Mol. Cell. Cardiol.
27:
181-193,
1995[Medline].
9.
Downs, T. R.,
R. C. Dage,
and
J. F. French.
Reduction in endotoxin-induced organ dysfunction and cytokine secretion by a cyclic nitrone antioxidant.
Int. J. Immunopharmacol.
17:
571-580,
1995[Medline].
10.
Fahmi, H.,
D. Charon,
M. Mondange,
and
R. Chaby.
Endotoxin-induced desensitization of mouse macrophages is mediated in part by nitric oxide production.
Infect. Immun.
63:
1863-1869,
1995
11.
Fraker, D. L.,
M. C. Stovroff,
M. J. Merino,
and
J. A. Norton.
Tolerance to tumor necrosis factor in rats and the relationship to endotoxin tolerance and toxicity.
J. Exp. Med.
168:
95-105,
1988
12.
Furuta, S.,
H. Hayashi,
M. Huikata,
S. Miyazawa,
T. Osumi,
and
T. Hashimoto.
Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase.
Proc. Natl. Acad. Sci. USA
83:
313-317,
1986
13.
Ghosh, B.,
C. D. Hanevold,
K. Dobashi,
J. K. Orak,
and
I. Singh.
Tissue differences in antioxidant enzyme gene expression in response to endotoxin.
Free Radic. Biol. Med.
21:
533-540,
1996[Medline].
14.
Hass, M. A.,
J. Iqbal,
L. B. Clerch,
L. Frank,
and
D. Massaro.
Rat lung Cu,Zn superoxide dismutase: isolation and sequence of a full-length cDNA and studies of enzyme induction.
J. Clin. Invest.
83:
1241-1246,
1989.
15.
Ho, Y.-S.,
and
J. D. Crapo.
Isolation and characterization of complementary DNAs encoding human manganese-containing superoxide dismutase.
FEBS Lett.
229:
256-260,
1988[Medline].
16.
Ho, Y.-S.,
M. S. Dey,
and
J. D. Crapo.
Antioxidant enzyme expression in rat lungs during hyperoxia.
Am. J. Physiol.
270 (Lung Cell. Mol. Physiol. 14):
L810-L818,
1996
17.
Hurt, J.,
J. L. Hsu,
W. C. Dougall,
G. A. Visner,
I. M. Burr,
and
H. S. Nick.
Multiple message RNA species generated by alternate polyadenylation from the rat manganese superoxide dismutase gene.
Nucleic Acids Res.
20:
2985-2990,
1992
18.
Izumo, S.,
S. B. Nadal-Ginard,
and
V. Mahdavi.
Protooncogene induction and reprogramming of cardiac gene expression produced by pressure overload.
Proc. Natl. Acad. Sci. USA
85:
339-343,
1988
19.
Kapadia, S.,
J. Lee,
G. Torre-Amione,
H. H. Birdsall,
T. S. Ma,
and
D. L. Mann.
Tumor necrosis factor-
gene and protein expression in adult feline myocardium after endotoxin administration.
J. Clin. Invest.
96:
1042-1052,
1995.
20.
Luss, H.,
S. C. Watkins,
P. D. Freeswick,
A. K. Imro,
A. K. Nussler,
T. R. Billiar,
R. L. Simmons,
P. J. de Nido,
and
F. X. McGowan, Jr.
Characterization of inducible nitric oxide synthase expression in endotoxemic rat cardiac myocytes in vivo and following cytokine exposure in vitro.
J. Mol. Cell. Cardiol.
27:
2015-2029,
1995[Medline].
21.
Maulik, N.,
M. Watanabe,
D. T. Engelman,
R. M. Engelman,
and
D. K. Das.
Oxidative stress adaptation improves postischemic ventricular recovery.
Mol. Cell. Biochem.
144:
67-74,
1995[Medline].
22.
Maulik, N.,
M. Watanabe,
D. Engelman,
R. M. Engelman,
V. E. Kagan,
E. Kisin,
V. Tyurin,
G. A. Cordis,
and
D. K. Das.
Myocardial adaptation to ischemia by oxidative stress induced by endotoxin.
Am. J. Physiol.
269 (Cell Physiol. 38):
C907-C916,
1995
23.
Mayer, Y.,
H. Czosnek,
P. E. Zeelon,
D. Yaffe,
and
U. Nudel.
Expression of the genes coding for the skeletal muscle and cardiac actins in the heart.
Nucleic Acids Res.
12:
1087-1100,
1984
24.
Meldrum, D. R.,
J. C. Cleveland,
R. T. Rowland,
A. Banerjee,
A. H. Harken,
and
X. Meng.
Early and delayed preconditioning: differential mechanisms and additive protection.
Am. J. Physiol.
273 (Heart Circ. Physiol. 42):
H725-H733,
1997
25.
Meng, X.,
L. Ao,
J. M. Brown,
D. A. Fullerton,
A. Banerjee,
and
A. H. Harken.
Nitric oxide synthase is not involved in cardiac contractile dysfunction in a rat model of endotoxemia without shock.
Shock
7:
111-118,
1997[Medline].
26.
Meng, X.,
L. Ao,
J. M. Brown,
D. R. Meldrum,
B. C. Sheridan,
B. S. Cain,
A. Banerjee,
and
A. H. Harken.
LPS induces late cardiac functional protection against ischemia independent of cardiac and circulating TNF-
.
Am. J. Physiol.
273 (Heart Circ. Physiol. 42):
H1894-H1902,
1997
27.
Meng, X.,
J. M. Brown,
L. Ao,
A. Banerjee,
and
A. H. Harken.
Norepinephrine induces cardiac heat shock protein and delayed cardioprotection in the rat through
1-adrenoceptors.
Cardiovasc. Res.
32:
374-383,
1996
28.
Meng, X.,
J. M. Brown,
L. Ao,
S. K. Nordeen,
W. Franklin,
A. H. Harken,
and
A. Banerjee.
Endotoxin induces cardiac heat shock protein 70 and resistance to endotoxemic myocardial dysfunction.
Am. J. Physiol.
271 (Cell Physiol. 40):
C1316-C1324,
1996
29.
Pope, B.,
J. F. Y. Hoh,
and
A. Weeds.
The ATPase activity of rat cardiac myosin isozymes.
FEBS Lett.
118:
205-208,
1980[Medline].
30.
Radford, N. B.,
M. Fina,
I. J. Benjamin,
R. W. Moreadith,
K. H. Graves,
P. Zhao,
S. Gavva,
A. Wiethoff,
A. D. Sherry,
C. R. Malloy,
and
R. S. Williams.
Cardioprotective effects of 70-kDa heat shock protein in transgenic mice.
Proc. Natl. Acad. Sci. USA
93:
2339-2342,
1996
31.
Rowland, R. T.,
X. Meng,
J. C. Cleveland,
D. R. Meldrum,
A. H. Harken,
and
J. M. Brown.
LPS-induced delayed myocardial adaptation enhances acute preconditioning to optimize postischemic myocardial function.
Am. J. Physiol.
272 (Heart Circ. Physiol. 41):
H2708-H2715,
1997
32.
Sakai, M.,
A. Okuda,
I. Hatayama,
K. Sato,
S. Nishi,
and
M. Muramatsu.
Structure and expression of the rat c-jun messenger RNA: tissue distribution and increase during chemical hepatocarcinogenesis.
Cancer Res.
49:
5633-5637,
1989
33.
Schotanus, K.,
G. M. Holtkamp,
N. Rooijen,
F. J. H. Tilders,
and
F. Berkenbosch.
Circulating tumor necrosis factor-
does not mediate endotoxin-induced hypothermia in rats.
Am. J. Physiol.
268 (Regulatory Integrative Comp. Physiol. 37):
R989-R996,
1995
34.
Schulz, R.,
E. Nava,
and
S. Moncada.
Induction and potential biological relevance of a Ca2+ independent nitric oxide synthase in the myocardium.
Br. J. Pharmacol.
105:
575-580,
1992[Medline].
35.
Snyder, Y. M.,
L. Guthrie,
G. F. Evans,
and
S. H. Zuckerman.
Transcriptional inhibition of endotoxin-induced monokine synthesis following heat shock in murine peritoneal macrophages.
J. Leukoc. Biol.
51:
181-187,
1992[Abstract].
36.
Ueyama, T.,
S. Umemoto,
and
E. Senba.
Immobilization stress induces c-fos and c-jun immediate early genes expression in the heart.
Life Sci.
59:
339-347,
1996[Medline].
37.
Wakabayashi, G.,
J. G. Cannon,
J. A. Gelfand,
B. D. Clark,
K. Aiura,
J. F. Burke,
S. M. Wolff,
and
C. A. Dinarello.
Altered interleukin-1 and tumor necrosis factor production and secretion during pyrogenic tolerance to LPS in rabbit.
Am. J. Physiol.
267 (Regulatory Integrative Comp. Physiol. 36):
R329-R336,
1994
38.
Webster, K. A.,
D. J. Discher,
and
N. H. Bishopric.
Regulation of fos and jun immediate-early genes by redox or metabolic stress in cardiac myocytes.
Circ. Res.
74:
679-686,
1994
39.
Yoshimura, S.,
S. Takekoshi,
K. Watanabe,
and
Y. Fujii-Kuriyama.
Determination of nucleotide sequence of cDNA coding rat glutathione peroxidase and diminished expression of the mRNA in selenium deficient rat liver.
Biochem. Biophys. Res. Commun.
154:
1024-1028,
1988[Medline].
40.
Zakut, R.,
M. Shani,
D. Givol,
S. Neuman,
D. Yaffe,
and
U. Nudel.
Nucleotide sequence of the rat skeletal muscle actin gene.
Nature
298:
857-859,
1982[Medline].
41.
Zuckerman, S. H.,
and
G. F. Evans.
Endotoxin tolerance: in vivo regulation of tumor necrosis factor and interleukin-1 synthesis is at the transcriptional level.
Cell. Immunol.
140:
513-519,
1992[Medline].
42.
Zuckerman, S. H.,
J. Shellhaas,
and
L. D. Butler.
Differential regulation of lipopolysaccharide-induced interleukin-1 and tumor necrosis factor synthesis: effects of endogenous and exogenous glucocorticoids and the role of the pituitary-adrenal axis.
Eur. J. Immunol.
19:
301-305,
1989[Medline].
This article has been cited by other articles:
![]() |
S.-F. Ma, D. N. Grigoryev, A. D. Taylor, S. Nonas, S. Sammani, S. Q. Ye, and J. G. N. Garcia Bioinformatic identification of novel early stress response genes in rodent models of lung injury Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L468 - L477. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bauer, T. Welbourne, T. Shigematsu, J. Russell, and D. N. Granger Endothelial expression of selectins during endotoxin preconditioning Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2000; 279(6): R2015 - R2021. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Meng, B. D. Shames, E. J. Pulido, D. R. Meldrum, L. Ao, K. S. Joo, A. H. Harken, and A. Banerjee Adrenergic induction of bimodal myocardial protection: signal transduction and cardiac gene reprogramming Am J Physiol Regulatory Integrative Comp Physiol, May 1, 1999; 276(5): R1525 - R1533. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |