Am J Physiol Cell Physiol Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 274: C1363-C1372, 1998;
0363-6143/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scheving, L. A.
Right arrow Articles by Cope, F. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scheving, L. A.
Right arrow Articles by Cope, F. O.
Vol. 274, Issue 5, C1363-C1372, May 1998

Dying enterocytes downregulate signaling pathways converging on Ras: rescue by protease inhibition

Lawrence A. Scheving1, Wen-Hui Jin1, Kang-Mei Chong1, Wendi Gardner1, and Frederick O. Cope2

1 Division of Gastroenterology and Nutrition, Department of Pediatrics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232; and 2 Neoprobe Corporation, Columbus, Ohio 43017

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Organ and cell cultures of the small intestine serve as excellent in vitro models for programmed cell death (PCD). Cells cultured in serum-free, minimal medium rapidly died, as evidenced by histological changes, internucleosomal DNA cleavage, and TdT-mediated dUTP nick end labeling. Cell death was pervasive, although nonepithelial cells within the fibrovascular villus core were spared. PCD did not require a functional p53 gene. Serine and cysteine protease inhibitors, but not FCS, suppressed it. Relative to structural and functional proteins, dying enterocytes rapidly downregulated Ras-convergent proteins, including epidermal growth factor receptor, Erb-B2, and the son of sevenless guanine nucleotide exchangers. Reductions in the steady-state levels of both protein and mRNA were observed. These reductions were prevented by a combination of death-defying serine and caspase inhibitors, indicating a requirement for the initiation of death. Thus, during catastrophic PCD, intestinal epithelial cells delete cell surface signaling pathways responsible for Ras activation.

epidermal growth factor receptor; son of sevenless guanine nucleotide exchangers; Erb-B2; caspases; serine proteases

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

THE REPEATING PATTERN of the mouse intestinal epithelium consists of a single ~3,000-cell villus encircled by 8-10 ~250-cell crypts. Villi project into the intestinal lumen, overlie a fibrovascular core, and consist of several interwoven epithelial cell bands. Each band of polarized cells originates deep within one of the surrounding crypts at a site anchoring monoclonal stem cells. Stem cell proliferation produces epithelial cells that migrate either up toward the villus or down to the base of the crypt. Upwardly migrating cells proliferate several times before reaching the base of the villus. At this position, they abruptly differentiate into the absorptive (70-80%), goblet (20%), or enterochromaffin (5%) cells. Downwardly migrating cells, which travel just one or two cell positions to the bottom of the crypts, differentiate into long-lived Paneth cells (18).

Absorptive enterocytes proliferate, migrate, and differentiate at an extraordinary rate, traveling from the crypt to the villus tip in 48-72 h. Yet the small intestine maintains a relatively constant mass, and it also has a remarkably low incidence of epithelial cancer. These properties are related to its ability to eliminate both senescent and genetically damaged cells through programmed cell death (PCD), which occurs in the villi as well as in the crypts. Villi exfoliate up to 30% of their cells daily, mainly at their distal tips. Crypts likewise eradicate cells, particularly when exposed to damaging chemicals or irradiation (28).

Although the morphological features of enterocyte death have been delineated, several factors have hindered the investigation of this process. The kinetics of apoptosis are rapid. Cell death occurs quickly, leaving few residual signs. Dying cells are either extruded into the intestinal lumen or phagocytized by neighboring cells. Thus, despite the high rate of intestinal PCD in vivo, apoptotic cells at any one time are few and elusive, making work in the intact animal model cumbersome and problematic. Moreover, the development of intestine-like cell culture lines to replace the in vivo model has had limited success. Several small intestinal cell lines were originally isolated from mixed cell cultures after collagenase disruption of intestinal tissue (6, 29). However, these cell lines differentiate poorly. Other cell culture lines have been derived from primary or metastatic colonic carcinomas. These lines, which revert to an immature developmental phenotype seen in the neonatal colon, resemble the small intestine in some aspects. For example, after long-term culture, they express modest amounts of specialized small intestinal proteins, such as sucrase-isomaltase. However, all intestinal or colonic cell lines were established under selective pressures to resist death and must lack or subvert some of the deadly signal transduction pathways that kill enterocytes in the first place.

Because primary intestinal cultures are difficult to establish (14), we hypothesized that the ex vivo culture of intestinal tissue in a chemically defined medium devoid of serum would synchronize PCD in enterocytes, permitting us to study this process. In this report, we show that intestinal cells separated from a freshly oxygenated blood supply undergo brisk, spontaneous, and massive cell death independent of p53 and serum. Yet broad protease inhibition attenuated apoptosis and prevented a death-mediated downregulation of the epidermal growth factor receptor (EGFR), Erb-B2, and the son of sevenless guanine nucleotide exchangers (Sos-1 and Sos-2). Directly or indirectly, proteases downregulate EGFR, Erb-B2, and Sos, disrupting vital signal transduction pathways between the cell surface and nucleus.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Organ and cell culture. We used B6D2F1 male mice (Harlan Sprague Dawley, Indianapolis, IN), except for p53 tumor suppressor gene-deficient studies in which c57BL/6TacfBr-[KO]p53 wild-type and homozygous mice (Taconic, Germantown, NY) were used. In each experiment, mice between 8 and 10 wk of age were killed between 0800 and 1100. The intestine was quickly excised and placed on a bed of ice, and the pieces were washed free of luminal contents with 0.9% NaCl. In some cases, mucosa was detached by gently scraping the everted intestine with a glass slide. Tissue pieces (2 cm long) or detached mucosa were then placed in preheated freshly prepared DMEM (GIBCO-BRL, Grand Island, NY) containing NaHCO3 and glucose (5.55 mM, pH 7.4). In some experiments, the DMEM was purchased in a predissolved liquid form supplemented with high D-glucose (25 mM), L-glutamine (4 mM), HEPES (25 mM), or FCS. Protease inhibitors were also added to the medium. Generally, the inhibitors (Boehringer Mannheim, Indianapolis, IN) included aprotinin (2 mg/ml), leupeptin (10 mg/ml), EDTA (2 mM), Pefabloc SC (1 mM), and phenylmethylsulfonyl fluoride (PMSF, 0.5 mM). In some experiments, we added the caspase inhibitor (caspases 1, 3, and 4) CBZ-Val-Ala-Asp-FMK (Z-VAD-FMK, Enzyme Systems Products, Livermore, CA) to a final concentration of 100 µM. Tissue was incubated as short-term cultures at 37°C.

Membrane preparation. Tissue was either snap frozen and stored at -75°C or immediately homogenized at 4°C in a buffer (10 mM Tris, 1 mM EGTA, 1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 200 µM Na3OVO4, and 50 µM Na2MO4) with a Tissue Tearor (Biospec Products) at setting 2 for 15 s. Sample tubes were kept on ice afterward. In some cases the homogenate was centrifuged at 18,000 g for 30 min, and the resultant pellet was resuspended in homogenization buffer. The homogenate and membrane pellet had final protein concentrations ranging between 1 and 6 mg/ml.

Evaluation of DNA integrity. DNA was prepared according to the manufacturer's instructions for the GNOME DNA Isolation Kit (BIO 101, La Jolla, CA). Homogenized tissue was successively treated with RNase and proteases and then "salted out." DNA was then ethanol precipitated during a 30-min incubation period by mixing it with 0.5 vol of 7.5 M ammonium acetate and 3 vol of 100% ethanol. Purified DNA was measured spectrophotometrically at A260/A280, and similar amounts of DNA were resolved on 10% Tris-borate-EDTA buffer acrylamide gels for 1 h at 100 V/h. Gels were stained with ethidium bromide (0.5 µg/ml for 30 min), placed on an ultraviolet transilluminator, and photographed.

Immunoblots. Antibodies included a sheep anti-human EGFR polyclonal antibody (1 µg/ml, Upstate Biotechnology, Lake Placid, NY), rabbit anti-mouse EGFR, Erb-B2, Sos-1 and Sos-2 COOH-terminal antibodies (0.1 µg/ml, Santa Cruz Biotechnology, Santa Cruz, CA), bovine DNase I (1 µg/ml, Upstate Biotechnology), transglutaminase type II (Upstate Biotechnology), amino-oligopeptidase (AOP; rabbit polyclonal antiserum; 1:1,000, courtesy of Dr. Gary M. Gray, Stanford University, CA), and anti-actin IgM monoclonal antibody (0.1 µg/ml, Oncogene Sciences, Cambridge, MA).

Membrane or homogenate samples were solubilized in Laemmli buffer by boiling for 5 min, separated by 7% SDS-PAGE, and transblotted to nitrocellulose at 100 V for 90 min at 4°C. Transfer efficiency was confirmed by use of prestained protein standards and Coomassie staining of the gel after electrophoresis. After the membrane was blocked with 5% defatted milk and 0.05% Tween 20, the immunoreactive proteins were exposed 90 min at room temperature to primary antibodies. An autoradiographic signal was generated by use of the enhanced chemiluminescence method as described by the manufacturer (Amersham), using the relevant donkey anti-rabbit or sheep peroxidase-linked IgG (1:2,000 dilution). In some preliminary experiments, parallel blots were analyzed with antiserum preincubated with the antigenic peptides (0.5 mg/ml) for 1 h at room temperature to assess specificity. Molecular masses were determined by analysis of the relative migration of the protein bands in relation to known standard proteins (myosin, 200 kDa; phosphorylase b, 97.4 kDa; BSA, 69 kDa; and ovalbumin, 46 kDa). Protein levels were quantified by laser densitometry (LKB Ultrascan Enhanced Laser Densitometer, courtesy of Dr. Fridolin Sulser of Vanderbilt University).

RNA and Northern blot analyses. RNA was isolated from intact intestinal pieces incubated at different times (0, 30, and 90 min) in the presence or absence of protease inhibitors. Total RNA was isolated with TriZol as directed by the manufacturer (BRL). Poly(A)+ mRNA was then isolated by adsorption to an oligo(dT)-cellulose column following the manufacturer's instructions (5'-3'). The eluted poly(A)+ RNA (5 µg/lane) was then subjected to 1.0% denaturing agarose gel electrophoresis in the presence of formamide and transferred to a positively charged nylon membrane. RNA blots were probed with PCR-amplified mouse Sos-1, Sos-2, and EGFR DNA sequences. PCR products were purified by gel purification. The primers were designed to amplify gene sequences located at the 3'-end. The primer sequences for Sos-1 were forward primer (GCAGCGTGTTCGATTCTGAC) and reverse primer (GGTACCCATTCAGATCACTG); the primer sequences for Sos-2 were forward primer (GTGATCAGCAGCATTGCTTCC) and reverse primer (AGCAGATTGTATTATAGGCCTC); and the primer sequences for EGFR were forward primer (AGTGCCTATCAAGTGGATGG) and reverse primer (ATGCTCCAATAAACTCACTGC). The cycle conditions for Sos-1 were 1 cycle of 94°C for 2 min, 30 cycles of 94, 55, and 72°C for 1 min each, and 1 cycle of 72°C for 10 min. The cycle conditions for Sos-2 and EGFR were 1 cycle of 94°C for 2 min, 30 cycles of 94, 57, and 72°C for 1 min each, and 1 cycle of 72°C for 10 min. The PCR products for Sos-1, Sos-2, and EGFR were 1.2, 0.629, and 1 kb, respectively, and confirmed by direct sequencing. Mouse brain cDNA was used as a template to amplify Sos-1 and Sos-2 fragments, and mouse liver cDNA was used as a template to amplify the EGFR fragment. Probes for mouse beta -actin DNA fragment and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) fragment (Ambion) were used as controls. All probes were labeled by the random-priming labeling method (Amersham). Northern hybridizations were carried out at 42°C using the hybridization buffer supplied in the Northern Max Kit (Ambion). The hybridized membranes were exposed to films from a few hours to a week.

TdT-mediated dUTP nick end-labeling method protocol. The TdT-mediated dUTP nick end-labeling (TUNEL) method was used for visualizing the 3'-OH ends of the DNA fragments as described previously (17) using the modified procedure (ApopTag In Situ Apoptosis Detection Kit). The sections were treated with methanol containing 0.3% H2O2 at room temperature for 20 min to inhibit endogenous peroxidase. They were then permeabilized by exposure to proteinase K (20 µg/ml) for 15 min at room temperature. After being rinsed in distilled water, they were exposed to TdT buffer [30 mM Trizma base (pH 7.2), 140 mM sodium cacodylate, and 1 mM cobalt chloride] for 5 min and then incubated at 37°C for 60 min in a moist chamber with 50 µl of the TdT buffer containing 8.3 U TdT and digoxigenin-dUTP. Anti-digoxigenin-peroxidase was used to detect end-labeled DNA. An enzyme substrate was prepared by adding 5 mg of diaminobenzidine tetrahydrochloride to 10 ml of PBS, followed by 32 µl of H2O2 (30%) before use. The reactions were stopped by rinsing the slides in tap water for 5 min. Some tissue sections were lightly counterstained with hematoxylin for 10 s. The slides were rinsed in tap water for 6 min. They were dehydrated, covered with Permount, and photographed.

Immunohistochemistry. Intestines were removed, washed with ice-cold saline, and then fixed in fresh 4% paraformaldehyde at 4°C for 4 h. Tissue pieces were then rinsed several times in 70% ethanol at 4°C, embedded in paraffin, and cut into 5-µm sections. Slides were deparaffinized by placing them first in xylene and then in a series of graded ethanol solutions. Sections were processed by the manufacturer's protocol (Vectastain Elite ABC Kit; Vector Laboratories, Burlingame, CA). Endogenous peroxidase activity was quenched by placing the slides in 0.3% H2O2 in methanol for 30 min. After the slides were blocked in a 3.0% goat serum solution for 1 h, the tissue sections were incubated with affinity purified Sos-2 antibodies in PBS for 90 min in a humidified chamber. Sections were exposed to primary antiserum blocked with the antigenic peptide (400 µg/ml overnight) or unblocked antibody. All signal was shown to be specific by this criterion. The sections were then washed, incubated with biotinylated secondary antibody, rinsed in PBS, and incubated with the Vectastain Elite ABC Reagent. The signal detection system was identical to that described for the TUNEL method above.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Intestinal organ cultures exhibit rapid DNA digestion independent of serum especially in distal intestine. To assess basal apoptosis in the normal small intestine, we initially prepared DNA from normal quick-frozen jejunal and ileal tissue and then analyzed its structure by acrylamide gel electrophoresis. DNA in apoptotic cells forms a ladderlike pattern on electrophoretic gels due to cleavage at internucleosomal sites. Although we expected to see some DNA laddering by ethidium bromide fluorescence, DNA from fresh or quick-frozen tissue migrated to a single high-molecular-mass position on acrylamide gels, suggesting that the method lacked sufficient sensitivity to identify basal apoptosis in normal tissue (data not shown). Yet when we prepared DNA from EDTA-dissociated enterocytes, we consistently saw DNA laddering in both villus and crypt fractions (data not shown). Moreover, when we incubated intact intestinal or colonic pieces in serum-free DMEM for 3 h at 37°C (Fig. 1), we saw DNA laddering again (3). Ladder formation was seen at both intestinal and colonic sites; however, DNA digestion varied at different sites, being greater in the distal small intestine (Fig. 1A). Indeed, in some gels, the proximal intestine showed little or no laddering at 3 h (Fig. 1A, lane on left). Because of the experimental advantages associated with having a rapid and well-synchronized death model, we used distal intestinal tissue in the subsequent work. Time-course experiments showed that DNA cleavage in this model occurred very rapidly (Fig. 1B), appearing as early as 1.5 h after the organ culture and peaking at 3 h.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 1.   Electrophoretic analyses of DNA integrity. A: regional differences in electrophoretic DNA migration pattern from 0- and 3-h organ cultures. Lane 2 contains DNA isolated from distal (D) intestine at 0 h. DNA from proximal (P) segment showed a similar high-molecular-mass species (data not shown). Lanes 1 and 3 contain DNA obtained from P (lane 1) and D (lane 3) segments of small intestine at 3 h. Note that DNA laddering is observed only in distal intestine for this particular experiment. In other experiments, some laddering was observed in proximal intestine at 3 h. B: time course of D culture DNA at 0 (lane 1), 0.5 (lane 2), 1.5 (lane 3), and 3 h (lane 4). C: acrylamide gel of DNA from tissue cultured for 3 h in presence of 0 (lane 3), 2.5 (lane 4), 5 (lane 5), 10 (lane 6), and 20% serum (lane 7). Zero time is in lane 2 beneath dash. Standard (St) is shown in lane 1. D: acrylamide gel of DNA prepared from normal control mice (lanes 1 and 2, 0 time; lanes 5-7, 3-h incubation) and p53 knockout (KO) mice (lanes 3 and 4, 0 time; lanes 8-10, 3-h organ culture). Each lane represents DNA from a single animal. E: acrylamide gel of DNA from 0 time (lanes 1-3), without protease inhibitor (PI-; lanes 4-6), and with protease inhibitor (PI+; lanes 7-9). Each lane displays DNA from a single animal. Note that DNA fragmentation in PI+ group is reduced compared with PI- group.

Apoptosis of intestinal organ cultures is serum and p53 independent. Serum starvation causes spontaneous cell death for some transformed cell lines. Growth factors can sometimes prevent the PCD associated with serum starvation (12). To find out whether serum growth factors prevented DNA cleavage in intestinal organ cultures, we added varying concentrations of serum to the explant medium. FCS (Fig. 1C) did not prevent DNA digestion. Indeed, low serum concentrations may have enhanced it (Fig. 1C).

p53 protein expression has been shown to be required for some models of apoptosis (9, 28). We evaluated the requirement for this protein by analyzing DNA integrity in 3-h explants prepared from control mice and their p53 gene knockout (KO) counterparts (Fig. 1D). The KO mice have a disrupted p53 gene and lack functional p53 protein. Cells from such mice have a greatly increased tendency to form tumors (11), and they are less likely to die in response to hypoxia (19). Whereas intestinal cells from p53 KO mice become highly resistant to PCD caused by the antimetabolite doxorubicin or by gamma -irradiation (9, 28), PCD was independent of p53 in our explant model. Explant cultures from p53 KO mice showed a susceptibility to PCD similar to that of normal control mice. Both displayed similar levels of internucleosomal cleavage after 3 h of organ culture (Fig. 1), and both showed similar levels of apoptosis judged by light-microscopic analysis (data not shown).

Effect of protease inhibition on DNA digestion. Serine and cysteine proteases play instrumental roles in some forms of apoptosis (25). To determine the requirement of proteases in our model, we added a combination of protease inhibitors to the medium, including aprotinin, leupeptin, EDTA, Pefabloc SC, and PMSF, and then analyzed DNA digestion by acrylamide electrophoresis in 3-h explants. The selected inhibitors allowed us to broadly inhibit the major protease families, including those belonging to the caspase family. Figure 1E shows that protease inhibition resulted in an ~80% reduction in DNA fragmentation. Preliminary analysis indicates that the serine protease inhibitor (PMSF) by itself partially inhibited DNA cleavage (data not shown).

In situ analysis of intestinal organ culture by histochemistry and TUNEL assay. Analysis of DNA structure suggested that our intestinal organ cultures underwent massive PCD. However, the intestine is a complex tissue made of many different cell types. To determine the overall condition of the cultured explants, we examined explant histology (Fig. 2). To better resolve the extent and location of PCD, we analyzed in situ DNA breakage by the TUNEL method (Fig. 3) (17).


View larger version (156K):
[in this window]
[in a new window]
 
Fig. 2.   Histology of intestine at 0 time (A) and after 3 h of organ culture in absence (B, D, and E) and presence (C, F, and G) of protease inhibitors. Note that normal intestinal morphology was better preserved in presence of inhibitors. D (PI-) and F (PI+) show villi, and E (PI-) and G (PI+) show crypts at higher magnifications.

The histological findings are shown in Fig. 2. In the absence of protease inhibitors (PI-), we observed severe distortion in the normal intestinal villus-crypt appearance (Fig. 2A) after 3 h of culture ex vivo (Fig. 2, B, D, and E). Villus epithelial cells detached from the surrounding crypts as well as from the underlying fibrovascular cores, producing oval islands of free-floating epithelial cells within the intestinal lumen (Fig. 2B). The crypts of such explants collapsed, forming tightly knit cellular units that remained attached to the underlying muscularis. In contrast, in the presence of protease inhibitors (PI+), explants had a coherent although exaggerated appearance. The villus epithelial monolayers from these cultures were larger, more often assumed a villus shape, retained an amorphous exudate in place of the fibrovascular core, and tended to be continuous with the underlying crypts (Fig. 2F). Persistent lymphocyte-villus epithelial interactions were noted. The crypts of the PI+ explants were also deeper and more cellular (Fig. 2G).

Although both crypt and villus epithelial cells maintained a polarized appearance, they displayed apoptotic morphology, featuring extensive nuclear and cell body shrinkage and nuclear fragmentation. We used the TUNEL method to end-label fragmented DNA in normal quick-fixed intestinal tissue (Fig. 3A) as well as in explant cultures (Fig. 3, B and C). Preliminary control experiments demonstrated that virtually all of the brown nuclear reaction product was specific (data not shown). Control tissue had minimal specific DNA labeling (Fig. 3A), except for occasional villus tip nuclei. The remaining nuclei were heavily stained with hematoxylin (blue nuclei). In contrast, explant cultures at 3 h revealed widespread DNA breakage of all major cell types, including villus and crypt epithelial cells (Fig. 3, B and C), villus fibrovascular core cells (Fig. 3B), and muscularis (data not shown). Villi showed a patchy sparing of fibrovascular cells within the lamina propria (Fig. 3B). TUNEL analysis confirmed increased DNA breakage in the PI- compared with the PI+ explants (data not shown).


View larger version (92K):
[in this window]
[in a new window]
 
Fig. 3.   TdT-mediated dUTP nick end-labeling (TUNEL) analysis of normal villus (A) and cultured intestine (B and C). Blue nuclei contain intact DNA stained by hematoxylin alone. Brown nuclei were end labeled by TUNEL. Note that only a few isolated nuclei at villus tip in vivo (A) are positive for DNA breakage by this method. In contrast, nuclear labeling in cultured intestine is strongly positive. Yet some cells within fibrovascular core and occasional enterocytes (B) are spared.

Protease inhibition preserves several key signaling molecules. Because protease inhibition reduced explant cell death and disintegration, we evaluated their influence on the steady-state levels and structure of several intestinal proteins, focusing on signaling pathways implicated in growth and apoptosis. We prepared homogenates from adjacent segments of intact intestinal tissue treated with (PI+) or without (PI-) protease inhibitors at 0-h (initial kill time) or 3-h culture time. We tested the broad protease inhibitors used in the original DNA fragmentation experiment. We initially analyzed the expression of EGFR, Sos-1, Sos-2, beta -actin, AOP, and transglutaminase. We selected the first three because of their importance in cell signaling, beta -actin as a general constitutive probe, AOP as a specific villus enterocyte marker, and transglutaminase as a potential apoptosis marker. Equal amounts of protein prepared from individual samples were subjected to immunoblot analysis with monospecific antibodies.

Differences in protein expression for PI+ and PI- groups were observed (Table 1). Protease inhibition increased the relative amounts of EGFR. Quantification of blots by laser densitometry indicated that EGFR levels after 3 h of PI- explant culture decreased by 35-40% compared with zero time and PI+ culture samples. Moreover, Sos-1 and Sos-2 showed even greater reductions in expression in the PI- group (data not shown). In contrast, beta -actin, a general constitutive probe, and AOP, an intestinal brush-border marker, remained at control levels. Transglutaminase was lower in cultured tissue but showed no differences between the PI+ and PI- groups.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Protein density of transglutaminase, actin, EGFR, and AOP as revealed by immunoblot scanning laser densitometry

To examine the time course of individual protein expression, we carried out immunoblots on homogenate protein prepared from intestinal mucosal scrapings cultured for 0, 0.5, 1.5, and 3 h under PI+ or PI- conditions (Fig. 4, A and B). Some minor changes in the expression markers were noted for transglutaminase under these conditions, which did not decrease in the PI+ or PI- mucosal scrapings (data not shown). However, consistent with previous results, mucosal EGFR, Sos-1, and Sos-2 decreased as early as 30 min after culture and continued to decline over the next 3 h.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 4.   Immunoblot analyses of signaling and constitutive proteins during programmed cell death. A: immunoblot analysis of son of sevenless guanine nucleotide exchangers (Sos-1 and Sos-2), epidermal growth factor receptor (EGFR), beta -actin, and amino-oligopeptidase (AOP) from intact intestinal pieces. Times refer to duration of cell culture (0, 0.5, 1.5, and 3 h). Zero times differ only in being exposed to either PI+ or PI- medium. Note that same beta -actin antibody gives a doublet for intestinal piece including muscularis (A) but a single band for detached mucosa (C and Fig. 7). B: kinetics of fractional changes between PI+ and PI- cultures for Sos-1, Sos-2, transglutaminase (TG), beta -actin, and AOP are shown here. Time-course blots were scanned by laser densitometry. Note that relative protein densities of Sos-1 and Sos-2 show a greater fractional change than other molecules when cultured in presence of protease inhibitors. C: immunoblot analysis of Sos-1, EGFR, Erb-B2, and beta -actin at 3 h from detached intestinal enterocytes cultured in presence of standard protease inhibitor mixture (+) with or without caspase inhibitor (Z-VAD-FMK; Z). In addition to showing an inhibitory effect of Z-VAD-FMK on reduction in Sos-1, EGFR, and Erb-B2, this shows that the changes observed for intact intestinal pieces (A) also were seen in villus mucosa separated from underlying muscularis (C). A single immunoreactive beta -actin isoform was seen in the detached cells (C) compared with the intact piece (A).

To determine whether caspases mediated the downregulation of EGFR and Sos-1, we examined the influence of Z-VAD-FMK, which is a specific inhibitor of caspases 1, 3, and 4. We also analyzed the expression of Erb-B2 (neu), a tyrosine kinase receptor that forms secondary dimers with EGFR, cross-phosphorylates it, and also signals through Ras. As shown in Fig. 4, the effects of general protease inhibitors (+) and Z-VAD-FMK (Z) on the different signaling molecules varied. For Sos-1, both Z-VAD-FMK (Z) and the general inhibitors (+) individually caused a marked decrease in Sos-1 downregulation and appeared to act synergistically so that Sos-1 expression at 3 h in the combined protease inhibitor and caspase culture (+/Z) showed no drop off from the zero time control (0). Z-VAD-FMK alone (Z) slightly inhibited EGFR degradation but, when added to the inhibitors (+/Z), did prevent EGFR downregulation further relative to the (+) group. Z-VAD-FMK alone (Z) had little effect on Erb-B2 but did increase this protein when added to the general inhibitors (+/Z) but not to the level observed at zero time (0; Fig. 4).

To further evaluate Sos-2 expression in situ, we carried out immunohistochemistry (Fig. 5). Preliminary experiments established that all of the immunoreactive signal generated by this antibody could be blocked by preadsorption of the affinity-purified antibody with the immunogenic peptide (data not shown). Although it is frequently stated that the Sos proteins are constitutively expressed, we observed that Sos-2 was highly concentrated in the villi but not the crypts of the normal mouse ileum (Fig. 5, A and B). Consistent with the immunoblotting results, the addition of protease inhibitors to the culture medium either upregulated or stabilized the expression of Sos-2 (compare Fig. 5C, PI+, with Fig. 5D, PI-). Protease inhibitors also altered the subcellular localization of Sos-2. In the PI- explants and 0-h tissue, Sos-2 had a diffuse cytoplasmic localization, except for some membrane staining in cells near the villus tip at 0 h. In contrast, in PI+ explants, we saw prominent staining of Sos-2 on both the basolateral and apical surface membranes (Fig. 5E).


View larger version (105K):
[in this window]
[in a new window]
 
Fig. 5.   Immunohistochemical localization of Sos-2 is shown in control intestine (A and B), PI+ culture (C and E), and PI- culture (D). Note accentuation of surface membrane localization in PI+ culture (E) and downregulation of Sos-2 in PI- culture (D).

Protease inhibition preserves mRNA expression for several key signaling molecules. To further define the expression of the above proteins, we analyzed the relative abundance of mRNA transcripts for EGFR, Sos-1, Sos-2, beta -actin, and GAPDH (Fig. 6). We prepared poly(A)+ RNA at 0, 30, and 90 min and then analyzed the expression of the various transcripts by Northern blot analysis, using assorted random-primed DNA probes described. We detected transcripts of 8.4 and 5.4 kb for Sos-1, 5.6 kb for Sos-2, 6.5 and 5.0 kb for EGFR, 1.4 kb for GAPDH, and 2.1 kb for beta -actin. GAPDH and beta -actin served as constitutively expressed internal controls. At 30 min in the PI- tissue, we found reductions for the Sos-1, Sos-2, EGFR, and GAPDH transcripts of ~30%. In contrast, beta -actin showed no change at 30 min. At 90 min, Sos-1, Sos-2, and EGFR decreased by 60, 60, and 70%, respectively. In contrast, GAPDH and beta -actin decreased by only 30 and 20%, respectively. Protease inhibition was associated with a preservation of mRNA expression for all of the examined transcripts at 30 and 90 min, with the exception of EGFR, which decreased by 70% at 90 min.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 6.   Northern blot analysis of Sos-1, Sos-2, EGFR, GAPDH, and beta -actin. Poly(A)+ RNA (5 µg) was isolated and analyzed by Northern blot as described in MATERIALS AND METHODS. Lines to left indicate specific transcripts reported in text. Sos-1 and Sos-2 are notably decreased at 1.5 h in PI- culture, compared with PI+ culture.

Reduction in signaling molecules cannot be prevented by addition of a metabolic fuel. Finally, we considered the possibility that medium composition would alter cell death and the expression of EGFR, Erb-B2, or Sos-1. We were particularly interested in whether the previously observed downregulation was dependent on DMEM, HEPES, or changes in the kind or concentration of metabolic fuels. The results of this experiment are shown in Fig. 7. We compared Hanks' balanced salt solution with DMEM, buffering the latter with or without HEPES (25 mM) because the media of the initial experiments included the latter. We also added different metabolic fuels to DMEM, including low glucose (5.55 mM), high glucose (25 mM), glutamine (4 mM), or sodium butyrate (10 mM). We found that none of these changes prevented the downregulation of EGFR, Erb-B2, or Sos-1, although the addition of glutamine increased their expression by ~20%.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 7.   Failure of various metabolic fuels to reverse downregulation of Sos-1, EGFR, and Erb-B2. Intestinal cells were cultured for 3 h in either Hanks' balanced salt solution (HSS) or DMEM with or without glucose, glutamine, HEPES, and sodium butyrate, as indicated and defined in MATERIALS AND METHODS. Low-glucose, low-glutamine medium caused greatest reduction in Sos-1, EGFR, and Erb-B2 relative to actin. 0 h, 0 time.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The small intestine has a high rate of cell proliferation that is counterbalanced by an equally high rate of spontaneous PCD. Spontaneous PCD, which is increased in bcl-2 (22) and E-cadherin (20) transgenic animal KO models, has received little attention, despite its importance in preserving the hollow gut lumen. In contrast, intestinal cell death induced by irradiation, carcinogens, or antimetabolites has been examined in some detail (2, 34).

In this paper, we describe a simple, reproducible, and global model of spontaneous intestinal PCD. We show that enterocytes cultured in a minimal medium undergo catastrophic PCD, consistent with the known difficulty in establishing primary intestinal epithelial cultures (14). Compared with other organ culture systems, intestinal PCD ex vivo is rapid and extensive (Figs. 1 and 2). Breast and prostate cells undergo apoptosis in organ culture following the removal of steroid hormones (5). Intestinal cell lines undergo PCD after exposure to various chemical toxins, such as chemotherapeutic agents (10). However, death in these cases is slow, focal, and poorly synchronized. In contrast, cells from intestinal mucosa rapidly die in a synchronous manner similar to glucocorticoid-mediated thymocyte death. Apparently, cell cycle traverse, DNA synthesis, and appreciable transcription or translation are not required for spontaneous intestinal cell death ex vivo. In a related paper, Strater et al. (33) have recently shown that whole colonic crypts obtained from minute human biopsies also displayed rapid apoptosis. However, these crypts were first stripped of their basement membrane by exposure to collagenase. Our model does not require collagenase, generates multiple samples from a single mouse, and lends itself to several different experimental approaches, including transgenic and gene-disrupted animals.

Organ cultures prepared from different sites along the intestinal horizontal axis died at different rates, with distal intestinal cells showing the greatest propensity to death. Regional differences along the horizontal axis of the intestine are well recognized (18). For example, the cell mass per unit length as well as the height and depth of the villi and crypts vary along the length of the intestine. In the distal intestine, the cellularity is only 30-40% that of the proximal intestine. Pronounced longitudinal gradients of gene and protein expression have also been defined along the horizontal intestinal axis. Thus local luminal or transcriptional factors may regulate apoptosis in a differential fashion. Along this line, Altmann (1) showed that the surgical transposition of the pancreatic duct from the proximal to distal intestine caused the villi of the distal gut to hypertrophy and the villi of the proximal gut to atrophy. Moreover, the proximal gut atrophies during a prolonged fast to a much greater extent than the distal gut (21), suggesting the existence of distinctly different mechanisms of mass regulation at the two sites. Exposure of the gut to survival factors, which are present in the biliary or pancreatic juice and upregulated by feeding, may decrease the rate of PCD.

The mechanisms and series of events that cause apoptosis are becoming clearer. Degradation of nuclear DNA at internucleosomal sites occurs during the final stages of apoptosis, but it is not essential, since apoptosis occurs in enucleated cells (35). On the other hand, cell signaling involving Src homology 2 (SH-2) domains and proteolysis may respectively cue the "initiation" and "execution" phases of apoptosis (15). In Xenopus extracts, SH-2 fusion proteins and related synthetic peptides inhibited the initiation of PCD. In other work, recombinant caspase expression increased PCD (27), whereas protease inhibition prevented it (25, 31). This death-promoting action of caspases and other proteases is associated with the cleavage of specific proteins. The initiation and execution phases of PCD may be connected in that apoptotic proteases target specific protein substrates essential to signal transduction. For example, in one cell system, serine proteases attacked PITSLRE kinase, generating a truncated apoptosis-inducing isoform (26). Similarly, cysteine proteases belonging to the CED-3/ICE family cleave the MDM oncoprotein, which normally downregulates p53 (13). This upregulates p53 and leads to apoptosis in this system. We now show that the administration of serine and cysteine inhibitors not only prevented a downregulation of the cell surface regulators of the Ras effector system but also inhibited spontaneous PCD of cultured intestinal cells (Fig. 1E).

Because of the importance of SH-2 domains and proteases in apoptotic death, we examined the ability of antiapoptotic protease inhibitors to modulate the structure and expression of three molecules involved in enterocyte signal transduction, EGFR, Erb-B2, and Sos (Figs. 4-6). Although little is known about the expression of Erb-B2 and Sos (7) in the intestine, EGFR has been extensively studied at this site (32). Although perceived as growth regulators, EGFR, transforming growth factor-alpha (its major intestinal extracellular ligand), and Erb-B2 (an intracellular "ligand") are highly expressed in differentiated enterocytes. When phosphorylated, EGFR (through various SH-2 domain-bearing adaptor proteins such as Grb-2) recruits Sos molecules to the cell surface, which then activate Ras by converting Ras-GDP to Ras-GTP; Ras activation then leads to signal propagation through assorted pathways, including Raf and phosphatidylinositol 3-kinase (PI3K).

We found that EGFR, Erb-B2, Sos-1, and Sos-2 were abruptly downregulated compared with actin, AOP, and transglutaminase in enterocytes undergoing PCD. Notably, protease inhibition, which inhibited cell death, also prevented this downregulation, selectively increasing or stabilizing EGFR, Erb-B2, and Sos-2 expression. Whether caspase or serine proteases specifically cleave them or other proteins regulating their transcription requires further investigation. Although we did not consistently identify proteolytic cleavage fragments of these molecules in our experiments, we have identified several potential sites of caspase and granzyme B cleavage in Sos-1 and Sos-2 that require further study. Nevertheless, we did observe a specific reduction in the mRNA for these molecules, suggesting that the observed downregulation may have a pretranslational component.

The disappearance of EGFR, Erb-B2, Sos-1, and Sos-2 in apoptotic PI- organ cultures suggests that the inactivation of Ras promotes apoptosis in this model. Conversely, because Sos surface membrane localization is sufficient to activate Ras, the observed increased Sos-2 surface membrane localization in the PI+ survival cultures suggests Ras activation (6). Several lines of evidence support an antiapoptotic role for Ras. First, a Grb2 isoform, Grb3-3, which binds Sos but not EGFR, has been described (16). Overexpression of this isoform in vitro inhibits epidermal growth factor-induced transactivation of a ras-responsive element, inducing apoptosis in target cells. This same isoform is naturally expressed at high levels in the involuting thymus when sustained apoptosis occurs. Second, the overexpression of ras reportedly inhibits PCD. For example, a nontumorigenic line of rat intestinal epithelial cells (IEC-18) normally died within 48-72 h when cultured as multicellular spheroids on a nonadhesive surface (30). Yet mutant c-H-ras expression in these cells inhibited PCD. Indeed, in transplantable mouse solid tumors in vivo, an inverse relationship between mutant ras oncogene expression and PCD has been noted (2), including colonic adenocarcinomas (36). Finally, inducible oncogenic ras has been shown in interleukin-3-dependent hematopoeitic cells to upregulate "survival" proteins, bcl-2 and bcl-xl, suppressing PCD (24). Although we have not yet determined that Ras activation directly promotes the survival of intestinal epithelial cells through either PI3K or the Raf pathway, we note that in c-Myc-induced fibroblast apoptosis, ras can have either an antiapoptotic or a proapoptotic action depending on whether PI3K or Raf kinase pathways are respectively activated (23).

In summary, we have shown that the distal intestine of the mouse underwent rapid apoptosis in a minimal medium. This process requires endogenous proteases but not p53, luminal contents, or serum. Although death was widespread, striking histological changes occurred in the epithelial cells constituting both the mature and proliferative mucosal compartments. Nonepithelial cells within the lamina propria were more resistant to death. Protease inhibition reversed the downregulation observed in these cultures for several key signaling and antiapoptotic molecules, including the EGFR and Sos. This model provides a tool to further analyze the biochemical and molecular signaling components involved in intestinal cell death.

    ACKNOWLEDGEMENTS

This study was supported by Ross Products Division-Abbott Laboratories Grant BE-7 and by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-45925.

    FOOTNOTES

Address for reprint requests: L. A. Scheving, Div. of Gastroenterology and Nutrition, Dept. of Pediatrics, Vanderbilt University School of Medicine, 21st and Garland, Nashville, TN 37232-2576.

Received 24 November 1997; accepted in final form 30 January 1998.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Altmann, G. G. Influence of bile and pancreatic secretions on the size of the intestinal villi in the rat. Am. J. Anat. 132: 167-178, 1971[Medline].

2.   Arends, M. J., A. H. McGregor, N. J. Toft, E. J. H. Brown, and A. H. Wyllie. Susceptibility to apoptosis is differentially regulated by c-myc and mutated Ha-Ras oncogenes and is associated with endonuclease availability. Br. J. Cancer 68: 1127-1133, 1994.

3.   Arends, M. J., R. G. Morris, and A. H. Wyllie. Apoptosis: the role of endonuclease. Am. J. Pathol. 136: 593-608, 1990[Abstract].

4.   Aronheim, A., D. Engelberg, N. Li, N. Al-Alawi, J. Schlessinger, and M. Karin. Membrane targeting of the nucleotide exchange factor sos is sufficient for activating the ras signaling pathway. Cell 78: 949-961, 1994[Medline].

5.   Atwood, C. S., M. Ikeda, and B. K. Vonderhaar. Involution of mouse mammary glands in whole organ culture: a model for studying programmed cell death. Biochem. Biophys. Res. Commun. 207: 860-867, 1995[Medline].

6.   Blay, J., and K. D. Brown. Characterization of an epithelioid cell line derived from rat small intestine: demonstration of cytokeratin filaments. Cell Biol. Int. Rep. 8: 551-560, 1984[Medline].

7.   Bowtell, D., P. Fu, M. Simon, and P. Senior. Identification of murine homologues of the Drosophila son of sevenless gene: potential activators of ras. Proc. Natl. Acad. Sci. USA 89: 6511-6515, 1992[Abstract/Free Full Text].

8.   Bruno, S., G. Del Bino, P. Lassota, W. Giaretti, and Z. Darzynkiewicz. Inhibitors of proteases prevent endonucleolysis accompanying apoptotic death of HL-60 leukemic cells and normal thymocytes. Leukemia 6: 1113-1120, 1992[Medline].

9.   Clarke, A. R., S. Gledhill, M. L. Hooper, C. C. Bird, and A. H. Wyllie. p53 dependence of early apoptotic and proliferative responses within the mouse intestinal epithelium following gamma -irradiation. Oncogene 9: 1767-1773, 1994[Medline].

10.   Desjardins, L. M., and J. P. MacManus. An adherent cell model to study different stages of apoptosis. Exp. Cell Res. 216: 380-387, 1995[Medline].

11.   Donehower, L. A., M. Harvey, B. L. Slagle, M. J. McArthur, C. A. Montgomery, Jr., J. S. Butel, and A. Bradley. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356: 215-221, 1992[Medline].

12.   Duke, R. C., and J. J. Cohen. Withdrawal of growth factor activates a suicide program in dependent T cells. Lymph. Res. 5: 289-299, 1986[Medline].

13.   Erhardt, P., K. J. Tomaselli, and G. M. Cooper. Identification of the MDM2 oncoprotein as a substrate for CPP32-like apoptotic proteases. J. Biol. Chem. 272: 15049-15052, 1997[Abstract/Free Full Text].

14.   Evans, G. S., N. Flint, A. S. Somers, B. Eyden, and C. S. Potten. The development of a method for the preparation of rat intestinal epithelial cell primary cultures. J. Cell Sci. 101: 219-231, 1992[Abstract/Free Full Text].

15.   Farschon, D. M., C. Couture, T. Mustelin, and D. D. Newmeyer. Temporal phases in apoptosis defined by the actions of Src homology 2 domains, ceramide, Bcl-2, interleukin-1 converting enzyme family proteases, and a dense membrane fraction. J. Cell Biol. 137: 1117-1125, 1997[Abstract/Free Full Text].

16.   Fath, I., F. Schweighoffer, I. Rey, M.-C. Multon, J. Boiziau, M. Duchesne, and B. Tocque. Cloning of a Grb2 isoform with apoptotic properties. Science 264: 971-974, 1994[Abstract/Free Full Text].

17.   Gavrieli, Y., Y. Sherman, and S. A. Ben-Sasson. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119: 493-496, 1992[Abstract/Free Full Text].

18.   Gordon, J. I., and M. L. Hermiston. Differentiation and self-renewal in the mouse gastrointestinal epithelium. Curr. Opin. Cell Biol. 6: 795-803, 1994[Medline].

19.   Graeber, T. G., C. Osmanian, T. Jacks, D. E. Housman, C. J. Kock, S. W. Lowe, and A. J. Giaccia. Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumors. Nature 379: 88-91, 1996[Medline].

20.   Hermiston, M. L., and J. I. Gordon. In vivo analysis of cadherin function in the mouse intestinal epithelium: essential roles in adhesion, maintenance of differentiation, and regulation of programmed cell death. J. Cell Biol. 129: 489-506, 1995[Abstract/Free Full Text].

21.   Holt, P. R., S. Wu, and K.-Y. Yeh. Ileal hyperplastic response to starvation in the rat. Am. J. Physiol. 251 (Gastrtointest. Liver Physiol. 14): G124-G131, 1986.

22.   Kamada, S., A. Shimono, Y. Shinto, T. Tsujimura, T. Takahashi, T. Noda, Y. Kitamura, H. Kondoh, and Y. Tsujimoto. bcl-2 deficiency in mice leads to pleiotropic abnormalities: accelerated lymphoid cell death in thymus and spleen, polycystic kidney, hair hypopigmentation and distorted small intestine. Cancer Res. 55: 354-359, 1995[Abstract/Free Full Text].

23.   Kauffmann-Zeh, A., P. Rodriguez-Viciana, E. Ulrich, C. Gilbert, P. Coffer, J. Downward, and G. Evan. Suppression of c-Myc-induced apoptosis by Ras signalling through PI(3)K and PKB. Nature 385: 544-548, 1997[Medline].

24.   Kinoshita, T., T. Yokota, K. Arai, and A. Miyajima. Regulation of Bcl-2 expression by oncogenic Ras protein in hematopoietic cells. Oncogene 10: 2207-2210, 1995[Medline].

25.   Kuida, K., J. A. Lippke, G. Ku, M. W. Harding, D. J. Livingston, M. S.-S. Su, and R. A. Flavell. Altered cytokine export and apoptosis in mice deficient in interleukin-1beta converting enzyme. Science 267: 2000-2003, 1995[Abstract/Free Full Text].

26.   Lahti, J. M., J. Xiang, L. S. Heath, D. Campana, and V. J. Kidd. PITSLRE protein kinase activity is associated with apoptosis. Mol. Cell. Biol. 15: 1-11, 1995[Abstract].

27.   Miura, M., H. Zhu, R. Rotello, E. A. Hartwieg, and J. Yuan. Induction of apoptosis in fibroblasts by IL-1beta -convering enzyme, a mammalian homolog of the C. elegans cell death gene ced-3. Cell 75: 653-660, 1993[Medline].

28.   Potten, C. S., A. Merritt, J. Hickman, P. Hall, and A. Faranda. Characterization of radiation-induced apoptosis in the small intestine and its biological implications. Int. J. Radiat. Biol. 65: 71-78, 1994[Medline].

29.   Quaroni, A., and R. J. May. Establishment and characterization of intestinal epithelial cell cultures. Methods Cell Biol. 21B: 403-427, 1980.

30.   Rak, J., Y. Mitsuhashi, V. Erdos, S.-N. Huang, J. Filmus, and R. S. Kerbel. Massive programmed cell death in intestinal epithelial cells induced by three-dimensional growth conditions: suppression by mutant c-H-ras oncogene expression. J. Cell Biol. 131: 1587-1598, 1995[Abstract/Free Full Text].

31.   Sarin, A., D. H. Adams, and P. A. Henkart. Protease inhibitors selectively block T cell receptor-triggered programmed cell death in a murine T cell hybridoma and activated peripheral T cells. J. Exp. Med. 278: 1693-1700, 1993.

32.   Scheving, L. A., R. A. Shiurba, T. D. Nguyen, and G. M. Gray. Epidermal growth factor of the intestinal enterocyte: localization to laterobasal but not brush border surface. J. Biol. Chem. 3: 1735-1741, 1989.

33.   Strater, J., U. Wedding, T. F. E. Barth, K. Koretz, C. Elsing, and P. Moller. Rapid onset of apoptosis in vitro follows disruption of beta 1-integrin/matrix interactions in human colonic crypt cells. Gastroenterology 110: 1776-1784, 1996[Medline].

34.   Thakkar, N. S., and C. S. Potten. Inhibition of doxorubicin-induced apoptosis in vivo by 2-deoxy-D-glucose. Cancer Res. 53: 2057-2060, 1993[Abstract/Free Full Text].

35.   Tomei, L. D., J. P. Shapiro, and F. O. Cope. Apoptosis in C3H/10T1/2 mouse embryonic cells: evidence for internucleosomal DNA modification in the absence of double stranded cleavage. Proc. Natl. Acad. Sci. USA 90: 853-857, 1993[Abstract/Free Full Text].

36.   Ward, R. L., A. V. Todd, F. Santiago, T. O'Connor, and N. J. Hawkins. Activation of the K-ras oncogene in colorectal neoplasms is associated with decreased apoptosis. Cancer 79: 1106-1113, 1997[Medline].


AJP Cell Physiol 274(5):C1363-C1372
0363-6143/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
F. Jimenez, S. Aiba-Masago, I. Al Hashimi, N. Vela-Roch, G. Fernandes, C.-K. Yeh, N. Talal, and H. Dang
Activated caspase 3 and cleaved poly(ADP-ribose)polymerase in salivary epithelium suggest a pathogenetic mechanism for Sjogren's syndrome
Rheumatology, March 1, 2002; 41(3): 338 - 342.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. M. Ray, M. J. Viar, Q. Yuan, and L. R. Johnson
Polyamine depletion delays apoptosis of rat intestinal epithelial cells
Am J Physiol Cell Physiol, March 1, 2000; 278(3): C480 - C489.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. A. Scheving, J. R. Thomas, and L. Zhang
Regulation of intestinal tyrosine phosphorylation and programmed cell death by peroxovanadate
Am J Physiol Cell Physiol, September 1, 1999; 277(3): C572 - C579.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
C. M. Coopersmith, D. O'Donnell, and J. I. Gordon
Bcl-2 inhibits ischemia-reperfusion-induced apoptosis in the intestinal epithelium of transgenic mice
Am J Physiol Gastrointest Liver Physiol, March 1, 1999; 276(3): G677 - G686.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scheving, L. A.
Right arrow Articles by Cope, F. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scheving, L. A.
Right arrow Articles by Cope, F. O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online