Am J Physiol Cell Physiol AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 275: C56-C67, 1998;
0363-6143/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chew, C. S.
Right arrow Articles by Chen, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chew, C. S.
Right arrow Articles by Chen, X.
Vol. 275, Issue 1, C56-C67, July 1998

Lasp-1 is a regulated phosphoprotein within the cAMP signaling pathway in the gastric parietal cell

C. S. Chew, J. A. Parente Jr., C.-J. Zhou, E. Baranco, and X. Chen

Institute of Molecular Medicine and Genetics, Medical College of Georgia, Augusta, Georgia 30912

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Activation of the cAMP signaling pathway is correlated with increased secretory-related events in a wide variety of cell types including the gastric parietal cell. Within this pathway, as well as in other intracellular signaling pathways, protein phosphorylation serves as a major downstream regulatory mechanism. However, although agonist and cAMP-dependent activation of cAMP-dependent protein kinase (PKA) has been demonstrated, little is currently known about the downstream in vivo phosphoprotein substrates of this enzyme. Here we report the isolation, microsequencing, and cloning of a LIM and SH3 domain-containing, cAMP-responsive, 40-kDa phosphoprotein (pp40) from rabbit gastric parietal cells. The deduced amino acid sequence for pp40 is 93.5%, homologous with the putative protein product of the human gene lasp-1, which was recently identified based on its overexpression in some breast carcinomas. In addition to LIM and SH3 domains, the rabbit homolog contains two highly conserved PKA consensus sequences as well as two conserved SH2 binding motifs and several other putative protein kinase phosphorylation sites, including two for tyrosine kinase(s). Combined Northern and Western blot analyses indicate that pp40/lasp-1 is widely expressed (through a single 3.3-kb message) not only in epithelial tissues but also in muscle and brain. Furthermore, stimulation of isolated parietal cells, distal colonic crypts, and pancreatic cells with the adenylyl cyclase activator forskolin leads to the appearance of a higher molecular weight form of pp40/lasp-1, a finding which is consistent with an increase in protein phosphorylation. Thus pp40/lasp-1 appears to be regulated within the cAMP signaling pathway in a wide range of epithelial cell types. Because the cAMP-dependent increase in pp40 phosphorylation is correlated with secretory responses in the parietal cell and because pp40 appears to be widely distributed among various secretory tissues, this newly defined signaling protein may play an important role in modulating ionic transport or other secretory-related activities in many different cell types.

rabbit; adenosine 3',5'-cyclic monophosphate-dependent protein kinase; protein phosphorylation; T84 cells; pancreas; colon; LIM domain; SH3 domain

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

THE SIGNALING PATHWAY of cAMP plays a central role in the regulation of multiple processes in epithelial cells including ion transport and exocytosis. In addition, cAMP-dependent changes in actin-based cytoskeletal organization and cellular morphology frequently occur in advance of other cellular responses (18, 24, 31). Within the actin-rich gastric parietal cell, elevation of intracellular cAMP concentrations increases hydrogen ion secretion, and this cAMP-dependent increase in secretion is preceded by dramatic morphological transformations (15). Most evidence favors the hypothesis of Forte and colleagues (14, 16) that these striking membrane transformations are the result of an exocytotic-like translocation of cytoplasmic tubulovesicles containing the proton-transporting H+-K+-ATPase to the apical plasma membrane. This hypothesis is further reinforced by recent studies in which several membrane-associated docking/fusion proteins have been detected in H+-K+-ATPase-containing vesicles (4, 28). Thus it appears that secretagogue-dependent morphological transformations in the parietal cell are mechanistically similar to membrane docking and fusion events that occur in other secretory cell types.

In general, very little is known about the specific molecular events that mediate cAMP-induced alterations in cellular morphology and secretion in the gastric parietal cell or in other highly differentiated cell types. Physiologically, parietal cell cAMP content is increased upon binding of the paracrine agonist histamine to H2-receptor subtypes with resultant activation of adenylyl cyclase, the enzyme that catalyzes the production of cAMP from ATP. The subsequent activation of cAMP-dependent protein kinase (PKA) in response to histamine and other agents that elevate intracellular cAMP content is also well established (reviewed in Refs. 5, 20). However, beyond this point, only four potential downstream phosphoprotein targets of PKA have been detected (7, 38, 39) and, of these, only the cytoskeletal, actin-membrane linking protein ezrin has been unequivocally identified (19).

A major goal of our laboratory is to identify and then define the specific functions of the major regulatory phosphoproteins within the cAMP and other intracellular signaling pathways within the parietal cell. As an initial approach, we have recently developed novel methodologies to isolate low-abundance, agonist-responsive phosphoproteins (26). Here, a modification of the original approach was used to isolate, microsequence, clone, and express a previously detected, but unidentified, cAMP-responsive phosphoprotein, pp40 (7). The deduced amino acid sequence for pp40 is highly homologous to that for the putative protein product of the human MLN50 gene, which is overexpressed in some breast carcinomas (35, 36). This gene and the putative protein product are now referred to as lasp-1 because the deduced amino acid sequence contains both a LIM motif and an SH3 binding domain (LIM and SH3 protein) (35). Because this combination of protein-protein-interacting domains is currently unique, lasp-1 has recently been categorized as the first member of a new LIM protein subfamily (35).

The present study provides the first evidence that the lasp-1 protein functions as a regulated phosphoprotein within the cAMP signaling pathway, not only in the parietal cell but also in other cell types including pancreas, colon, and possibly the T84 human colonic cell line. Present and previous observations (7) have further demonstrated an excellent correlation between increased pp40/lasp-1 phosphorylation and acid secretory-related responses in isolated parietal cells. Because pp40/lasp-1 has been localized to a parietal cell membrane fraction that becomes enriched in the proton-transporting H+-K+-ATPase upon initiation of the acid secretory response (7, 37) and because this protein possesses several potential protein-protein interaction domains, we postulate that pp40/lasp-1 may play a pivotal role in regulating stimulus-secretion coupling within the parietal cell, perhaps by interacting with other vesicular proteins associated with the H+-K+-ATPase complex. The widespread distribution of pp40/lasp-1 mRNA in both human (35) and rabbit tissues further suggests the possibility that this cAMP-dependent phosphoprotein may play also a key regulatory role in other secretory cell types.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cell isolation and parietal cell enrichment. Parietal and chief cells were isolated from the gastric mucosae of male New Zealand White rabbits (2-4 kg) using sequential pronase/collagenase digestion then enriched to 70-85% purity using Accudenz density gradient separation as previously described (6). For specific in situ 32P-labeling experiments and for RNA isolation, parietal cells were further enriched to >95% purity by centrifugal elutriation (6). Colonic crypts from rabbit distal colon were isolated using a procedure similar to that for isolation of parietal cells except that only the collagenase (Sigma blend, 1.3 U/ml) digestion step was used, and oxygenated tissue was digested in a Precision metabolic shaker (165 rpm), rather than in a magnetically stirred flask, with trituration at 10-min intervals. The presence of intact colonic crypts was confirmed by microscopic observation. Pancreatic cell clusters (8-12 cells/cluster with mainly acinar cell-like configurations and central lumens) were prepared by the same technique. T84 cells (passage 55) were provided by Dr. James Goldenring of the Medical College of Georgia, Augusta, GA.

Metabolic 32P labeling of parietal and T84 cell proteins and detection of pp40 phosphorylation. 32P labeling of endogenous ATP pools in parietal cells was performed as previously described (6, 25). In brief, freshly isolated cells were washed in a low-BSA, phosphate-free incubation medium then equilibrated in this medium plus 2 mCi/ml [32P]orthophosphate for 2 h at 37°C. After metabolic labeling, cells were exposed to various agents (see RESULTS), rapidly pelleted, washed once in ice-cold PBS, then lysed in hot SDS/beta -mercaptoethanol (BME) [0.3% (wt/vol) SDS, 1% (vol/vol) BME]. After a 20-min incubation on ice with DNase/RNase (RASE RNase, DPFF DNase I), cellular extracts were precipitated with acetone at room temperature, dissolved in RSA [9.5 M urea, 1.6% pH 5-8, 0.4% pH 3.5-9 ampholines, 100 mM dithiothreitol (DTT) plus 2% CHAPS or 2% ocytyl-beta -glucopyranoside, Ref. 25], and subjected to analytical or preparative two-dimensional gel electrophoresis [isoelectric focusing (IEF), pH 5-8; 9% SDS-PAGE] to resolve pp40 protein that was detected by autoradiographic comparisons with unstimulated controls (7).

T84 colonic epithelial cells were seeded on 60-mm culture dishes and used for phosphorylation studies 7 days later. Cellular proteins were labeled with 32P as described by Cohn (11) except that metabolic labeling time was increased to 90 min and reactions were terminated by placing the dishes on ice and rinsing the cells with cold PBS. Detached cells were then rapidly pelleted and immediately lysed with hot SDS/BME, and resulting extracts were analyzed on two-dimensional gels as for parietal cells.

Changes in pp40 phosphorylation were quantitated using BioImage 2-D Gel Analyzer software (Ann Arbor, MI) as previously described (25). Where appropriate, values are expressed as means ± SE, with n representing the number of independent experiments. For paired samples, data were analyzed for statistical significance using the Student's t-test for paired comparisons. ANOVA and Dunnett's tests were used to analyze multiple comparisons (7).

pp40 isolation and purification to apparent homogeneity. Cells (~100 × 106) were diluted to 2 × 106 cells/ml, temperature equilibrated (30 min, 37°C), then stimulated for 10-15 min with 10 µM forskolin. To extract pp40 from parietal cell membranes, cells were rapidly pelleted, rinsed once with ice-cold extraction buffer [10 mM Tris, pH 7.4, 50 mM beta -glycerophosphate, 1.5 mM EGTA, 1 mM DTT, 1 mM benzamidine, 0.1 mM Na3VO4, 0.1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF), and 10 µg/ml each of leupeptin/pepstatin], and incubated in the same buffer containing 0.5% Triton X-100 (8 ml) for 30 min on ice. Extracts were centrifuged (10,000 g, 20 min, 4°C), and supernatants were heated in SDS/BME (3-5 min, 100°C). Because pp40 is incompletely extracted by incubation with Triton X-100 (7), Triton-extracted pellets were further disrupted with an Omni 5000 cell disrupter (7-mm probe, 70% power, 4 × 30 s, 4°C) in a small volume of extraction buffer, centrifuged 2 × 15 min (800 g) to remove nuclei and unbroken cells, then centrifuged at 3,000 g to remove particulate material. The resulting supernatants were heated in SDS/BME and pooled with supernatants from the initial Triton extraction. Protein concentrations were determined after TCA precipitation of aliquots using a Bio-Rad DC protein assay kit.

Pooled supernatants were dialyzed and concentrated with Centripreps (Amicon), acetone precipitated, then dissolved in SDS-PAGE stop solution (2% SDS, 0.0625 M Tris · HCl, pH 6.8, 1 mM EDTA, 10% glycerol, 100 mM DTT, and 0.002% bromphenol blue). Proteins (25 mg in 2 ml) were resolved on a Bio-Rad Prep Cell [28-mm ID; 3 cm, 4.75% T, 2.66% C acrylamide/piperazine diacrylamide (PDA) stacking gel; 8 cm, 9% T, 2.66% C acrylamide/PDA resolving gel; 12-W constant power]. Peak fractions containing pp40 were initially identified by Cerenkov counting of 32P-labeled pp40 marker [500-1,000 counts/min (cpm)] isolated from preparative two-dimensional gels as previously described (26). Later, pp40-containing fractions were identified by reproducible absorbance patterns of Prep Cell fractions and by molecular weight on mini-gels using Inovision Isee software (Research Triangle, NC) for image capture and BioImage Whole Band Analyzer software to determine the molecular weight ranges in acetone-precipitated aliquots of each fraction. Approximately 300-600 µg total protein were recovered from each pp40-containing peak.

Prep Cell peaks containing pp40 were acetone precipitated, dissolved in 50 µl RSA, then subjected to preparative two-dimensional PAGE (~300 µg protein/gel; first dimension, 3-mm × 10-cm gels, pH 5-8, 6,500-7,000 V · h, 18°C; second dimension, 1-mm thick, 4.75% T, 2.66% C acrylamide/PDA stacking gel and 9% Duracryl resolving gel) using a Millipore (Bedford, MA) Investigator two-dimensional electrophoresis system. Gels were stained with a modified Coomassie blue stain, destained, and dried as previously described (26). pp40 was identified based on autoradioradiographic detection of comigration of Coomassie blue-stained protein with endogenously 32P-labeled pp40-containing extracts from forskolin-stimulated cells (26).

Cleveland V8 digestion and microsequencing of pp40. To concentrate pp40 for Cleveland V8 digestion (9) and subsequent microsequencing, the protein was excised from preparative two-dimensional gels, pooled, and concentrated in a single lane of a minigel with an extra long stacking gel (6 cm, 4.85% T, 2.66% C, acrylamide/PDA) and an 8% T, 2.66% C (acrylamide/PDA) resolving gel (15-mA constant current, 18°C). Resolved pp40 was detected by staining with modified Coomassie blue stain (as above) followed by brief destaining in 30% methanol then excised and further destained with several changes of 50% methanol. For V8 digestion (endoproteinase Glu-C), excised pp40 bands were loaded onto a second SDS-PAGE gel and transferred to Immobilon Pseq polyvinylidine fluoride membrane (Millipore) as previously described (26). Peptides from V8 digests were sequenced at the Emory University Microsequencing Facility (Atlanta, GA).

Phosphoamino acid analysis of pp40 phosphorylated in vivo. For phosphoamino acid analysis of pp40 phosphorylated within intact parietal cells, 32P-labeled cells were stimulated with histamine (100 µM, 5 min), rapidly pelleted, washed with ice-cold extraction buffer (see above), and extracted (20 min, 4°C) with extraction buffer plus 0.5% Triton X-100 (100 µl/106 cells). Extracts were centrifuged (10,000 g, 15 min, 4°C), and the resulting supernatants were heated in SDS/BME, acetone precipitated, and subjected to preparative two-dimensional electrophoresis. 32P-labeled pp40 was detected by autoradiography and excised from dried gels. The amount of 32P incorporated into pp40 was estimated by Cerenkov counting. Labeled pp40 was subjected to acid hydrolysis (6 N HCl, 110°C, 1 h) under N2 then resolved by two-dimensional phosphoamino acid analysis using a Hunter Thin Layer Peptide Mapping System (CBS Scientific, Del Mar, CA) as described by Boyle et al. (3). Resolved phosphoamino acid standards (5 µg each: phosphoserine, phosphothreonine, phosphotyrosine) were identified on thin-layer chromatography plates by ninhydrin staining and used to locate radiolabeled amino acids detected by autoradiography (-70°C with intensifying screens).

Molecular cloning and sequencing of pp40. mRNA was isolated from parietal cells (98% pure) using a Poly(A)Ttract system 1000 (Promega). Tagged cDNA was synthesized from this mRNA with a 3'-rapid amplification of cDNA ends (RACE) system as previously described (26). Sense and antisense primers were designed based on pp40 microsequence information and predicted lasp-1 amino acid sequences using OLIGO Primer Analysis software, version 5.0 for MacIntosh (National Biosciences, Plymouth, MN). Highly conserved regions in lasp-1 cDNA were identified by comparing the human and mouse sequences in the GenBank (accession nos. X82456 and X96973, respectively). Sense and antisense primers (19- to 21-mer) were synthesized by Gibco BRL Life Sciences as follows: sense primer, SP1 (amino acid position 8-13; CGGCAAGATCGTGTATCCC); sense primer, SP2 (amino acid position 53-59; CAACGCACACTACCCCAAGC); sense primer, SP3 (amino acid position 106-112; GCTCCAGAGAATCAAGAAGA); and antisense primer, ASP1 (amino acid position 113-119; CGGCTCTTCTCAAACTCC TCA).

pp40/lasp-1-specific double-stranded DNA was generated using PCR amplification with Taq DNA polymerase (Perkin Elmer, A. Roche Division, Nutley, NJ). PCR-generated bands of expected sizes were excised, extracted with a GlassPac/GS Quickit (National Scientific Supply, San Raphael, CA), amplified using a high-stringency PCR protocol (initial denaturation, 97°C, 3 min; anneal, 55°C, 30 s; extend, 72°C, 30 s followed by 30 cycles of 97°C, 15 s; 55°C, 30 s; 72°C, 30 s with a final extension at 72°C, 10 min) then subcloned into pBluescript. Positive plaques were detected by blue-white screening (30). cDNA from plasmids was sequenced in the Medical College of Georgia Core DNA Sequencing Facility with an ABI Prism 377 automated DNA sequencer using ABI Prism Cycle Sequencing Dye Terminator Ready Reaction kits.

The complete 3'-untranslated region (UTR) of rabbit pp40/lasp-1 was obtained using 3'-RACE (Gibco BRL Life Technologies, Gaithersburg, MD) and an EXPAND long-template PCR system (Boehringer Mannheim, Indianapolis, IN). cDNA containing a universal amplimer primer (Gibco) was first synthesized using 3'-RACE. A 3-kb PCR product was subsequently generated with the EXPAND long-template PCR using a sense primer based on the previously identified rabbit DNA sequence including a 5'-Xba I restriction site (GGCTCTAGAGCTCCAGAGAATCAAGAAGA) and an antisense universal amplimer primer that was modified to include a 5'-Xho I restriction site (GGCCTCGAGGGCCACGCGTCGACTAGTAC). The resulting PCR product was subcloned and sequenced as above. The entire 3'-UTR was sequenced using primer walking.

To complete the upstream portion of the open reading frame, sense and antisense primers were synthesized based on the conserved 5'-UTRs of the human and mouse sequences (TCGGAACCATGAACCCCAACT) and the rabbit 3'-UTR sequence (TCGCGGATGCTAACAGGACAA), respectively. A 904-bp PCR product was generated with these primers using Pfu DNA polymerase (Stratagene, La Jolla, CA): initial denaturation, 96°C, 3 min; hot start, 80°C, 20 s; anneal, 55°C, 2 min; extend, 72°C, 1 min; followed by 30 cycles of 97°C, 20 s; 72°C, 2 min with a final extension at 72°C, 10 min. This PCR product was also subcloned and sequenced as above.

cDNA and amino acid sequences were analyzed with Wisconsin Genetics Computing Group software at the University of Georgia, Athens, GA, and National Center for Biotechnology Information software on the Internet (www.ncbi.nlm. nih.gov).

Expression of recombinant pp40/lasp-1, polyclonal antibody generation, and Western blot analyses. Recombinant lasp-1 was expressed in a prokaryotic system using the pET15b expression vector (Novagen, Madison, WI). After the cloning and sequencing of pp40/lasp-1, the 789 nt open reading frame was PCR amplified using a sense primer (GGCCATATGAACCCCAACTGCGCCCGGTGC) containing a 5'-Nde I restriction site and an antisense primer (CCGGATCCTCAGATGGCCTCCACGTATTT) containing a 5'-BamH I restriction site. The resultant full-length sequence was gel isolated (as above) and inserted into the pET15b vector in-frame with the polyhistidine (His-tag) sequence. Ligated plasmids were transformed into BL21(DE3)pLysS bacteria and the pp40/lasp-1 recombinant His-tagged protein produced by isopropylthio-beta -D-galactoside induction as previously described (25). Recombinant protein was isolated from bacterial supernatants using a Hi Trap chelating column (Pharmacia Biotech, Piscataway, NJ) then further purified to apparent homogeneity by fast protein liquid chromatography using a Mono Q column (Pharamacia Biotech). The purity of recombinant pp40/lasp-1 was verified using SDS-PAGE gel analysis.

Polyclonal antibodies directed against the recombinant pp40/lasp-1 protein were generated by injecting mice with 50-100 µg of the purified protein four or five times at 2- to 4-wk intervals. The resulting polyclonals obtained from these mice were screened at the University of Georgia Monoclonal Facility by ELISA using the recombinant pp40/lasp-1 protein and by enhance chemiluminescence-based Western blot analysis in our laboratory using parietal cell extracts as previously described (26). Primary antibody dilutions were 1:500-1:1,000. Secondary antibody (sheep anti-mouse horseradish peroxidase, Amersham) was diluted 1:2,500-1:5,000 depending on the expected strength of the signal. Specificity of the pp40 antibody was confirmed by 1) comparing, on Western blots of SDS-PAGE gels, the migration patterns of the endogenous cross-reacting protein with the predicted migration pattern of recombinant His-tagged pp40/lasp-1 (which is expected to migrate at a slightly higher molecular weight due to the presence of the added histidine residues) and by 2) confirming comigration of the endogenous cross-reacting protein with endogenously 32P-labeled pp40 on two-dimensional Western blots.

Extracts of various tissues used for Western blot analyses were prepared using a protocol similar to that used to extract pp40 from parietal cells (above) except that the Triton X-100 extraction step was omitted. After aliquots were removed for protein analysis, extracts were immediately heated in hot SDS stop solution and stored at -20°C until used.

Northern blot analyses of pp40/lasp-1 tissue distribution. Total RNA was isolated from various tissues using a RNA STAT-60 kit (Tel-Test, Friendswood, TX), separated on 1.25% formaldehyde-agarose gels containing 1 µg/ml ethidium bromide, and transferred to Magnagraph (Micron, Westboro, MA) nylon membranes (26). The open reading frame of pp40 was radiolabeled by PCR amplification (Gibco BRL Life Technologies) in the presence of [alpha -32P]dCTP (sp act 6,000 Ci/mmol). After transfer, Northern blots were prehybridized (4 h, 42°C in 50% formamide, 5× Denhardt's, 5× SSPE, 0.2% SDS, 10% dextran sulfate, 100 µg/ml salmon sperm DNA) then hybridized with the 32P-labeled pp40 probe for 16 h under the same conditions. Membranes were washed under high-stringency conditions (0.1× SSPE, 1% SDS, 65°C) then subjected to autoradiography (Hyperfilm-MP, Amersham Life Sciences) at -70°C with intensifying screens.

In vitro phosphorylation of recombinant pp40/lasp-1. For in vitro phosphorylation of pp40/lasp-1, detergent-solublized cellular extracts were prepared by washing parietal cells (0.5-1 × 107) in extraction buffer (10 mM Tris · HCl, pH 7.4, 50 mM beta -glycerophosphate, 1 mM EDTA, 1 mM EGTA, 1 mM benzamidine, 1 mM DTT, and 10 µg/ml leupeptin/pepstatin) then incubating the cells in the same buffer plus 0.5% Triton X-100 for 10 min on ice. Cellular extracts were centrifuged (14,000 g, 10 min, 4°C), and Triton-soluble supernatants (25-50 µg protein/assay tube) were used to phosphorylate recombinant pp40/lasp-1 (2 µg) in a reaction mixture containing (final concentrations) 25 mM HEPES, pH 7.4, 10 mM Mg(C2H3O2)2, 0.3 mM DTT, 1 mM IBMX, 2 µM cAMP, and 0.1 mM [gamma -32P]ATP (sp act 30,000-36,000 cpm/pmol). Standard phosphorylating conditions were 5 min and 30°C.

Similar in vitro phosphorylations were performed using native or recombinant PKA catalytic subunit (15 units/assay tube) except that cAMP and the phosphodiesterase inhibitor IBMX were omitted. Specificity of PKA-dependent phosphorylations were tested by inclusion of synthetic rabbit PKA inhibitory peptide (PKI, 0.6 µg/tube). In vitro phosphorylations were also performed with recombinant Ca2+/calmodulin-dependent protein (CAM kinase) II and recombinant protein kinase (PKC)-alpha in the same reaction mixture as for recombinant PKA except that 0.2 µM calmodulin and 1.5 mM CaCl2 were included in CAM kinase II assays and 10 µg phosphatidylserine, 2 µg 1,2-dioleoyl-sn-glycerol, and 0.1 mM CaCl2 were included in PKC-alpha assays.

Reactions were terminated and proteins resolved on SDS-PAGE gels (10% T, 2.66% C, acrylamide/PDA) as previously described (26). Phosphorylated pp40/lasp-1 was identified based on comigration of radiolabeled protein with the Coomassie blue-stained protein. 32P incorporation into pp40/lasp-1 was quantitated in dried gels with a Molecular Dynamics Phosphorimager. Gels were then subjected to autoradiography to produce higher quality image resolution for figures.

Chemicals. Collagenase (type II and Sigma blend), endoproteinase Glu-C (sequencing grade), histamine, forskolin, synthetic cAMP-dependent protein kinase inhibitor, leupeptin, pepstatin, benzamidine, phosphatidylserine, and 1,2-dioleoyl-sn-glycerol were from Sigma Chemical (St. Louis, MO). 32P-orthophosphate and [gamma -32P]ATP were from Du Pont-New England Nuclear (Wilmington, DE), and [alpha -32P]dCTP was from Amersham Life Sciences (Arlington Heights, IL). Recombinant CaM kinase II and PKA were from New England BioLabs (Beverly, MA), and recombinant PKC-alpha was from Pan Vera (Madison, WI). Native PKA catalytic subunit was from Promega (Madison, WI). Pronase and AEBSF were from Calbiochem-Novabiochem International (La Jolla, CA). RASE RNase and DPFF DNase I were from Worthington Biochemical (Freehold, NJ). Accudenz was from Accurate Chemical (Westbury, NY). Ampholines were from Pharmacia (Uppsala, Sweden). Duracryl was from Oxford Glycosystems (Bedford, MA). All other electrophoresis reagents were from Bio-Rad Laboratories (Hercules, CA).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

pp40 phosphorylation is increased upon activation of the cAMP signaling pathway. To demonstrate that histamine reproducibly increases the phosphorylation of pp40 in isolated parietal cells, 32P-labeled cells (>95% enriched) were incubated with histamine (10 µM, 15 min, 37°C) then lysed and subjected to analytical two-dimensional gel electrophoresis and autoradiography as described in MATERIALS AND METHODS. Figure 1 shows the autoradiographic localization of the histamine-responsive parietal cell phosphoprotein, pp40, on two-dimensional gels. As previously reported (7), pp40 migrates on such gels with an apparent Mr of 40,000 and an isoelectric point (pI) of ~6.2. Time course experiments have shown that histamine induces a rapid rise in pp40 phosphorylation that is detectable within 1 min and sustained for at least 30 min (Ref. 7 and C. S. Chew and C.-J. Zhou, unpublished observations). In the present study, similar results were obtained with the adenylyl cyclase activator forskolin (data not shown); however, forskolin, which stimulates a somewhat greater secretory response than histamine, also elicited a stronger pp40 phosphorylation response as compared with histamine [850 ± 58% above basal with maximal histamine stimulation (100 µM) vs. 1,132 ± 77% above basal with forskolin (10 µM); 10 min, 37°C, n = 5, P < 0.01].


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 1.   Histamine increases phosphorylation of a 40-kDa protein in gastric parietal cells. Cells were enriched to 98% purity, 32P labeled, and stimulated with histamine (10 µM, 5 min). Cellular extracts were resolved on analytical 2-dimensional gels, and labeled phosphoproteins were detected by autoradiography (see MATERIALS AND METHODS). Arrows in A (control) and B (histamine) indicate position of pp40 on autoradiographs. Acidic ends of gels are on left.

Cohn (11) reported that vasoactive intestinal polypeptide and cAMP analogs increase the phosphorylation of a protein with a similar molecular mass (37 kDa) and pI (6.3) in the colonic T84 cell line. To determine if this protein could be pp40, extracts of endogenously 32P-labeled T84 cells were analyzed on two-dimensional gels under the same conditions used to analyze parietal cell extracts. In these experiments, forskolin increased the phosphorylation of a protein that migrates in the same region on two-dimensional gels as the parietal cell phosphoprotein (data not shown). Thus it appears that pp40 and the T84 cell phosphoprotein are the same. However, additional experiments using an immunoprecipitating antibody directed against pp40, for example, are required to confirm this possibility.

pp40 is phosphorylated on serine residues after histamine stimulation. To establish that pp40 is phosphorylated in vivo by a serine/threonine kinase, 32P-labeled parietal cells were stimulated with histamine (100 µM, 5 min, 37°C), and whole cell extracts were subjected to preparative two-dimensional gel electrophoresis. Radiolabeled pp40 was localized by autoradiography. The specific location of phosphorylated pp40 was confirmed by comparing 32P-labeling patterns of extracts from histamine-stimulated cells with controls. Four clearly resolved radiolabeled pp40 spots were then marked using their respective autoradiographs as a guide, excised from the gels, and Cerenkov counted. Approximately 1,000 cpm of 32P-labeled pp40 was subjected to acid hydrolysis followed by high-voltage two-dimensional phosphoamino acid analysis. Figure 2 shows that only serine phosphorylation was detected under these conditions. Thus a serine-threonine kinase rather than a tyrosine kinase appears to regulate histamine and cAMP-stimulated pp40 phosphorylation in vivo. Moreover, it appears that only serine residues are phosphorylated in vivo after histamine stimulation.


View larger version (80K):
[in this window]
[in a new window]
 
Fig. 2.   Histamine stimulation of intact parietal cells increases phosphorylation of pp40 on serine residues. Parietal cells were metabolically labeled with 32P, stimulated with histamine (100 µM, 5 min), and extracted as in Fig. 1. Phosphorylated pp40 was collected from preparative 2-dimensional gels, hydrolyzed, and subjected to phosphoamino acid hydrolysis and autoradiography as described in MATERIALS AND METHODS. Circles indicate ninhydrin staining pattern of phosphoamino acid standards. As shown on figure, only serine residues were detectably labeled. P-Ser, phosphoserine; P-Thr, phosphothreonine; P-Tyr, phosphotyrosine.

Isolation and internal microsequencing of pp40. Preliminary sequencing attempts (not shown) indicated that pp40 is NH2-terminally blocked. Therefore, Cleveland V8 digestion was used to obtain internal peptide microsequencing information. The protein was first purified to apparent homogeneity using a combination of Triton X-100 extraction, Prep Cell fractionation, and preparative two-dimensional gel electrophoresis (see MATERIALS AND METHODS). Figure 3 depicts a typical preparative two-dimensional gel, and the corresponding autoradiograph, from which pp40 was finally isolated for V8 digestion. Initial V8 digests of small amounts of endogenously 32P-labeled pp40 isolated from a preparative two-dimensional gel without prior enrichment yielded a single major phosphorylated band of ~14 kDa (data not shown). A major peptide of similar size was obtained from a V8 digest of pp40 that was obtained by pooling Coomassie blue-stained spots from 25 preparative two-dimensional gels. NH2-terminal microsequencing of this 13.5- to 14-kDa peptide produced the unambiguous sequence, KSRMGPSGGEGAE, which was found, in a GenBank search, to be 92% homologous with a region within the putative protein product of the human and mouse lasp-1 genes (Fig. 4). No other significant homologies with other proteins or DNA sequences were detected. The Coomassie blue-stained spot migrating immediately to the right of pp40 that comigrated with the internal 32P-labeled pp40 "spike" on two-dimensional gels (Fig. 3) may be the unphosphorylated form of pp40 since this protein was not consistently resolved on preparative two-dimensional gels; however, this assumption has not yet been confirmed because this protein was not subjected to microsequencing.


View larger version (94K):
[in this window]
[in a new window]
 
Fig. 3.   Purification of pp40 to apparent homogeneity for internal microsequencing. Top: 1 of 25 Coomassie blue-stained 2-dimensional preparative gels from which pp40 was isolated. Bottom: autoradiograph of same gel. Before 2-dimensional gel electrophoresis, pp40 was enriched from parietal cell extracts using sequential Triton X-100 extractions followed by Prep Cell fractionation. A spike of endogenously radiolabeled protein from histamine-simulated parietal cells was added to Prep Cell fractions, and radiolabeled pp40 in these spikes was then used to localize Coomassie blue-stained pp40 (see MATERIALS AND METHODS). Circled region on gel shows location of another protein that was microsequenced as an internal control (see RESULTS and Fig. 4). Acidic (+) and basic (-) regions of first dimension isoelectric focusing gels are shown.


View larger version (100K):
[in this window]
[in a new window]
 
Fig. 4.   Molecular cloning of pp40. cDNA and deduced amino acid sequence of pp40 derived from PCR cloning. An additional 8 nt in 5'-untranslated region that were also sequenced (TCGGAACC) are not shown. Amino acid sequence from Cleveland V8 digest (Fig. 3) is indicated by bold lettering. Consensus sequences for protein kinases are indicated as follows: PKA, shaded boxes; PKC, underlined; casein kinase II, open boxes; tyrosine kinase, underlined italics. Location of sense primers (SP1, SP2) used for initial cloning is indicated by single arrows; location of anti-sense primer (ASP1) is delineated by double arrows.

A control V8 digest of a second Coomassie blue-stained protein that migrated on the basic side of pp40 (Fig. 3, circled region) was performed using protein collected from the same 25 preparative two-dimensional gels. Microsequence analysis of one of the digested peptides from this more basic protein yielded the sequence ASSNFKAADLQLQMT, which did not match any region of the predicted lasp-1 sequence and was not homologous with any mammalian protein in the GenBank; however, partial matches (40-46% homology) were found between this 15-amino acid peptide sequence and two other predicted protein sequences, the Caenorhabditis elegans T04C9.1 gene product (accession no. U80955) and a kinase-associated protein phosphatase in Arabindopsis thaliana (accession no. U09505).

Cloning of pp40 using rabbit mRNA as a template. The predicted sizes of the encoded proteins for the lasp-1 gene are 261 and 263 amino acids in human (35) and mouse (34), respectively. The strategy used for cloning the rabbit pp40 cDNA was to design nondegenerate, nested primers based on highly conserved regions between the human and mouse lasp-1 open reading frames using the knowledge that codon usage in the rabbit is the same as in the human.

Combinations of the primers SP1 and SP2, in conjunction with ASP1 (see MATERIALS AND NETHODS), yielded two PCR products from rabbit parietal cell cDNA that migrated within the predicted size range on agarose gels (250-350 bp, data not shown). These products were excised, gel isolated, and subjected to a second round of PCR under the same conditions. Sequencing of the PCR product from the combination of SP1 and ASP1 yielded the expected lasp-1 cDNA sequence (Fig. 4). The complete open reading frame plus the 3'-UTR and a small amount of the 5'-UTR of rabbit pp40 was then obtained using 3'-RACE (Fig. 4). The overall homology between the predicted rabbit pp40 and human lasp-1 amino acid sequences was 95.8% similarity, 93.5% identity (Fig. 5) and that between rabbit and mouse was 96.2% similarity, 93.9% identity (data not shown). Most importantly, the amino acid sequence obtained from V8 digests of the pp40 protein was identical to the deduced amino acid sequence from the cloned cDNA.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 5.   Amino acid sequence alignment of cloned rabbit pp40 and human lasp-1. Open box, LIM domain; dashed-line box and italics, SH2 domain binding motif; shaded box, SH3 domain.

As shown in Fig. 4, the rabbit protein contains phosphorylation site consensus sequences for PKA, PKC, casein kinase II, and tyrosine kinases. All three casein kinase II phosphorylation sites (residues 134-137, 216-219, and 224-227) and both tyrosine kinase phosphorylation sites (residues 45-52 and 144-152) are conserved between human and rabbit. However, although both the rabbit and human proteins contain three PKC phosphorylation sites, only two of the three are conserved (residues 15-17 and 34-36). Also, within the rabbit sequence, all three PKC sites contain threonine, rather than serine residues. Because only serine residues appear to be phosphorylated after stimulation with the secretory agonist histamine (Fig. 2), it is unlikely that these sites are involved in this response. Interestingly, there are two serine-containing consensus motifs for PKA within both the predicted rabbit and human protein sequence [RRDS at residues 143-146; and R(K)GFS at residues 96-99].

Figure 5 also shows that the cysteine-rich LIM domain (residues 5-44), the SH3 domain (residues 199-263), and the SH2 binding motif (residues 152-155) are highly conserved between rabbit and human (35). In addition to these different domains, binding motifs, and potential phosphorylation sites, there is a single amidation site at residues 205-208 that is also present in the human sequence but at residues 203-206 (35). The significance of this amidation site is presently unclear. Also present in the rabbit sequence, but not the human, are three potential myristoylation sites (residues 135-139, 200-205, and 253-258). Because these latter sites are not conserved, their significance is also uncertain.

Northern blot analyses of pp40 mRNA indicate that pp40 is widely distributed. High-stringency Northern blot analyses of total RNA extracted from various rabbit tissues detected a single message of 3.3 kb. This transcript was found to be expressed in mucosal tissues throughout the gastrointestinal tract as well as in heart, lung, liver, kidney, adrenal, and smooth and skeletal muscles (Fig. 6). Interestingly, as shown in Fig. 6, the level of expression appears to be highest in stomach, intestine, kidney, and lung, and on the basis of ethidium bromide staining patterns, the lowest level of expression in the surveyed tissues appears to be in skeletal muscle. In human tissue, a single 3.8-kb lasp-1 mRNA transcript has been detected in stomach, colon, liver, lung, skin, breast, and lymph node. High levels of this transcript were also detected in 40% of metastatic lymph nodes and 8% of primary breast cancers (35). The smaller size of the rabbit mRNA transcript as compared with the human is not unexpected based on the shorter length of the 3'-UTR in the rabbit sequence as compared with the human sequence (35).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6.   Northern blot analysis indicates that pp40 mRNA is expressed in gastric fundic mucosa as well as in a number of other tissues. Top: autoradiograph showing distribution of a 3.3-kb message in gastric fundus (lane 1), jejunum (lane 2), ileum (lane 3), colon (lane 4), liver (lane 5), spleen (lane 6), pancreas (lane 7), kidney (lane 8), adrenal, (lane 9), smooth muscle (lane 10), skeletal muscle (lane 11), heart (lane 12), and lung (lane 13). Although not clearly discernible in lanes 5 and 11, similarly sized 3.3-kb bands were detected in these lanes with longer exposure times (>= 48 h). Bottom: ethidium bromide staining of 18S ribosomal RNA for comparison of loading conditions. Approximately 20 µg total RNA were loaded per lane. After transfer, membranes were hybridized with a full-length 32P-labeled probe for pp40. In other experiments (not shown), a similar sized message was detected with mRNA isolated from highly enriched (95% purity) parietal and enriched (85%) chief cells, with a much stronger signal being detected in parietal cells under similar loading conditions.

Western blot analyses detect expression of the pp40 protein in gastrointestinal tract and brain. In initial experiments, a polyclonal antibody raised against recombinant pp40/lasp-1 (see MATERIALS AND METHODS) was used to determine whether or not the cloned pp40/lasp-1 protein was indeed the same protein as the in situ cAMP-responsive 40-kDa phosphoprotein. Extracts from control and forskolin-stimulated (10 µM, 10 min, 37°C), 32P-labeled parietal cells were subjected to preparative two-dimensional gel electrophoresis (800 µg protein/gel). After the transfer of proteins to nitrocellulose and subsequent autoradiography of control and forskolin-treated blots to localize pp40, blots from forskolin-treated extracts were probed with the pp40/lasp-1 antibody. Overlays of Western blots with autoradiographs demonstrated comigration of 32P-labeled pp40 with pp40/lasp-1 immunoreactivity as well as the expected stronger cross-reactivity associated with closely migrating spots immediately basic to the radiolabeled pp40 spot (data not shown). The same polyclonal antibody was then used to assess the distribution of pp40/lasp-1 in various tissues. Figure 7 demonstrates the presence of a similarly sized cross-reacting protein in all of the tissues examined. These data indicate reasonably good agreement between the level of mRNA and protein expression in the tissues examined (compare Figs. 6 and 7).


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 7.   Western blot analysis using a polyclonal antibody to recombinant pp40/lasp-1 indicates that pp40 protein is expressed throughout the gastrointestinal tract and brain. Parietal (lane 1, 95% enriched) and chief (lane 2, 85% enriched) cells and tissue extracts from ileum (lane 3), colon (lane 4), liver (lane 5), pancreas (lane 6), and brain (lane 7) were prepared and probed using enhanced chemiluminescence detection as described in MATERIALS AND METHODS. Approximately 50 µg of protein from each sample were loaded per lane.

Band shift analyses of pp40 in forskolin-stimulated parietal cells, pancreatic acini, and colonic crypts demonstrate that cAMP-dependent regulation is not parietal cell specific. Because Western blot analyses of pp40 immunoreactivity detected closely migrating doublets in some tissues (see Fig. 7), we sought to determine if 1) the higher molecular weight species might represent the regulated, and presumably phosphorylated, form of this protein and 2) if pp40 present in cell types other than parietal cells were similarly regulated. Isolated parietal cells, distal colonic crypts, and pancreatic cell clusters were incubated with vehicle (0.1% DMSO) or forskolin (10 µM) for 15 min after an initial temperature equilibration period (30 min, 37°C). After rapid fixation (MATERIALS AND METHODS), whole cell extracts were subjected to Western blot analysis using the polyclonal pp40 antibody. The data depicted in Fig. 8 demonstrate that forskolin stimulation in all three cell types leads to a dramatic increase in the amount of the second, higher molecular weight band. Because it is generally accepted that increased protein phosphorylation can generate such a band shift on SDS-PAGE gels and because a similar band shift was apparent when recombinant pp40/lasp-1 was phosphorylated in vitro with PKA (see Fig. 9), this apparent shift in molecular weight strongly suggests that elevation of cAMP in all of these cell types results in increased phosphorylation of pp40. The combined data also provide additional evidence that the cloned pp40/lasp-1 protein is the same cAMP-responsive phosphoprotein that was originally identified (7). This conclusion is further supported by other data (data not shown) from Cleveland V8 digests of 32P-labeled PKA phosphorylated recombinant protein and in vivo 32P-labeled pp40 from forskolin-stimulated parietal cells. In these experiments, a major phosphorylated peptide with a molecular mass of ~13.5-14 kDa was detected in digests of both the recombinant (PKA phosphorylated) and native proteins (isolated from forskolin-stimulated parietal cells).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8.   Forskolin stimulation of isolated parietal cells, distal colonic crypts, and pancreatic cells leads to appearance of a higher molecular weight band of immunoreactive pp40/lasp-1. Cells were isolated, preequilibrated, and incubated with forskolin (10 µM) or vehicle (0.1% DMSO) for 15 min at 37°C. Cellular extracts (7.5-15 µg protein) were then subjected to enhanced chemiluminescence-based Western blot analysis using pp40/lasp-1 polyclonal antibody. Parietal cell extracts (15 µg, lanes 1 and 2), colonic crypt extracts (7.5 µg, lanes 3 and 4), pancreatic cell extracts (15 µg, lanes 5 and 6), and recombinant His-tagged pp40/lasp-1 standards (2.5, 5, and 10 ng, respectively, lanes 7-9) are shown. Same exposure time was used for lanes 1-4 and for recombinant protein standards. Because signal from pancreatic extracts was relatively weak, a longer film exposure time was used for lanes 5 and 6.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 9.   Comparison of phosphorylating activity of cAMP-dependent protein kinase (PKA) vs. protein kinase C (PKC) and Ca2+/calmodulin protein kinase (CAM kinase) II and inhibitory effects of PKA inhibitory peptide (PKI) using recombinant pp40/lasp-1 as a substrate. A: autoradiograph. Lane 1, CAM kinase II; lane 2, CAM kinase II + PKI; lane 3, PKC; lane 4, PKC + PKI; lane 5, PKA; lane 6, PKA + PKI. B: corresponding Coomassie blue-stained gel showing position of recombinant pp40/lasp-1 protein. Mr standards are to left of lane 1. Note Mr shift (arrows) of phosphorylated pp40/lasp-1 protein (lane 5) vs. nonphosphorylated or weakly phosphorylated forms (lanes 1-4 and 6). Assay tubes contained 2 µg recombinant pp40/lasp-1 plus same activity units (15 U) of each enzyme tested plus appropriate activators and with and without PKI inhibitor (0.6 µg) as described in MATERIALS AND METHODS. Similar results were obtained in 5 separate experiments. Unchanging higher Mr band in lanes 7 and 8 is most likely recombinant PKA protein, since this band alone was detected in absence of added pp40/lasp-1 protein (data not shown).

Based on the signal obtained with recombinant pp40/lasp-1 protein standards (Fig. 8), estimated levels of endogenous pp40/lasp-1 protein (expressed as percent of total cellular protein) were as follows: parietal cells, 0.08%; colonic cells, 0.1%; pancreatic acini, 0.02%. The apparent lower level of pp40/lasp-1 expression in isolated pancreatic cells as compared with rapidly fixed pancreatic tissue (compare results in Figs. 7 and 8) may reflect either some degree of proteolytic degradation in the isolated cells or a difference in the specific cell types sampled under the two conditions.

Recombinant pp40/lasp-1 protein is phosphorylated in vitro by PKA. Although present and previous data (7) clearly demonstrate that elevation of cAMP in vivo leads to increased phosphorylation of pp40/lasp-1, the protein kinase responsible for pp40 lasp-1 phosphorylation could be either PKA itself or some other serine/threonine protein kinase downstream of PKA. As a first step in defining which of these events might occur in vivo, we sought to determine if the recombinant pp40/lasp-1 protein can serve as a direct substrate for PKA in vitro. For comparative purposes, the ability of two other serine/threonine kinases, PKC and CAM kinase II, to phosphorylate this protein was compared with PKA in the same experiments. Data depicted in Fig. 9 demonstrate that recombinant pp40/lasp-1 protein is an excellent in vitro substrate for the catalytic subunit of PKA but not for similar catalytic amounts (15 U) of recombinant PKC-alpha or recombinant CAM kinase II. Furthermore, only PKA-dependent phosphorylation is inhibited by PKI. Phosphoimager-based quantitation of similar phosphorylation data from three independent experiments and expressing these data as the percent of PKA-dependent phosphorylation yielded the following results: PKA, 100%; PKA + PKI, 0.8 ± 1%; PKC, 11 ± 6%; PKC + PKI, 10 ± 5%; CAM kinase II, 0.2 ± 1%; CAM kinase II + PKI, 0.2 ± 0.1%.

Results in Fig. 10 further demonstrate that the recombinant pp40/lasp-1 protein is phosphorylated in vitro, in a cAMP-dependent manner, by parietal cell extracts, and this cAMP-dependent phosphorylation is also potently inhibited by PKI. In contrast, basal, cAMP-independent phosphorylation of parietal cell proteins by other protein kinases present in the extracts is not inhibited by PKI. Overall, the data in Figs. 9 and 10 support the hypothesis that pp40/lasp-1 is a direct substrate for PKA in vivo; however, additional studies comparing specific in vivo and in vitro phosphorylation sites are required to prove unequivocally that this is indeed the case.


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 10.   cAMP-dependent phosphorylation of recombinant pp40/lasp-1 by parietal cell extracts. A: autoradiograph. B: corresponding Coomassie blue-stained gel. Lane 1, no additions; lane 2, PKI; lane 3, cAMP + IBMX; lane 4, cAMP + IBMX + PKI. Arrows indicate migratory position of pp40/lasp-1 as determined by comparing staining patterns of parietal cell extracts alone vs. extracts plus recombinant pp40/lasp-1 (data not shown). Note that although there is a significant amount of phosphorylation of endogenous parietal cell proteins in absence of cAMP, phosphorylation of these proteins is not inhibited by PKI, a specific inhibitor of PKA activity. Upon addition of cAMP plus the phosphodiesterase inhibitor IBMX, there is a distinct increase in phosphorylation of pp40/lasp-1 as well as several other proteins (with Mr values of ~186,000, 91,000, 55,000, 53,000, 34,000, 33,000, 28,000 and 27,000). Further addition of PKI potently inhibits phosphorylation of these proteins. See MATERIALS AND METHODS for experimental details.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Although protein phosphorylation is considered to be a major mechanism of integration for different signaling pathways within eukaryotic cells (10), only a few agonist-regulated phosphoproteins have thus far been identified in highly differentiated cells that perform specific secretory functions. Here, we describe the isolation, microsequencing, and cDNA cloning of one such protein that was initially identified as a 40-kDa, cAMP-regulated phosphoprotein in the gastric parietal cells (7). Because the cDNA sequence for pp40 shares 93.5% identity with the open reading frame of the human MLN50/lasp-1 gene, it seems reasonable to conclude that pp40 is the rabbit homolog of the putative human MLN50 gene product lasp-1. We further demonstrate that both pp40/lasp-1 mRNA and the expressed protein are widely distributed among a variety of different tissues. In addition, present results with several different cell types including T84, colonic, and pancreatic cells support the conclusion that cAMP-dependent regulation of the pp40/lasp-1 protein is not confined to the gastric parietal cell. Whether or not this protein is similarly regulated in all of the tissues and cell types in which it is expressed remains to be determined.

On the basis of the observations that pp40 phosphorylation is rapidly increased in intact parietal cells in response to the cAMP-dependent acid secretory agonist histamine (7) and, apparently, in T84 cells in response to vasoactive intestinal polypeptide (11), it is likely that pp40/lasp-1 is an early downstream effector within the cAMP signaling pathway in epithelial cells. Because the recombinant pp40/lasp-1 protein is an excellent in vitro substrate for PKA, which is a serine-threonine kinase, and because histamine-stimulated pp40 phosphorylation appears to occur exclusively on serine residues in vivo, we hypothesize that pp40/lasp-1 is a direct substrate for PKA in vivo. It should be emphasized, however, that the ultimate proof of this hypothesis will require the identification and detailed analyses of the specific serine residue(s) that are phosphorylated in vivo.

As a newly identified signaling protein, the specific function of pp40/lasp-1 within the cAMP pathway is unknown. However, the presence of this phosphoprotein in the same cellular membrane fraction into which the H+-K+-ATPase redistributes after stimulation with cAMP-dependent agonists (37) and the observations that both PKA activation and pp40/lasp-1 phosphorylation are sustained and temporally precede the acid secretory response (5, 7) suggest the intriguing possibility that pp40/lasp-1 may play either a direct or indirect role in regulating the agonist-induced activation and/or translocation of this H+ transporter. Because rabbit pp40/lasp-1 contains three different, highly conserved motifs (a LIM domain, an SH3 domain, and an SH2 domain binding motif), all of which have been associated with protein-protein interactions (1, 12, 17, 22, 27, 32, 33), there is a strong possibility that this protein interacts with other parietal cell proteins in a regulated fashion. Thus pp40/lasp-1 could be involved, for example, in regulating changes in cell morphology or in localizing ion pumps such as the H+-K+-ATPase and/or one or more ion channels or protein kinases to specific regions of the cell.

A number of precedents exist for such protein-protein interactions. For example, a Src tyrosine kinase has recently been shown to be associated with potassium channels in human myocardium through an SH3 domain (21), and a novel LIM domain-containing protein was recently found to associate with PKC in an isoform-specific manner (23). A number of noncatalytic proteins possessing SH3 and SH2 domains have been shown to serve as adapters, linking tyrosine kinases to specific target proteins (22, 27), and the SH3 domain of PLC-gamma appears to target this signaling protein to the actin cytoskeleton (2). Also, there are a number of examples in which the phosphorylation of tyrosine residues within SH2 domain binding motifs, such as that found in lasp-1, induces the binding of SH2 domain-containing proteins to these target residues (32).

In terms of possible effects on cellular morphology, a number of LIM domain-containing cytoskeletal proteins including, for example, zyxin, paxillin, myogenic LIM-only protein, cysteine-rich protein, and beta -cysteine-rich protein have been found to associate directly or indirectly with actin-containing filaments (1, 12, 29). Along these same lines, the cytoskeletal actin-membrane linker protein ezrin, which is abundant in parietal cells, is also phosphorylated in parietal cells upon activation of the cAMP signaling pathway (19, 38). Interestingly, ezrin possesses a proline-rich SH3 domain binding motif (residues 465-479 in the human sequence, accession no. P23714) and is enriched in the same crude membrane fraction as pp40/lasp-1 (37). Also, like pp40/lasp-1, ezrin is incompletely extracted from cells with Triton X-100 (7, 8). Ezrin phosphorylation has been suggested to be an important step in the membrane fusion-recruitment process that occurs during parietal cell activation (18). More recently, ezrin has been found to bind to the regulatory subunit of cAMP-dependent protein kinase (12). Other evidence further suggests that ezrin may interact preferentially with the beta -isoform of actin which, in contrast to the basolaterally distributed gamma -isoform, appears to be concentrated within apical parietal cell membranes (40). Because both ezrin and pp40/lasp-1 appear to be localized, at least partially, to the same intracellular compartment and to possess, respectively, an SH3 domain binding motif and an SH3 domain, it is possible that the functions of these two cAMP-dependent phosphoproteins are interdependent.

To our knowledge, this is the first report linking a regulated phosphoprotein possessing both an SH3 domain and an SH2 domain binding motif to the cAMP signaling pathway. In contrast, a significant effort has been directed toward defining the role of proteins possessing these motifs in the activation and regulation of signal transduction pathways involving tyrosine kinases, particularly those pathways that mediate the intracellular responses to growth factor and cytokine stimulation in actively proliferating cells (22, 27, 32). Because the gastric parietal cell is terminally differentiated, our findings suggest that proteins possessing such domains may also play important regulatory roles in other cellular activities. Moreover, because pp40/lasp-1 contains not only two PKA phosphorylation consensus motifs but also multiple potential phosphorylation sites for tyrosine kinases, casein kinase II, and protein kinase C, it is possible that this novel protein is also intricately regulated by cross talk among the different intracellular signaling pathways. Further work is clearly necessary to sort out these intriguing possibilities.

    ACKNOWLEDGEMENTS

We thank Dr. Jan Pohl at the Emory University Microsequencing Facility for outstanding assistance in the sequencing of the V8 digests of pp40 and other proteins. We also thank Dr. James Goldenring at the Medical College of Georgia for providing T84 cells.

    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants R37-DK-31900 (to C. S. Chew) and F32-DK-09447 (to J. Parente, Jr.).

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EBI Data Bank with accession number AF017438.

Present address of C.-J. Zhou: Dept. of Physiology, Morehouse School of Medicine, Atlanta, GA 30310.

Address for reprint requests: C. S. Chew, Institute of Molecular Medicine and Genetics, Saunders R&E Bldg., Rm. CB 2803, Medical College of Georgia, Augusta, GA 30912-3175.

Received 5 November 1997; accepted in final form 26 March 1998.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Arber, S., and P. Caroni. Specificity of single LIM motifs in targeting and LIM/LIM interactions in situ. Genes Dev. 10: 289-300, 1996[Abstract/Free Full Text].

2.   Bar-Sagi, D., D. Rotin, A. Batzer, V. Mandiyan, and J. Schlessinger. SH3 domains direct cellular localization of signaling molecules. Cell 74: 83-91, 1993[Medline].

3.   Boyle, W. J., P. van der Geer, and T. Hunter. Phosphopeptide mapping and phosphoamino acid analysis by two-dimensional separation on thin-layer cellulose plates. Methods Enzymol. 201: 110-149, 1991[Medline].

4.   Calhoun, B. C., and J. R. Goldenring. Two Rab proteins, vesicle-associated membrane protein (VAMP-2) and secretory carrier membrane proteins (SCAMPs), are present on immunoisolated parietal cell tubulovesicles. Biochem. J. 325: 559-564, 1997.

5.   Chew, C. S. Intracellular activation events for parietal cell hydrochloric acid secretion. In: Handbook of Physiology. The Gastrointestinal System. Salivary, Gastric, Pancreatic, and Hepatobiliary Secretion. Bethesda, MD: Am. Physiol. Soc., 1989, sect. 6, vol. III, chapt. 13, p. 255-266.

6.   Chew, C. S. cAMP technologies, functional correlates in gastric parietal cells. Methods Enzymol. 191: 640-661, 1990[Medline].

7.   Chew, C. S., and M. R. Brown. Histamine increases phosphorylation of 27- and 40-kDa parietal cell proteins. Am. J. Physiol. 253 (Gastrointest. Liver Physiol. 16): G823-G829, 1987[Abstract/Free Full Text].

8.   Chew, C. S., J. A. Parente, Jr., C. Zhou, and X. Chen. PKC activation increases ezrin phosphorylation in gastric parietal cells (Abstract). FASEB J. 11: A296, 1997.

9.   Cleveland, D. W., S. G. Fischer, M. W. Kirschner, and U. K. Laemmli. Peptide mapping by limited proteolysis in sodium dodecyl sulfate and analysis by gel electrophoresis. J. Biol. Chem. 252: 1102-1106, 1977[Abstract/Free Full Text].

10.   Cohen, P. Signal integration at the level of protein kinases, protein phosphatases and their substrates. Trends Biochem. Sci. 10: 408-413, 1992.

11.   Cohn, J. A. Vasoactive intestinal peptide stimulates protein phosphorylation in colonic epithelial cell line. Am. J. Physiol. 253 (Gastrointest. Liver Physiol. 16): G420-G424, 1987[Abstract/Free Full Text].

12.   Dawid, I. B., R. Toyama, and M. Taira. LIM domain proteins. C. R. Acad. Sci. 318: 295-306, 1995.

13.   Dransfield, D. T., A. J. Bradford, J. Smith, M. Martin, C. Roy, P. H. Mangeat, and J. R. Goldenring. Ezrin is a cyclic AMP-dependent protein kinase anchoring protein. EMBO J. 16: 35-43, 1997[Medline].

14.   Forte, J. G., and H. C. Lee. Gastric adenosine triphosphatases: a review of their possible role in HCl secretion. Gastroenterology 73: 921-926, 1977[Medline].

15.   Forte, J. G., and A. H. Soll. Cell biology of hydrochloric acid secretion. In: Handbook of Physiology. The Gastrointestinal System. Salivary, Gastric, Pancreatic, and Hepatobiliary Secretion. Bethesda, MD: Am. Physiol. Soc., 1989, sect. 6, vol. III, chapt. 11, p. 207-228.

16.   Forte, J. G., and X. Yao. The membrane-recruitment-and-recycling hypothesis of gastric HCl secretion. Trends Cell Biol. 6: 45-48, 1996.[Medline]

17.   Gill, G. N. The enigma of LIM domains. Structure 3: 1285-1289, 1995[Medline].

18.   Han, J. D., and C. S. Rubin. Regulation of cytoskeleton organization and paxillin dephosphorylation by cAMP. Studies on murine Y1 adrenal cells. J. Biol. Chem. 271: 29211-29215, 1996[Abstract/Free Full Text].

19.   Hanzel, D., H. Reggio, A. Bretscher, J. G. Forte, and P. Mangeat. The secretion-stimulated 80K phosphoprotein of parietal cells is ezrin, and has properties of a membrane cytoskeletal linker in the induced apical microvilli. EMBO J. 10: 2363-2373, 1991[Medline].

20.   Hersey, S. J., and G. Sachs. Gastric acid secretion. Physiol. Rev. 75: 155-189, 1995[Free Full Text].

21.   Holmes, T. C., D. A. Fadool, R. Ren, and I. B. Levitan. Association of Src tyrosine kinase with a human potassium channel mediated by SH3 domain. Science 274: 2089-2091, 1996[Abstract/Free Full Text].

22.   Koch, C. A., D. Anderson, M. F. Moran, C. Ellis, and T. Pawson. SH2 and SH3 domains: elements that control interactions of cytoplasmic signaling proteins. Science 252: 668-674, 1991[Abstract/Free Full Text].

23.   Kuroda, S., C. Tokunaga, Y. Kiyohara, O. Higuchi, H. Konishi, K. Mizuno, G. N. Gill, and U. Kikkawa. Protein-protein interaction of zinc finger LIM domains with protein kinase C. J. Biol. Chem. 271: 31029-31032, 1996[Abstract/Free Full Text].

24.   Lamb, N. J., A. Fernandez, M. A. Conti, R. Adelstein, D. B. Glass, W. J. Welch, and J. R. Feramisco. Regulation of actin microfilament integrity in living nonmuscle cells by the cAMP-dependent protein kinase and the myosin light chain kinase. J. Cell Biol. 106: 1955-1971, 1988[Abstract/Free Full Text].

25.   Nakamura, K., C. J. Zhou, J. Parente, and C. S. Chew. Parietal cell MAP kinases: multiple activation pathways. Am. J. Physiol. 271 (Gastrointest. Liver Physiol. 34): G640-G649, 1996[Abstract/Free Full Text].

26.   Parente, J. A., J. R. Goldenring, A. C. Petropoulos, U. Hellman, and C. S. Chew. Purification, cloning, and expression of a novel, endogenous, calcium-sensitive, 28-kDa phosphoprotein. J. Biol. Chem. 271: 20096-20101, 1996[Abstract/Free Full Text].

27.   Pawson, T. Protein modules and signalling networks. Nature 373: 573-580, 1995[Medline].

28.   Peng, X. R., X. Yao, D. C. Chow, J. G. Forte, and M. K. Bennett. Association of syntaxin 3 and vesicle-associated membrane protein (VAMP) with H+/K+-ATPase-containing tubulovesicles in gastric parietal cells. Mol. Biol. Cell 8: 399-407, 1997[Abstract].

29.   Sadler, I., A. W. Crawford, J. W. Michelsen, and M. C. Beckerle. Zyxin and cCRP: two interactive LIM domain proteins associated with the cytoskeleton. J. Cell Biol. 119: 1573-1587, 1992[Abstract/Free Full Text].

30.   Sambrook, J., E. F. Fritsch, and T. Maniatis. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989.

31.   Schimmer, B. P. Cyclic nucleotides in hormonal regulation of adrenocortical function. Adv. Cyclic Nucleotide Res. 13: 181-214, 1980[Medline].

32.   Schlessinger, J. SH2/SH3 signaling proteins. Curr. Opin. Genet. Dev. 4: 25-30, 1994[Medline].

33.   Schmeichel, K. L., and M. C. Beckerle. The LIM domain is a modular protein-binding interface. Cell 79: 211-219, 1994[Medline].

34.   Sparks, A. B., N. G. Hoffman, S. J. McConnell, D. M. Folkes, and B. K. Kay. Cloning of ligand targets: systematic isolation of SH3 domain-containing proteins. Nature Biotechnol. 14: 741-744, 1996.[Medline]

35.   Tomasetto, C., C. Moog-Lutz, C. H. Regnier, V. Schreiber, P. Basset, and M. C. Rio. Lasp-1 (MLN 50) defines a new LIM protein subfamily characterized by the association of LIM and SH3 domains. FEBS Lett. 373: 245-249, 1995[Medline].

36.   Tomasetto, C., C. Regnier, C. Moog-Lutz, M. G. Mattei, M. P. Chenard, R. Lidereau, P. Basset, and M. C. Rio. Identification of four novel human genes amplified and overexpressed in breast carcinoma and localized to the q11-q21.3 region of chromosome 17. Genomics 28: 367-736, 1995[Medline].

37.   Urushidani, T., and J. G. Forte. Stimulation-associated redistribution of H+-K+-ATPase activity in isolated gastric glands. Am. J. Physiol. 252 (Gastrointest. Liver Physiol. 15): G458-G465, 1987[Abstract/Free Full Text].

38.   Urushidani, T., D. K. Hanzel, and J. G. Forte. Protein phosphorylation associated with stimulation of rabbit gastric glands. Biochim. Biophys. Acta 930: 209-219, 1987[Medline].

39.   Urushidani, T., D. K. Hanzel, and J. G. Forte. Characterization of an 80-kDa phosphoprotein involved in parietal cell stimulation. Am. J. Physiol. 256 (Gastrointest. Liver Physiol. 19): G1070-G1081, 1989[Abstract/Free Full Text].

40.   Yao, X., C. Chaponnier, G. Gabbiani, and J. G. Forte. Polarized distribution of actin isoforms in gastric parietal cells. Mol. Biol. Cell 6: 541-557, 1995[Abstract].


Am J Physiol Cell Physiol 275(1):C56-C67
0002-9513/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
C. S. Chew, X. Chen, R. J. Bollag, C. Isales, K. H. Ding, and H. Zhang
Targeted disruption of the Lasp-1 gene is linked to increases in histamine-stimulated gastric HCl secretion
Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G37 - G44.
[Abstract]