|
|
||||||||
1 Division of Gastroenterology and Nutrition, Department of Pediatrics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232; and 2 Neoprobe Corporation, Columbus, Ohio 43017
| |
ABSTRACT |
|---|
|
|
|---|
Organ and cell cultures of the small intestine serve as excellent in vitro models for programmed cell death (PCD). Cells cultured in serum-free, minimal medium rapidly died, as evidenced by histological changes, internucleosomal DNA cleavage, and TdT-mediated dUTP nick end labeling. Cell death was pervasive, although nonepithelial cells within the fibrovascular villus core were spared. PCD did not require a functional p53 gene. Serine and cysteine protease inhibitors, but not FCS, suppressed it. Relative to structural and functional proteins, dying enterocytes rapidly downregulated Ras-convergent proteins, including epidermal growth factor receptor, Erb-B2, and the son of sevenless guanine nucleotide exchangers. Reductions in the steady-state levels of both protein and mRNA were observed. These reductions were prevented by a combination of death-defying serine and caspase inhibitors, indicating a requirement for the initiation of death. Thus, during catastrophic PCD, intestinal epithelial cells delete cell surface signaling pathways responsible for Ras activation.
epidermal growth factor receptor; son of sevenless guanine nucleotide exchangers; Erb-B2; caspases; serine proteases
| |
INTRODUCTION |
|---|
|
|
|---|
THE REPEATING PATTERN of the mouse intestinal epithelium consists of a single ~3,000-cell villus encircled by 8-10 ~250-cell crypts. Villi project into the intestinal lumen, overlie a fibrovascular core, and consist of several interwoven epithelial cell bands. Each band of polarized cells originates deep within one of the surrounding crypts at a site anchoring monoclonal stem cells. Stem cell proliferation produces epithelial cells that migrate either up toward the villus or down to the base of the crypt. Upwardly migrating cells proliferate several times before reaching the base of the villus. At this position, they abruptly differentiate into the absorptive (70-80%), goblet (20%), or enterochromaffin (5%) cells. Downwardly migrating cells, which travel just one or two cell positions to the bottom of the crypts, differentiate into long-lived Paneth cells (18).
Absorptive enterocytes proliferate, migrate, and differentiate at an extraordinary rate, traveling from the crypt to the villus tip in 48-72 h. Yet the small intestine maintains a relatively constant mass, and it also has a remarkably low incidence of epithelial cancer. These properties are related to its ability to eliminate both senescent and genetically damaged cells through programmed cell death (PCD), which occurs in the villi as well as in the crypts. Villi exfoliate up to 30% of their cells daily, mainly at their distal tips. Crypts likewise eradicate cells, particularly when exposed to damaging chemicals or irradiation (28).
Although the morphological features of enterocyte death have been delineated, several factors have hindered the investigation of this process. The kinetics of apoptosis are rapid. Cell death occurs quickly, leaving few residual signs. Dying cells are either extruded into the intestinal lumen or phagocytized by neighboring cells. Thus, despite the high rate of intestinal PCD in vivo, apoptotic cells at any one time are few and elusive, making work in the intact animal model cumbersome and problematic. Moreover, the development of intestine-like cell culture lines to replace the in vivo model has had limited success. Several small intestinal cell lines were originally isolated from mixed cell cultures after collagenase disruption of intestinal tissue (6, 29). However, these cell lines differentiate poorly. Other cell culture lines have been derived from primary or metastatic colonic carcinomas. These lines, which revert to an immature developmental phenotype seen in the neonatal colon, resemble the small intestine in some aspects. For example, after long-term culture, they express modest amounts of specialized small intestinal proteins, such as sucrase-isomaltase. However, all intestinal or colonic cell lines were established under selective pressures to resist death and must lack or subvert some of the deadly signal transduction pathways that kill enterocytes in the first place.
Because primary intestinal cultures are difficult to establish (14), we hypothesized that the ex vivo culture of intestinal tissue in a chemically defined medium devoid of serum would synchronize PCD in enterocytes, permitting us to study this process. In this report, we show that intestinal cells separated from a freshly oxygenated blood supply undergo brisk, spontaneous, and massive cell death independent of p53 and serum. Yet broad protease inhibition attenuated apoptosis and prevented a death-mediated downregulation of the epidermal growth factor receptor (EGFR), Erb-B2, and the son of sevenless guanine nucleotide exchangers (Sos-1 and Sos-2). Directly or indirectly, proteases downregulate EGFR, Erb-B2, and Sos, disrupting vital signal transduction pathways between the cell surface and nucleus.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Organ and cell culture. We used B6D2F1 male mice (Harlan Sprague Dawley, Indianapolis, IN), except for p53 tumor suppressor gene-deficient studies in which c57BL/6TacfBr-[KO]p53 wild-type and homozygous mice (Taconic, Germantown, NY) were used. In each experiment, mice between 8 and 10 wk of age were killed between 0800 and 1100. The intestine was quickly excised and placed on a bed of ice, and the pieces were washed free of luminal contents with 0.9% NaCl. In some cases, mucosa was detached by gently scraping the everted intestine with a glass slide. Tissue pieces (2 cm long) or detached mucosa were then placed in preheated freshly prepared DMEM (GIBCO-BRL, Grand Island, NY) containing NaHCO3 and glucose (5.55 mM, pH 7.4). In some experiments, the DMEM was purchased in a predissolved liquid form supplemented with high D-glucose (25 mM), L-glutamine (4 mM), HEPES (25 mM), or FCS. Protease inhibitors were also added to the medium. Generally, the inhibitors (Boehringer Mannheim, Indianapolis, IN) included aprotinin (2 mg/ml), leupeptin (10 mg/ml), EDTA (2 mM), Pefabloc SC (1 mM), and phenylmethylsulfonyl fluoride (PMSF, 0.5 mM). In some experiments, we added the caspase inhibitor (caspases 1, 3, and 4) CBZ-Val-Ala-Asp-FMK (Z-VAD-FMK, Enzyme Systems Products, Livermore, CA) to a final concentration of 100 µM. Tissue was incubated as short-term cultures at 37°C.
Membrane preparation.
Tissue was either snap frozen and stored at
75°C or
immediately homogenized at 4°C in a buffer (10 mM Tris, 1 mM EGTA,
1 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 200 µM
Na3OVO4, and 50 µM
Na2MO4)
with a Tissue Tearor (Biospec Products) at setting 2 for 15 s.
Sample tubes were kept on ice afterward. In some cases the homogenate
was centrifuged at 18,000 g for 30 min, and the resultant pellet was resuspended in homogenization buffer.
The homogenate and membrane pellet had final protein concentrations ranging between 1 and 6 mg/ml.
Evaluation of DNA integrity. DNA was prepared according to the manufacturer's instructions for the GNOME DNA Isolation Kit (BIO 101, La Jolla, CA). Homogenized tissue was successively treated with RNase and proteases and then "salted out." DNA was then ethanol precipitated during a 30-min incubation period by mixing it with 0.5 vol of 7.5 M ammonium acetate and 3 vol of 100% ethanol. Purified DNA was measured spectrophotometrically at A260/A280, and similar amounts of DNA were resolved on 10% Tris-borate-EDTA buffer acrylamide gels for 1 h at 100 V/h. Gels were stained with ethidium bromide (0.5 µg/ml for 30 min), placed on an ultraviolet transilluminator, and photographed.
Immunoblots. Antibodies included a sheep anti-human EGFR polyclonal antibody (1 µg/ml, Upstate Biotechnology, Lake Placid, NY), rabbit anti-mouse EGFR, Erb-B2, Sos-1 and Sos-2 COOH-terminal antibodies (0.1 µg/ml, Santa Cruz Biotechnology, Santa Cruz, CA), bovine DNase I (1 µg/ml, Upstate Biotechnology), transglutaminase type II (Upstate Biotechnology), amino-oligopeptidase (AOP; rabbit polyclonal antiserum; 1:1,000, courtesy of Dr. Gary M. Gray, Stanford University, CA), and anti-actin IgM monoclonal antibody (0.1 µg/ml, Oncogene Sciences, Cambridge, MA).
Membrane or homogenate samples were solubilized in Laemmli buffer by boiling for 5 min, separated by 7% SDS-PAGE, and transblotted to nitrocellulose at 100 V for 90 min at 4°C. Transfer efficiency was confirmed by use of prestained protein standards and Coomassie staining of the gel after electrophoresis. After the membrane was blocked with 5% defatted milk and 0.05% Tween 20, the immunoreactive proteins were exposed 90 min at room temperature to primary antibodies. An autoradiographic signal was generated by use of the enhanced chemiluminescence method as described by the manufacturer (Amersham), using the relevant donkey anti-rabbit or sheep peroxidase-linked IgG (1:2,000 dilution). In some preliminary experiments, parallel blots were analyzed with antiserum preincubated with the antigenic peptides (0.5 mg/ml) for 1 h at room temperature to assess specificity. Molecular masses were determined by analysis of the relative migration of the protein bands in relation to known standard proteins (myosin, 200 kDa; phosphorylase b, 97.4 kDa; BSA, 69 kDa; and ovalbumin, 46 kDa). Protein levels were quantified by laser densitometry (LKB Ultrascan Enhanced Laser Densitometer, courtesy of Dr. Fridolin Sulser of Vanderbilt University).RNA and Northern blot analyses.
RNA was isolated from intact intestinal pieces incubated at different
times (0, 30, and 90 min) in the presence or absence of protease
inhibitors. Total RNA was isolated with TriZol as directed by the
manufacturer (BRL). Poly(A)+ mRNA
was then isolated by adsorption to an oligo(dT)-cellulose column
following the manufacturer's instructions (5'-3'). The eluted poly(A)+ RNA (5 µg/lane)
was then subjected to 1.0% denaturing agarose gel electrophoresis in
the presence of formamide and transferred to a positively charged nylon
membrane. RNA blots were probed with PCR-amplified mouse Sos-1, Sos-2,
and EGFR DNA sequences. PCR products were purified by gel purification.
The primers were designed to amplify gene sequences located at the
3'-end. The primer sequences for Sos-1 were forward primer
(GCAGCGTGTTCGATTCTGAC) and reverse primer (GGTACCCATTCAGATCACTG); the
primer sequences for Sos-2 were forward primer
(GTGATCAGCAGCATTGCTTCC) and reverse primer
(AGCAGATTGTATTATAGGCCTC); and the primer sequences for EGFR were
forward primer (AGTGCCTATCAAGTGGATGG) and reverse primer (ATGCTCCAATAAACTCACTGC). The cycle conditions for Sos-1 were 1 cycle of 94°C for 2 min, 30 cycles of 94, 55, and 72°C for 1 min each, and 1 cycle of 72°C for 10 min. The cycle conditions for Sos-2 and EGFR were 1 cycle of 94°C for 2 min, 30 cycles of 94, 57, and 72°C for 1 min each, and 1 cycle of 72°C for 10 min. The PCR products for Sos-1, Sos-2, and EGFR were 1.2, 0.629, and 1 kb,
respectively, and confirmed by direct sequencing. Mouse brain cDNA was
used as a template to amplify Sos-1 and Sos-2 fragments, and mouse
liver cDNA was used as a template to amplify the EGFR fragment. Probes
for mouse
-actin DNA fragment and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) fragment (Ambion) were used as controls. All
probes were labeled by the random-priming labeling method (Amersham).
Northern hybridizations were carried out at 42°C using the
hybridization buffer supplied in the Northern Max Kit (Ambion). The
hybridized membranes were exposed to films from a few hours to a week.
TdT-mediated dUTP nick end-labeling method protocol. The TdT-mediated dUTP nick end-labeling (TUNEL) method was used for visualizing the 3'-OH ends of the DNA fragments as described previously (17) using the modified procedure (ApopTag In Situ Apoptosis Detection Kit). The sections were treated with methanol containing 0.3% H2O2 at room temperature for 20 min to inhibit endogenous peroxidase. They were then permeabilized by exposure to proteinase K (20 µg/ml) for 15 min at room temperature. After being rinsed in distilled water, they were exposed to TdT buffer [30 mM Trizma base (pH 7.2), 140 mM sodium cacodylate, and 1 mM cobalt chloride] for 5 min and then incubated at 37°C for 60 min in a moist chamber with 50 µl of the TdT buffer containing 8.3 U TdT and digoxigenin-dUTP. Anti-digoxigenin-peroxidase was used to detect end-labeled DNA. An enzyme substrate was prepared by adding 5 mg of diaminobenzidine tetrahydrochloride to 10 ml of PBS, followed by 32 µl of H2O2 (30%) before use. The reactions were stopped by rinsing the slides in tap water for 5 min. Some tissue sections were lightly counterstained with hematoxylin for 10 s. The slides were rinsed in tap water for 6 min. They were dehydrated, covered with Permount, and photographed.
Immunohistochemistry. Intestines were removed, washed with ice-cold saline, and then fixed in fresh 4% paraformaldehyde at 4°C for 4 h. Tissue pieces were then rinsed several times in 70% ethanol at 4°C, embedded in paraffin, and cut into 5-µm sections. Slides were deparaffinized by placing them first in xylene and then in a series of graded ethanol solutions. Sections were processed by the manufacturer's protocol (Vectastain Elite ABC Kit; Vector Laboratories, Burlingame, CA). Endogenous peroxidase activity was quenched by placing the slides in 0.3% H2O2 in methanol for 30 min. After the slides were blocked in a 3.0% goat serum solution for 1 h, the tissue sections were incubated with affinity purified Sos-2 antibodies in PBS for 90 min in a humidified chamber. Sections were exposed to primary antiserum blocked with the antigenic peptide (400 µg/ml overnight) or unblocked antibody. All signal was shown to be specific by this criterion. The sections were then washed, incubated with biotinylated secondary antibody, rinsed in PBS, and incubated with the Vectastain Elite ABC Reagent. The signal detection system was identical to that described for the TUNEL method above.
| |
RESULTS |
|---|
|
|
|---|
Intestinal organ cultures exhibit rapid DNA digestion independent of serum especially in distal intestine. To assess basal apoptosis in the normal small intestine, we initially prepared DNA from normal quick-frozen jejunal and ileal tissue and then analyzed its structure by acrylamide gel electrophoresis. DNA in apoptotic cells forms a ladderlike pattern on electrophoretic gels due to cleavage at internucleosomal sites. Although we expected to see some DNA laddering by ethidium bromide fluorescence, DNA from fresh or quick-frozen tissue migrated to a single high-molecular-mass position on acrylamide gels, suggesting that the method lacked sufficient sensitivity to identify basal apoptosis in normal tissue (data not shown). Yet when we prepared DNA from EDTA-dissociated enterocytes, we consistently saw DNA laddering in both villus and crypt fractions (data not shown). Moreover, when we incubated intact intestinal or colonic pieces in serum-free DMEM for 3 h at 37°C (Fig. 1), we saw DNA laddering again (3). Ladder formation was seen at both intestinal and colonic sites; however, DNA digestion varied at different sites, being greater in the distal small intestine (Fig. 1A). Indeed, in some gels, the proximal intestine showed little or no laddering at 3 h (Fig. 1A, lane on left). Because of the experimental advantages associated with having a rapid and well-synchronized death model, we used distal intestinal tissue in the subsequent work. Time-course experiments showed that DNA cleavage in this model occurred very rapidly (Fig. 1B), appearing as early as 1.5 h after the organ culture and peaking at 3 h.
|
Apoptosis of intestinal organ cultures is serum and p53 independent. Serum starvation causes spontaneous cell death for some transformed cell lines. Growth factors can sometimes prevent the PCD associated with serum starvation (12). To find out whether serum growth factors prevented DNA cleavage in intestinal organ cultures, we added varying concentrations of serum to the explant medium. FCS (Fig. 1C) did not prevent DNA digestion. Indeed, low serum concentrations may have enhanced it (Fig. 1C).
p53 protein expression has been shown to be required for some models of apoptosis (9, 28). We evaluated the requirement for this protein by analyzing DNA integrity in 3-h explants prepared from control mice and their p53 gene knockout (KO) counterparts (Fig. 1D). The KO mice have a disrupted p53 gene and lack functional p53 protein. Cells from such mice have a greatly increased tendency to form tumors (11), and they are less likely to die in response to hypoxia (19). Whereas intestinal cells from p53 KO mice become highly resistant to PCD caused by the antimetabolite doxorubicin or by
-irradiation (9, 28), PCD was
independent of p53 in our explant model. Explant cultures from p53 KO
mice showed a susceptibility to PCD similar to that of normal control
mice. Both displayed similar levels of internucleosomal cleavage after 3 h of organ culture (Fig. 1), and both showed similar levels of
apoptosis judged by light-microscopic analysis (data not shown).
Effect of protease inhibition on DNA digestion. Serine and cysteine proteases play instrumental roles in some forms of apoptosis (25). To determine the requirement of proteases in our model, we added a combination of protease inhibitors to the medium, including aprotinin, leupeptin, EDTA, Pefabloc SC, and PMSF, and then analyzed DNA digestion by acrylamide electrophoresis in 3-h explants. The selected inhibitors allowed us to broadly inhibit the major protease families, including those belonging to the caspase family. Figure 1E shows that protease inhibition resulted in an ~80% reduction in DNA fragmentation. Preliminary analysis indicates that the serine protease inhibitor (PMSF) by itself partially inhibited DNA cleavage (data not shown).
In situ analysis of intestinal organ culture by histochemistry and TUNEL assay. Analysis of DNA structure suggested that our intestinal organ cultures underwent massive PCD. However, the intestine is a complex tissue made of many different cell types. To determine the overall condition of the cultured explants, we examined explant histology (Fig. 2). To better resolve the extent and location of PCD, we analyzed in situ DNA breakage by the TUNEL method (Fig. 3) (17).
|
), we observed severe distortion in the
normal intestinal villus-crypt appearance (Fig.
2A) after 3 h of culture ex vivo
(Fig. 2, B,
D, and
E). Villus epithelial cells detached
from the surrounding crypts as well as from the underlying
fibrovascular cores, producing oval islands of free-floating epithelial
cells within the intestinal lumen (Fig.
2B). The crypts of such explants
collapsed, forming tightly knit cellular units that remained attached
to the underlying muscularis. In contrast, in the presence of protease
inhibitors (PI+), explants had a coherent although exaggerated
appearance. The villus epithelial monolayers from these cultures were
larger, more often assumed a villus shape, retained an amorphous
exudate in place of the fibrovascular core, and tended to be continuous
with the underlying crypts (Fig.
2F). Persistent lymphocyte-villus
epithelial interactions were noted. The crypts of the PI+ explants were
also deeper and more cellular (Fig.
2G).
Although both crypt and villus epithelial cells maintained a polarized
appearance, they displayed apoptotic morphology, featuring extensive
nuclear and cell body shrinkage and nuclear fragmentation. We used the
TUNEL method to end-label fragmented DNA in normal quick-fixed
intestinal tissue (Fig.
3A) as
well as in explant cultures (Fig. 3, B
and C). Preliminary control
experiments demonstrated that virtually all of the brown nuclear
reaction product was specific (data not shown). Control tissue had
minimal specific DNA labeling (Fig.
3A), except for occasional villus
tip nuclei. The remaining nuclei were heavily stained with hematoxylin
(blue nuclei). In contrast, explant cultures at 3 h revealed widespread
DNA breakage of all major cell types, including villus and crypt
epithelial cells (Fig. 3, B and
C), villus fibrovascular core cells
(Fig. 3B), and muscularis (data not
shown). Villi showed a patchy sparing of fibrovascular cells within the
lamina propria (Fig. 3B). TUNEL analysis confirmed increased DNA breakage in the PI
compared with the PI+ explants (data not shown).
|
Protease inhibition preserves several key signaling molecules.
Because protease inhibition reduced explant cell death and
disintegration, we evaluated their influence on the steady-state levels
and structure of several intestinal proteins, focusing on signaling
pathways implicated in growth and apoptosis. We prepared homogenates
from adjacent segments of intact intestinal tissue treated with (PI+)
or without (PI
) protease inhibitors at 0-h (initial kill time)
or 3-h culture time. We tested the broad protease inhibitors used in
the original DNA fragmentation experiment. We initially analyzed the
expression of EGFR, Sos-1, Sos-2,
-actin, AOP, and transglutaminase.
We selected the first three because of their importance in cell
signaling,
-actin as a general constitutive probe, AOP as a specific
villus enterocyte marker, and transglutaminase as a potential apoptosis
marker. Equal amounts of protein prepared from individual samples were
subjected to immunoblot analysis with monospecific antibodies.
groups were
observed (Table 1). Protease inhibition
increased the relative amounts of EGFR. Quantification of blots by
laser densitometry indicated that EGFR levels after 3 h of PI
explant culture decreased by 35-40% compared with zero time and
PI+ culture samples. Moreover, Sos-1 and Sos-2 showed even greater
reductions in expression in the PI
group (data not shown). In
contrast,
-actin, a general constitutive probe, and AOP, an
intestinal brush-border marker, remained at control levels.
Transglutaminase was lower in cultured tissue but showed no differences
between the PI+ and PI
groups.
|
conditions (Fig. 4,
A and
B). Some minor changes in the
expression markers were noted for transglutaminase under these
conditions, which did not decrease in the PI+ or PI
mucosal scrapings (data not shown). However, consistent with previous results,
mucosal EGFR, Sos-1, and Sos-2 decreased as early as 30 min after
culture and continued to decline over the next 3 h.
|
). Protease inhibitors also altered the subcellular localization of Sos-2. In the PI
explants and 0-h tissue, Sos-2 had a diffuse cytoplasmic localization, except for some membrane staining in cells near the villus tip at 0 h.
In contrast, in PI+ explants, we saw prominent staining of Sos-2 on
both the basolateral and apical surface membranes (Fig.
5E).
|
Protease inhibition preserves mRNA expression for several key
signaling molecules.
To further define the expression of the above proteins, we analyzed the
relative abundance of mRNA transcripts for EGFR, Sos-1, Sos-2,
-actin, and GAPDH (Fig. 6). We prepared
poly(A)+ RNA at 0, 30, and 90 min
and then analyzed the expression of the various transcripts by Northern
blot analysis, using assorted random-primed DNA probes described. We
detected transcripts of 8.4 and 5.4 kb for Sos-1, 5.6 kb for Sos-2, 6.5 and 5.0 kb for EGFR, 1.4 kb for GAPDH, and 2.1 kb for
-actin. GAPDH
and
-actin served as constitutively expressed internal controls. At
30 min in the PI
tissue, we found reductions for the Sos-1,
Sos-2, EGFR, and GAPDH transcripts of ~30%. In contrast,
-actin
showed no change at 30 min. At 90 min, Sos-1, Sos-2, and EGFR decreased by 60, 60, and 70%, respectively. In contrast, GAPDH and
-actin decreased by only 30 and 20%, respectively. Protease inhibition was
associated with a preservation of mRNA expression for all of the
examined transcripts at 30 and 90 min, with the exception of EGFR,
which decreased by 70% at 90 min.
|
Reduction in signaling molecules cannot be prevented by addition of a metabolic fuel. Finally, we considered the possibility that medium composition would alter cell death and the expression of EGFR, Erb-B2, or Sos-1. We were particularly interested in whether the previously observed downregulation was dependent on DMEM, HEPES, or changes in the kind or concentration of metabolic fuels. The results of this experiment are shown in Fig. 7. We compared Hanks' balanced salt solution with DMEM, buffering the latter with or without HEPES (25 mM) because the media of the initial experiments included the latter. We also added different metabolic fuels to DMEM, including low glucose (5.55 mM), high glucose (25 mM), glutamine (4 mM), or sodium butyrate (10 mM). We found that none of these changes prevented the downregulation of EGFR, Erb-B2, or Sos-1, although the addition of glutamine increased their expression by ~20%.
|
| |
DISCUSSION |
|---|
|
|
|---|
The small intestine has a high rate of cell proliferation that is counterbalanced by an equally high rate of spontaneous PCD. Spontaneous PCD, which is increased in bcl-2 (22) and E-cadherin (20) transgenic animal KO models, has received little attention, despite its importance in preserving the hollow gut lumen. In contrast, intestinal cell death induced by irradiation, carcinogens, or antimetabolites has been examined in some detail (2, 34).
In this paper, we describe a simple, reproducible, and global model of spontaneous intestinal PCD. We show that enterocytes cultured in a minimal medium undergo catastrophic PCD, consistent with the known difficulty in establishing primary intestinal epithelial cultures (14). Compared with other organ culture systems, intestinal PCD ex vivo is rapid and extensive (Figs. 1 and 2). Breast and prostate cells undergo apoptosis in organ culture following the removal of steroid hormones (5). Intestinal cell lines undergo PCD after exposure to various chemical toxins, such as chemotherapeutic agents (10). However, death in these cases is slow, focal, and poorly synchronized. In contrast, cells from intestinal mucosa rapidly die in a synchronous manner similar to glucocorticoid-mediated thymocyte death. Apparently, cell cycle traverse, DNA synthesis, and appreciable transcription or translation are not required for spontaneous intestinal cell death ex vivo. In a related paper, Strater et al. (33) have recently shown that whole colonic crypts obtained from minute human biopsies also displayed rapid apoptosis. However, these crypts were first stripped of their basement membrane by exposure to collagenase. Our model does not require collagenase, generates multiple samples from a single mouse, and lends itself to several different experimental approaches, including transgenic and gene-disrupted animals.
Organ cultures prepared from different sites along the intestinal horizontal axis died at different rates, with distal intestinal cells showing the greatest propensity to death. Regional differences along the horizontal axis of the intestine are well recognized (18). For example, the cell mass per unit length as well as the height and depth of the villi and crypts vary along the length of the intestine. In the distal intestine, the cellularity is only 30-40% that of the proximal intestine. Pronounced longitudinal gradients of gene and protein expression have also been defined along the horizontal intestinal axis. Thus local luminal or transcriptional factors may regulate apoptosis in a differential fashion. Along this line, Altmann (1) showed that the surgical transposition of the pancreatic duct from the proximal to distal intestine caused the villi of the distal gut to hypertrophy and the villi of the proximal gut to atrophy. Moreover, the proximal gut atrophies during a prolonged fast to a much greater extent than the distal gut (21), suggesting the existence of distinctly different mechanisms of mass regulation at the two sites. Exposure of the gut to survival factors, which are present in the biliary or pancreatic juice and upregulated by feeding, may decrease the rate of PCD.
The mechanisms and series of events that cause apoptosis are becoming clearer. Degradation of nuclear DNA at internucleosomal sites occurs during the final stages of apoptosis, but it is not essential, since apoptosis occurs in enucleated cells (35). On the other hand, cell signaling involving Src homology 2 (SH-2) domains and proteolysis may respectively cue the "initiation" and "execution" phases of apoptosis (15). In Xenopus extracts, SH-2 fusion proteins and related synthetic peptides inhibited the initiation of PCD. In other work, recombinant caspase expression increased PCD (27), whereas protease inhibition prevented it (25, 31). This death-promoting action of caspases and other proteases is associated with the cleavage of specific proteins. The initiation and execution phases of PCD may be connected in that apoptotic proteases target specific protein substrates essential to signal transduction. For example, in one cell system, serine proteases attacked PITSLRE kinase, generating a truncated apoptosis-inducing isoform (26). Similarly, cysteine proteases belonging to the CED-3/ICE family cleave the MDM oncoprotein, which normally downregulates p53 (13). This upregulates p53 and leads to apoptosis in this system. We now show that the administration of serine and cysteine inhibitors not only prevented a downregulation of the cell surface regulators of the Ras effector system but also inhibited spontaneous PCD of cultured intestinal cells (Fig. 1E).
Because of the importance of SH-2 domains and proteases in apoptotic
death, we examined the ability of antiapoptotic protease inhibitors to
modulate the structure and expression of three molecules involved in
enterocyte signal transduction, EGFR, Erb-B2, and Sos (Figs. 4-6).
Although little is known about the expression of Erb-B2 and Sos (7) in
the intestine, EGFR has been extensively studied at this site (32).
Although perceived as growth regulators, EGFR, transforming growth
factor-
(its major intestinal extracellular ligand), and Erb-B2 (an
intracellular "ligand") are highly expressed in differentiated
enterocytes. When phosphorylated, EGFR (through various SH-2
domain-bearing adaptor proteins such as Grb-2) recruits Sos molecules
to the cell surface, which then activate Ras by converting Ras-GDP to
Ras-GTP; Ras activation then leads to signal propagation through
assorted pathways, including Raf and phosphatidylinositol 3-kinase
(PI3K).
We found that EGFR, Erb-B2, Sos-1, and Sos-2 were abruptly downregulated compared with actin, AOP, and transglutaminase in enterocytes undergoing PCD. Notably, protease inhibition, which inhibited cell death, also prevented this downregulation, selectively increasing or stabilizing EGFR, Erb-B2, and Sos-2 expression. Whether caspase or serine proteases specifically cleave them or other proteins regulating their transcription requires further investigation. Although we did not consistently identify proteolytic cleavage fragments of these molecules in our experiments, we have identified several potential sites of caspase and granzyme B cleavage in Sos-1 and Sos-2 that require further study. Nevertheless, we did observe a specific reduction in the mRNA for these molecules, suggesting that the observed downregulation may have a pretranslational component.
The disappearance of EGFR, Erb-B2, Sos-1, and Sos-2 in apoptotic
PI
organ cultures suggests that the inactivation of Ras promotes
apoptosis in this model. Conversely, because Sos surface membrane
localization is sufficient to activate Ras, the observed increased
Sos-2 surface membrane localization in the PI+ survival cultures
suggests Ras activation (6). Several lines of evidence support an
antiapoptotic role for Ras. First, a Grb2 isoform, Grb3-3, which
binds Sos but not EGFR, has been described (16). Overexpression of this
isoform in vitro inhibits epidermal growth factor-induced
transactivation of a ras-responsive
element, inducing apoptosis in target cells. This same isoform is
naturally expressed at high levels in the involuting thymus when
sustained apoptosis occurs. Second, the overexpression of
ras reportedly inhibits PCD. For
example, a nontumorigenic line of rat intestinal epithelial cells
(IEC-18) normally died within 48-72 h when cultured as
multicellular spheroids on a nonadhesive surface (30). Yet mutant
c-H-ras expression in these cells
inhibited PCD. Indeed, in transplantable mouse solid tumors in vivo, an
inverse relationship between mutant ras oncogene expression and PCD has
been noted (2), including colonic adenocarcinomas (36). Finally,
inducible oncogenic ras has been shown
in interleukin-3-dependent hematopoeitic cells to upregulate
"survival" proteins, bcl-2 and bcl-xl, suppressing PCD (24).
Although we have not yet determined that Ras activation directly
promotes the survival of intestinal epithelial cells through either
PI3K or the Raf pathway, we note that in c-Myc-induced fibroblast
apoptosis, ras can have either an
antiapoptotic or a proapoptotic action depending on whether PI3K or Raf
kinase pathways are respectively activated (23).
In summary, we have shown that the distal intestine of the mouse underwent rapid apoptosis in a minimal medium. This process requires endogenous proteases but not p53, luminal contents, or serum. Although death was widespread, striking histological changes occurred in the epithelial cells constituting both the mature and proliferative mucosal compartments. Nonepithelial cells within the lamina propria were more resistant to death. Protease inhibition reversed the downregulation observed in these cultures for several key signaling and antiapoptotic molecules, including the EGFR and Sos. This model provides a tool to further analyze the biochemical and molecular signaling components involved in intestinal cell death.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported by Ross Products Division-Abbott Laboratories Grant BE-7 and by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-45925.
| |
FOOTNOTES |
|---|
Address for reprint requests: L. A. Scheving, Div. of Gastroenterology and Nutrition, Dept. of Pediatrics, Vanderbilt University School of Medicine, 21st and Garland, Nashville, TN 37232-2576.
Received 24 November 1997; accepted in final form 30 January 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Altmann, G. G.
Influence of bile and pancreatic secretions on the size of the intestinal villi in the rat.
Am. J. Anat.
132:
167-178,
1971[Medline].
2.
Arends, M. J.,
A. H. McGregor,
N. J. Toft,
E. J. H. Brown,
and
A. H. Wyllie.
Susceptibility to apoptosis is differentially regulated by c-myc and mutated Ha-Ras oncogenes and is associated with endonuclease availability.
Br. J. Cancer
68:
1127-1133,
1994.
3.
Arends, M. J.,
R. G. Morris,
and
A. H. Wyllie.
Apoptosis: the role of endonuclease.
Am. J. Pathol.
136:
593-608,
1990[Abstract].
4.
Aronheim, A.,
D. Engelberg,
N. Li,
N. Al-Alawi,
J. Schlessinger,
and
M. Karin.
Membrane targeting of the nucleotide exchange factor sos is sufficient for activating the ras signaling pathway.
Cell
78:
949-961,
1994[Medline].
5.
Atwood, C. S.,
M. Ikeda,
and
B. K. Vonderhaar.
Involution of mouse mammary glands in whole organ culture: a model for studying programmed cell death.
Biochem. Biophys. Res. Commun.
207:
860-867,
1995[Medline].
6.
Blay, J.,
and
K. D. Brown.
Characterization of an epithelioid cell line derived from rat small intestine: demonstration of cytokeratin filaments.
Cell Biol. Int. Rep.
8:
551-560,
1984[Medline].
7.
Bowtell, D.,
P. Fu,
M. Simon,
and
P. Senior.
Identification of murine homologues of the Drosophila son of sevenless gene: potential activators of ras.
Proc. Natl. Acad. Sci. USA
89:
6511-6515,
1992
8.
Bruno, S.,
G. Del Bino,
P. Lassota,
W. Giaretti,
and
Z. Darzynkiewicz.
Inhibitors of proteases prevent endonucleolysis accompanying apoptotic death of HL-60 leukemic cells and normal thymocytes.
Leukemia
6:
1113-1120,
1992[Medline].
9.
Clarke, A. R.,
S. Gledhill,
M. L. Hooper,
C. C. Bird,
and
A. H. Wyllie.
p53 dependence of early apoptotic and proliferative responses within the mouse intestinal epithelium following
-irradiation.
Oncogene
9:
1767-1773,
1994[Medline].
10.
Desjardins, L. M.,
and
J. P. MacManus.
An adherent cell model to study different stages of apoptosis.
Exp. Cell Res.
216:
380-387,
1995[Medline].
11.
Donehower, L. A.,
M. Harvey,
B. L. Slagle,
M. J. McArthur,
C. A. Montgomery, Jr.,
J. S. Butel,
and
A. Bradley.
Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours.
Nature
356:
215-221,
1992[Medline].
12.
Duke, R. C.,
and
J. J. Cohen.
Withdrawal of growth factor activates a suicide program in dependent T cells.
Lymph. Res.
5:
289-299,
1986[Medline].
13.
Erhardt, P.,
K. J. Tomaselli,
and
G. M. Cooper.
Identification of the MDM2 oncoprotein as a substrate for CPP32-like apoptotic proteases.
J. Biol. Chem.
272:
15049-15052,
1997
14.
Evans, G. S.,
N. Flint,
A. S. Somers,
B. Eyden,
and
C. S. Potten.
The development of a method for the preparation of rat intestinal epithelial cell primary cultures.
J. Cell Sci.
101:
219-231,
1992
15.
Farschon, D. M.,
C. Couture,
T. Mustelin,
and
D. D. Newmeyer.
Temporal phases in apoptosis defined by the actions of Src homology 2 domains, ceramide, Bcl-2, interleukin-1 converting enzyme family proteases, and a dense membrane fraction.
J. Cell Biol.
137:
1117-1125,
1997
16.
Fath, I.,
F. Schweighoffer,
I. Rey,
M.-C. Multon,
J. Boiziau,
M. Duchesne,
and
B. Tocque.
Cloning of a Grb2 isoform with apoptotic properties.
Science
264:
971-974,
1994
17.
Gavrieli, Y.,
Y. Sherman,
and
S. A. Ben-Sasson.
Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation.
J. Cell Biol.
119:
493-496,
1992
18.
Gordon, J. I.,
and
M. L. Hermiston.
Differentiation and self-renewal in the mouse gastrointestinal epithelium.
Curr. Opin. Cell Biol.
6:
795-803,
1994[Medline].
19.
Graeber, T. G.,
C. Osmanian,
T. Jacks,
D. E. Housman,
C. J. Kock,
S. W. Lowe,
and
A. J. Giaccia.
Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumors.
Nature
379:
88-91,
1996[Medline].
20.
Hermiston, M. L.,
and
J. I. Gordon.
In vivo analysis of cadherin function in the mouse intestinal epithelium: essential roles in adhesion, maintenance of differentiation, and regulation of programmed cell death.
J. Cell Biol.
129:
489-506,
1995
21.
Holt, P. R.,
S. Wu,
and
K.-Y. Yeh.
Ileal hyperplastic response to starvation in the rat.
Am. J. Physiol.
251 (Gastrtointest. Liver Physiol. 14):
G124-G131,
1986.
22.
Kamada, S.,
A. Shimono,
Y. Shinto,
T. Tsujimura,
T. Takahashi,
T. Noda,
Y. Kitamura,
H. Kondoh,
and
Y. Tsujimoto.
bcl-2 deficiency in mice leads to pleiotropic abnormalities: accelerated lymphoid cell death in thymus and spleen, polycystic kidney, hair hypopigmentation and distorted small intestine.
Cancer Res.
55:
354-359,
1995
23.
Kauffmann-Zeh, A.,
P. Rodriguez-Viciana,
E. Ulrich,
C. Gilbert,
P. Coffer,
J. Downward,
and
G. Evan.
Suppression of c-Myc-induced apoptosis by Ras signalling through PI(3)K and PKB.
Nature
385:
544-548,
1997[Medline].
24.
Kinoshita, T.,
T. Yokota,
K. Arai,
and
A. Miyajima.
Regulation of Bcl-2 expression by oncogenic Ras protein in hematopoietic cells.
Oncogene
10:
2207-2210,
1995[Medline].
25.
Kuida, K.,
J. A. Lippke,
G. Ku,
M. W. Harding,
D. J. Livingston,
M. S.-S. Su,
and
R. A. Flavell.
Altered cytokine export and apoptosis in mice deficient in interleukin-1
converting enzyme.
Science
267:
2000-2003,
1995
26.
Lahti, J. M.,
J. Xiang,
L. S. Heath,
D. Campana,
and
V. J. Kidd.
PITSLRE protein kinase activity is associated with apoptosis.
Mol. Cell. Biol.
15:
1-11,
1995[Abstract].
27.
Miura, M.,
H. Zhu,
R. Rotello,
E. A. Hartwieg,
and
J. Yuan.
Induction of apoptosis in fibroblasts by IL-1
-convering enzyme, a mammalian homolog of the C. elegans cell death gene ced-3.
Cell
75:
653-660,
1993[Medline].
28.
Potten, C. S.,
A. Merritt,
J. Hickman,
P. Hall,
and
A. Faranda.
Characterization of radiation-induced apoptosis in the small intestine and its biological implications.
Int. J. Radiat. Biol.
65:
71-78,
1994[Medline].
29.
Quaroni, A.,
and
R. J. May.
Establishment and characterization of intestinal epithelial cell cultures.
Methods Cell Biol.
21B:
403-427,
1980.
30.
Rak, J.,
Y. Mitsuhashi,
V. Erdos,
S.-N. Huang,
J. Filmus,
and
R. S. Kerbel.
Massive programmed cell death in intestinal epithelial cells induced by three-dimensional growth conditions: suppression by mutant c-H-ras oncogene expression.
J. Cell Biol.
131:
1587-1598,
1995
31.
Sarin, A.,
D. H. Adams,
and
P. A. Henkart.
Protease inhibitors selectively block T cell receptor-triggered programmed cell death in a murine T cell hybridoma and activated peripheral T cells.
J. Exp. Med.
278:
1693-1700,
1993.
32.
Scheving, L. A.,
R. A. Shiurba,
T. D. Nguyen,
and
G. M. Gray.
Epidermal growth factor of the intestinal enterocyte: localization to laterobasal but not brush border surface.
J. Biol. Chem.
3:
1735-1741,
1989.
33.
Strater, J.,
U. Wedding,
T. F. E. Barth,
K. Koretz,
C. Elsing,
and
P. Moller.
Rapid onset of apoptosis in vitro follows disruption of
1-integrin/matrix interactions in human colonic crypt cells.
Gastroenterology
110:
1776-1784,
1996[Medline].
34.
Thakkar, N. S.,
and
C. S. Potten.
Inhibition of doxorubicin-induced apoptosis in vivo by 2-deoxy-D-glucose.
Cancer Res.
53:
2057-2060,
1993
35.
Tomei, L. D.,
J. P. Shapiro,
and
F. O. Cope.
Apoptosis in C3H/10T1/2 mouse embryonic cells: evidence for internucleosomal DNA modification in the absence of double stranded cleavage.
Proc. Natl. Acad. Sci. USA
90:
853-857,
1993
36.
Ward, R. L.,
A. V. Todd,
F. Santiago,
T. O'Connor,
and
N. J. Hawkins.
Activation of the K-ras oncogene in colorectal neoplasms is associated with decreased apoptosis.
Cancer
79:
1106-1113,
1997[Medline].
This article has been cited by other articles:
![]() |
F. Jimenez, S. Aiba-Masago, I. Al Hashimi, N. Vela-Roch, G. Fernandes, C.-K. Yeh, N. Talal, and H. Dang Activated caspase 3 and cleaved poly(ADP-ribose)polymerase in salivary epithelium suggest a pathogenetic mechanism for Sjogren's syndrome Rheumatology, March 1, 2002; 41(3): 338 - 342. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Ray, M. J. Viar, Q. Yuan, and L. R. Johnson Polyamine depletion delays apoptosis of rat intestinal epithelial cells Am J Physiol Cell Physiol, March 1, 2000; 278(3): C480 - C489. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Scheving, J. R. Thomas, and L. Zhang Regulation of intestinal tyrosine phosphorylation and programmed cell death by peroxovanadate Am J Physiol Cell Physiol, September 1, 1999; 277(3): C572 - C579. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Coopersmith, D. O'Donnell, and J. I. Gordon Bcl-2 inhibits ischemia-reperfusion-induced apoptosis in the intestinal epithelium of transgenic mice Am J Physiol Gastrointest Liver Physiol, March 1, 1999; 276(3): G677 - G686. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |