|
|
||||||||
Department of Biochemistry, Faculty of Medicine, University of Alberta, Edmonton, Alberta, Canada T6G 2H7
| |
ABSTRACT |
|---|
|
|
|---|
We examined factors important in regulation of expression of the Na+/H+ exchanger gene in NIH/3T3 cells. A stable fibroblast cell line was generated that contained a 1.1-kb proximal fragment of the mouse NHE1 promoter. The addition of serum to serum-starved cells resulted in an increase in activity of the NHE1 promoter. The mitogenic agonists insulin, thrombin, and epidermal growth factor also increased transcription from the NHE1 promoter. Phorbol esters also increased NHE1 promoter-directed transcription, whereas the serine/threonine protein kinase inhibitor 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine inhibited this stimulation. The protein kinase inhibitors GF-109203X, PD-98059, and genistein all stimulated promoter activity. Promoter deletion analysis and gel mobility shift assays showed that a region between 0.9 and 1.1 kb from the start site was involved in mediating the effect of mitogenic stimulation. The results show that a variety of mitogenic factors can activate the NHE1 promoter during cell growth and proliferation.
cell proliferation; cell growth; serum; phorbol esters
| |
INTRODUCTION |
|---|
|
|
|---|
THE SODIUM/HYDROGEN EXCHANGER is a mammalian plasma membrane glycoprotein that mediates the exchange of intracellular H+ for extracellular Na+ with a 1:1 stoichiometry. Several isoforms of the protein have been identified that are designated NHE1 to -5. The NHE1 isoform is present in all mammalian cells and has been described as the housekeeping isoform of the Na+/H+ exchanger family (13). It is involved in pH regulation (4) and control of cell volume (16) and is activated by growth factors (2, 32), phorbol esters, and protein kinase C (PKC) (3, 30).
The Na+/H+ exchanger is involved in cell proliferation and differentiation. During cell proliferation, it is responsible for an elevation of intracellular pH, which plays a permissive role in growth of some cell types (17). Recent evidence has suggested that mRNA levels of the exchanger are increased during cellular proliferation in intact tissues (12). Hyperplasia of vascular smooth muscle in culture has also been reported to cause up to 25-fold increases in the levels of NHE1 message (34). The role of the Na+/H+ antiporter in cellular differentiation remains more controversial. Rao et al. (35) examined the regulation of Na+/H+ exchanger gene expression and its role in retinoic acid-induced differentiation of HL-60 cells. Immediately before differentiation of HL-60 cells into granulocyte-like cells, the activity of the Na+/H+ exchanger increases and remains elevated well into differentiation (24, 35). There is an 18-fold increase in NHE1 mRNA levels as well as a 7-fold increase in protein levels (35). In addition, we have recently shown that the NHE1 promoter is activated during differentiation of P19 cells (10). These dramatic changes in Na+/H+ antiporter transcription suggest that Na+/H+ exchanger gene expression and differentiation are closely linked. However, it is not universally agreed that there is a causal link between increased antiporter activity and subsequent differentiation (1, 18, 38).
The mechanisms involved in long-term regulation of the Na+/H+ antiporter are only recently being studied. The recent cloning of the NHE1 genes has enabled more in-depth study of promoter activity (11, 22). The trans-acting nuclear protein AP-2 has been identified as a transcription factor that can regulate the NHE1 gene (11). In addition, phorbol esters and the transcription factor AP-1 (21, 29) have been implicated in regulation of the NHE1 gene. Glucose is also thought to act through PKC to increase NHE1 message levels in certain cell types (42). In this report, we characterize mitogenic factors required for induction of expression of the NHE1 gene. We investigate the role of several protein kinases in the regulation of the NHE1 gene and present evidence that demonstrates that stimulation of cell proliferation causes activation of the NHE1 promoter.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials. Restriction endonuclease and DNA-modifying enzymes were obtained from Boehringer Mannheim (Laval, Quebec, Canada) and Bethesda Research Laboratories (Gaithersburg, MD). The pBluescript plasmids were from Stratagene (La Jolla, CA). [3H]thymidine was purchased from ICN Biomedicals (Ontario, Canada). PD-98059 and GF-109203X were purchased from Calbiochem (La Jolla, CA). All other chemicals were of analytical or molecular biology grade and were purchased from Fisher Scientific (Ottawa, Ontario, Canada), Sigma (St. Louis, MO), or BDH (Toronto, Ontario, Canada).
Cell culture. NIH/3T3 cells were obtained from Dr. J. Stone of the Department of Biochemistry, University of Alberta. They were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Where indicated, serum was reduced to 0.5% and other components added as described.
Transfection and reporter assays.
For construction of stable cell lines, NIH/3T3 cells were transfected
using the calcium phosphate precipitation method as described earlier
(11). Stably transfected cells were made using pRSVneo plasmid (1 µg)
and pXP-1.1MP (20 µg). pXP-1.1MP was constructed as described earlier
(11). The 1.1-kb fragment contains base pairs
1085 to +22 of the
NHE1 promoter. After transformation, cells were incubated for 24 h
before being replated at a dilution of 1:10. After being replated, the
cells were treated with 400 µg/ml G418 for 14 days. G418-resistant
colonies were identified, and individual colonies were repropagated
until reaching a higher density. They were then assayed for luciferase
activity. Polymerase chain reaction (PCR) was used to confirm that the
entire mouse promoter region had been inserted. The primers amplified
from the 5'-end of luciferase to the 5'-end of the insert.
NIH/3T3 cells stably transfected with the plasmid pXP-1MP were used to study regulation of the NHE1 promoter. In some experiments, stable transfectants were made with the same 1.1-kb fragment of the NHE1 promoter linked to a chloramphenicol acetyltransferase (CAT) reporter. This plasmid (p1.1MPcat) was constructed by inserting the same Pst
I-Sma I fragment of the NHE1 promoter
into the Pst I site of the plasmid
pCATBasic (Promega) after blunting of all the
Pst I sticky ends. Activities of
reporter plasmids were calculated per microgram of protein and
normalized to control values wherever indicated.
-galactosidase as an internal control. NIH/3T3 cells
were transiently transfected using the CaPO4 precipitation technique as
described earlier (17). After 36 h, the cells were harvested, and the
cell lysate was assayed for luciferase activity and
-galactosidase
activity. For transient transfection, the plasmid pXP-1.1MP or
pXP-0.9MP was used. The plasmid pXP-0.9MP was constructed as described
earlier (45) and was the same as pXP-1.1MP except that it began at
nucleotide
808 of the mouse promoter.
For luciferase reporter assays, the medium was aspirated, and the cells
were washed in 1× phosphate-buffered saline (PBS) and 1 mM EDTA.
After the cells spent 5 min in 1 ml PBS-1 mM EDTA, the washing solution
was replaced with 150 µl ice-cold lysis buffer [0.1 M
tris(hydroxymethyl)aminomethane (Tris), pH 7.8, 0.5% Nonidet P-40, and 1 mM dithiothreitol (DTT)]. After 10-min
incubation on ice, cells were scraped, transferred to a microcentrifuge
tube, and pelleted at 14,000 revolutions/min (rpm) for 10 min. The
supernatant was removed and assayed for luciferase activity. Luciferase
assays contained 20 µl of the cell lysate and 100 µl of the
luciferase assay reagent (20 mM tricine, 1.07 mM magnesium carbonate,
2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT, 470 mM luciferin, 530 µM ATP, 270 µM coenzyme A, and 1 ng/ml bovine serum albumin). Luciferase activity was assayed with an
LKB luminometer and corrected for protein content. Results are reported
as means ± SE of at least 5 experiments; where not shown, SE was
too small to be displayed.
The
-galactosidase assay was by two methods. In the first method, 20 µl cell lysate were mixed with 80 µl
H2O and 20 µl
o-nitrophenyl-
-D-galactopyranoside. After 60 min at 37°C, 60 µl of 1 M
Na2CO3
was added to stop the reaction, and the optical density was measured at
a wavelength of 420 nm. The second method for
-galactosidase assay was by luminometry. Twenty microliters of cell
lysate were mixed with 100 µl of galacto reaction buffer (Tropix) and
incubated at room temperature for 60 min. Five seconds before
measurement, 100 µl of chemiluminescence accelerator (ClonTech) were
added.
Flow cytometry analysis. Cell cycle compartment analysis was done by flow cytometry with Hoechst 33342 staining. 1A7 cells were used at 70% confluence. Cells were incubated with 20 µM Hoechst 33342 for 1 h at 37°C. Flow cytometry was with an Epic Elite flow cytometer (Coulter Electronics) equipped with an Innova 90-5 argon laser for generation of the ultraviolet line at 353 nm (200 mW) and an air-cooled argon laser (15 mW). The signal from Hoechst was collected by a photomultiplier tube equipped with a 525/40 BP filter.
[3H]thymidine incorporation. 1A7 cells were incubated in 1 µCi/ml [3H]thymidine along with 0.5% serum and various agonists including 1 nM thrombin, 10 µg/ml insulin, 10 ng/ml epidermal growth factor (EGF), 10 µg/ml genistein, or 10 ng/ml EGF with 10 µg/ml genistein. After 24 h, the cells were washed in 1× PBS and scraped from the dishes. The suspension was then centrifuged for 30 s at 10,000 rpm to pellet the cells. After the harvest, the cells were resuspended in 0.3 N KOH. The DNA and protein were then precipitated with 0.9 N HCl/25% trichloroacetic acid solution. The precipitate was compressed at 14,000 rpm for 10 min, the solute was decanted, and the precipitate pellet was resuspended in 200 µl of 0.1 N KOH. Aliquots of 100 µl were taken and measured for DNA concentration or [3H]thymidine incorporation. The amount of incorporated [3H]thymidine was expressed as counts per minute per nanogram DNA.
RNA isolation and measurement of NHE1 mRNA levels by PCR. Total RNA was isolated from quiescent (0.5% serum) and actively proliferating (10% serum) NIH/3T3 cells (46). Poly (A)+ RNA was purified using Dynabeads as described by the manufacturer (Dynal). For reverse transcriptase PCR, poly (A)+ RNA was isolated as described above, and 1 µg was copied with reverse transcriptase from the Invitrogen cDNA cycle kit using the procedures described by the manufacturer. We used a competitive reverse transcriptase PCR assay to measure NHE1 mRNA levels essentially as we have described earlier (46). The assay is based on the use of a competitive substrate that competes with the reverse-transcribed cDNA. Primers for the Na+/H+ exchanger spanned an intron so that contamination by genomic DNA did not contribute any error. For NHE1, primers were mNHE1-1 (TTGAATTCCAAAGAGCCCCAG) and mNHE1-2 (CGGGATCCTTGTCCTTGGACAG). These primers were specific to the NHE1 isoform and were used to amplify a 180-bp product from reverse-transcribed cDNA. To a series of these amplification reactions, an increasing amount of competitive template was added. Increasing amounts of competitor result in decreasing amounts of DNA product. The Na+/H+ exchanger competitive template was produced by using a plasmid that contains the same sequence plus a DNA insert generating a slightly larger product from the PCR (404 bp). Conditions of the reaction plus mRNA quantification were as described earlier (46). Quantification of relative amounts of Na+/H+ exchanger PCR products was on 9% gels, and the incorporated radioactivity was quantified with a model BAS1000 phosphoimager (Fuji Photo Film). The log of the ratio of counts per minute in competitor-derived products to target-derived products was plotted vs. the log of the number of competitor template molecules. When the target-derived and competitor-derived products have the same number of incorporated counts, the target and competitor DNA templates were present at the same levels, corresponding to a logarithm equal to 0. Although no differences in amplification were noted between competitor and target cDNA, for the present series of experiments we only compared the relative amounts of cDNA in samples and not absolute amounts to the amount of competitor.
DNA binding assays.
Nuclear extracts were prepared from NIH/3T3 cells as reported by
Schreiber et al. (36). Initial experiments used a DNA fragment of the
promoter prepared by amplification of 5'-region contained in the
plasmid pXP1.1MP and not present in pXP0.9MP. The synthetic oligonucleotides of the sequence 5'-CAA AGT GAG TTC TAG ACC AGG C-3' (MP286PCR) and 5'-GCA TTC TAG TTG TGG TTT GTC
C-3' (5'-pXP-1) were made. Together, they
amplified nucleotides
1085 to
800 plus a small fragment
of the vector pXP-1. To label the product, 0.5 µl dATP was added to
[
-32P]dATP (3,000 Ci/mmol). DNA binding reactions were with 1 µg NIH/3T3 nuclear
extracts in binding buffer (5% glycerol, 0.52 mM
CaCl2, 5 mM
MgCl2, 20 mM
Tris · HCl, pH 7.0) and contained 5,000-10,000 counts/min
-32P-labeled
oligonucleotides mixed for 20 min at room temperature. Binding assays
were in a volume of 10 µl. Some assays contained cold competitor at
concentrations from 9.2 ng/ml to 612.7 µg/ml. The competitor was
either the same unlabeled PCR product or poly dI:dC at the
concentrations indicated. After electrophoresis on 6% polyacrylamide
gels, the gels were dried and exposed to X-ray film for 24 h at
70°C. In some experiments, nuclear extracts were prepared
from quiescent and proliferating NIH/3T3 cells. In this case to obtain
proliferating cells, NIH/3T3 cells were initially serum starved for 24 h in 0.5% serum. They were then returned to a medium with 10% serum
for 24 h and harvested. To obtain quiescent cells, NIH/3T3 cells were
grown to confluence and then serum starved (0.5% serum) for 24 h. They
were then harvested as described above.
| |
RESULTS |
|---|
|
|
|---|
To examine regulation of expression of the NHE1 gene, we constructed a
series of plasmids with various deletions of the NHE1 promoter. The
plasmids used were described earlier (45). The constructs were
pXP-1.1MP, pXP-0.9MP, pXP-0.5MP, pXP-0.2MP, pXP-0.18MP, pMP+AP2, and
pMP-AP2. These plasmids begin at nucleotides
1085,
808,
515,
171,
155,
125, and
92 of the
mouse NHE1 promoter, respectively (45). To construct a stable
fibroblast cell line, we used a reporter plasmid containing a 1.1-kb
fragment of the mouse NHE1 promoter/enhancer (pXP-1.1MP) inserted
5' to a luciferase gene. We have earlier isolated and cloned this
region of the NHE1 promoter and have shown that it contains the
necessary elements essential for activity (11). This plasmid was then
stably transfected into the mouse fibroblast NIH/3T3 cells. We isolated
several different and independent transfectants with the NHE1 promoter
coupled to the luciferase promoter (1A7, 1A8, 3B5). We used PCR to
confirm that the entire 1.1-kb NHE1 promoter region was integrated into the genome of the cells and that it was not interrupted mid sequence. To do this, we isolated genomic DNA from cells that could express luciferase. Oligonucleotide primers directed against the 5'-end of luciferase and to the 5'-end of the mouse insert amplified the
appropriate size DNA fragment (data not shown). This confirmed that we
had inserted the intact 1.1-kb promoter region into the genome of the
NIH/3T3 cells. We compared the relative luciferase activity of these
different isolates and found that it varied markedly. The relative
luciferase activity of the clones per microgram of protein was 90,655, 26,113, and 113 for clones 1A7, 1A8, and 3B5, respectively. The
reason for the differences is not known at this time but could be
because of the influence of surrounding DNA sequences.
Serum deprivation has routinely been used to arrest growth of NIH/3T3 cells and render them quiescent (6, 9). Because recent evidence has suggested that mRNA levels of the exchanger are increased in at least some models of cellular proliferation (12) and because of a possible involvement of the Na+/H+ exchanger in cell proliferation, we examined the effects of reduction of serum content on the activity of the NHE1 promoter. Mouse NIH/3T3 cells (1A7) were grown to ~70% confluency and then grown for 24 h in medium containing either 0.5 or 10% serum. Figure 1A represents the level of luciferase activity from cells grown in 0.5 and 10% serum. Cells grown in the presence of 10% serum had a 100% increase in NHE1 promoter activity compared with those with 0.5% serum (Fig. 1A). Also, the cells showed a 100% increase in [3H]thymidine uptake (Fig. 1B). The effects of serum in these experiments are most likely a result of alterations in the growth state of the fibroblasts. Serum-reduced cells undergo a decrease in cellular proliferation and become quiescent. When serum is reintroduced to these cells, proliferation increases and growth rate rises. These alterations in cell proliferation were reflected in the ability of serum to stimulate DNA synthesis (Fig. 1B). These results suggest that increased growth rate may result in elevated NHE1 gene expression.
|
To identify some of the specific factors contained in serum that may act to stimulate NHE1 promoter transcription, we treated 1A7 cells with a variety of mitogens. Cells were initially incubated in serum-reduced medium for 24 h to decrease cell proliferation and to eliminate any residual mitogens. The cells were then treated with various stimuli for 24 h, harvested, and assayed for luciferase activity. The results are shown in Fig. 2. EGF, phorbol 12-myristate 13-acetate (PMA), thrombin, and insulin all stimulated activity of the NHE1 promoter in the 1A7 cells. Treatment with EGF also caused significant increases in [3H]thymidine uptake (data not shown), suggesting that cell proliferation had also been stimulated.
|
One of the pathways involved in the activation of the NHE1 promoter may
be mediated by a serine/threonine protein kinase, possibly PKC. We used
the inhibitor 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine (H-7) to
examine the contribution of the thrombin/insulin-dependent PKC pathway
on the activity of the NHE1 promoter (Fig. 4). When cells were treated
with thrombin and insulin in addition to H-7 (65 µM), the increase in
promoter activity was significantly attenuated. H-7 is an inhibitor of
serine/threonine protein kinases with partial specificity to PKC (5).
Our results show that H-7 can block a large amount of the stimulatory
effects of thrombin and insulin (Fig. 2). In addition, H-7 blocked the
stimulatory effects of PMA on the promoter. This indicates that the
increase in NHE1 transcription stimulated by thrombin and insulin can
be reduced by inhibition of serine/threonine protein kinases. To
provide further evidence that PKC is indeed involved in the
thrombin/insulin pathway, another PKC inhibitor was used. Similar to
H-7, staurosporine blocked the stimulatory effects of thrombin and
insulin on the NHE1 promoter activity (data not shown). When cells were
treated with the inactive form of phorbol ester, 4
-PMA, for 24 h,
there was no stimulation of the promoter activity.
How the NHE1 promoter is activated in cells treated with EGF is not known. One possibility is that the increase in proliferation may affect NHE1 transcriptional activity. Also, the tyrosine kinase activity may phosphorylate an as yet unidentified transcription factor that can then regulate the NHE1 promoter. To determine the role of tyrosine kinase in this process, the tyrosine kinase inhibitor genistein was used. Cells were treated with 10 ng/ml EGF along with 10 µg/ml genistein (Fig. 2). Surprisingly, cells treated with EGF and genistein showed an even greater increase over cells treated with EGF alone. Because genistein inhibits tyrosine kinase activity, it is most likely that the inhibition of the kinase results in the eventual increase in NHE1 promoter activity. One possibility may be that genistein increases proliferation, thereby stimulating NHE1 transcription. To test this hypothesis, genistein was examined for the ability to stimulate DNA synthesis in NIH/3T3 cells. Cells treated with EGF resulted in a two- to threefold increase in [3H]thymidine incorporation, whereas fibroblasts that were exposed to EGF and genistein together showed no increase in [3H]thymidine incorporation as compared with controls. The increases in NHE1 promoter activity because of EGF alone may be explained by increases in cellular proliferation. However, the effects of genistein on the NHE1 promoter in EGF-treated cells cannot be attributed to the induction of proliferation.
To ensure that the results we obtained were not because of a peculiarity of the cell line we use, we examined the effects of EGF on several other independently isolated stable transfectants. For this purpose, we tested several clones with the luciferase reporter pXP-1.1MP. In addition, we tested clones with the same region of the promoter and with a CAT reporter (p1.1MPcat) plasmid. This was to ensure that the effects we observed were not because of some effect on the luciferase reporter, which was not related to the activity of the promoter. The results of these experiments are shown in Fig. 3. EGF significantly stimulated activity of the reporter in different stable cells with either the luciferase or the CAT reporter. Genistein also stimulated the various cell lines, although the effect of EGF and genistein together was not greater in 1A8 cells in contrast to 1A7 and 3B5. Similar to the 1A7 cells, both cell lines with a CAT reporter were stimulated by thrombin. In a different series of experiments, we transiently transfected cells with the plasmid pRSVLuc. The cells were then serum deprived and treated with serum or genistein as described above. Neither serum nor genistein stimulated the activity of this promoter (data not shown).
|
We also examined the effect of two more selective protein kinase inhibitors, PD-98059 and GF-109203X. PD-98059 is a specific inhibitor of activation of the mitogen-activated protein (MAP) kinase kinase (MEK) that has been used earlier to examine the MAP kinase cascade (41), while GF-109203X is a selective inhibitor of PKC (40). The results (Fig. 4) showed that both inhibitors produced an interesting biphasic effect. In proliferating cells grown in either the presence of 10% serum (Fig. 4A) or in cells grown in the presence of 0.5% serum (Fig. 4B), PD-98059 caused a large increase in the activity of the NHE1 promoter. The peak increase was at ~25 µM and higher concentrations inhibited activity of the promoter. A similar effect was seen with the PKC inhibitor GF-109203X in cells grown in 10% serum. At low micromolar concentrations, it stimulated activity of the promoter, whereas at much higher concentrations, the activity declined. There was no effect of GF-109203X in the absence of serum (Fig. 4B), and in both cases, vehicle alone did not stimulate the promoter. EGF (10 ng/ml) in the presence of 25 µM PD-98059 caused a greater stimulation of the promoter; however, the stimulation was not statistically different at the 0.05 level of significance.
|
To determine which region of the promoter was involved in stimulation
of activity, we used transient transfection of cells with a series of
constructs of the promoter. The results (Fig. 5) suggest that a region between
1085 and
808 of the NHE1 promoter could be involved in
regulation of the NHE1 promoter. The plasmid pXP1.1MP that contained
these base pairs was stimulated by EGF, serum, and PMA. Other shorter
regions of the promoter were not activated by these stimuli. In some
cases, EGF and serum resulted in an apparent depression of activity of
the promoter. The cause of this suppression of activity is not known.
|
We next examined directly whether the region between base pairs
1085 and
800 of the NHE1 promoter could be involved in
regulation of the NHE1 promoter. DNA coding for this region was
amplified and labeled using PCR as described above. Gel mobility shift
analysis was used to determine whether a protein(s) bound to this
region. The results (Fig. 6) show that a
protein or proteins can bind to this region. Competition with unlabeled
fragment reduced the mobility shift. Competition with poly(dI:dC) did
not reduce binding to the fragment. An interesting observation was that
competition with poly(dA:dT) reduced the binding. This suggested that
the regions involved in protein binding may be dA:dT rich.
|
Fragments of the
1085 to
800 region of the NHE1 promoter
were examined to localize which region of the gene was involved in
mitogenic stimulation. We examined four fragments of this region (Fig.
7) for their ability to bind protein that
was from either proliferating or quiescent cells. Both a 199-bp
fragment and a 192-bp fragment bound to nuclear extracts from NIH/3T3
cells (Fig. 8). The 61- and 94-bp fragments
bound only small amounts of protein from the nuclear extracts. An
interesting aspect of the binding was that in all cases nuclear
extracts from quiescent cells bound more DNA than nuclear extracts of
proliferating cells, resulting in a stronger shift.
|
|
We also examined mRNA from quiescent and proliferating NIH/3T3 cells. Primers for the NHE1 isoform of the Na+/H+ exchanger amplified a 180-bp fragment from cDNA of NIH/3T3 cells. Comparison of mRNA levels by competitive PCR as described earlier (46) showed that NHE1 message levels were increased 70-75% in proliferating in comparison with quiescent cells.
Because of the observed increase in NHE1 promoter activity because of mitogenic stimuli, we examined whether an increase in the NHE1 promoter activity could be detected in any specific stage of the cell cycle. Cells were sorted according to the phases of the cell cycle. These groups were identified as early G1, late G1, S, and G2 phases. Figure 9 represents the levels of NHE1 promoter-directed transcription in these groups of cells. In the phases of the cell cycle in which the cell is not dividing (G1 and S phases), NHE1 promoter activity is low. When the cells enter G2 phase, however, the cells are preparing to undergo mitosis. It is at this point that we see a 2.7-fold increase in NHE1 promoter activity. Because the amount of DNA per cell is significantly increased, the results do not suggest a dramatic increase in activity of the promoter.
|
| |
DISCUSSION |
|---|
|
|
|---|
The NHE1 isoform of the Na+/H+ exchanger family has traditionally been described as the "housekeeping" isoform (11). Generally speaking, housekeeping genes and proteins are thought of as nonresponsive to external stimuli. A number of studies, however, have shown that mRNA levels for the NHE1 isoform can be increased by a variety of external stimuli including serum, acidosis, PKC, and cell proliferation (12, 20, 23, 34). These findings prompted us to investigate the cellular events that lead to the activation of the NHE1 gene. We constructed a number of permanently transfected cell lines that contained the NHE1 promoter directing a reporter gene. This approach allowed us to characterize more precisely the changes in promoter expression by avoiding some of the variability inherent in transient transfections. We used several different, independently isolated cell lines to confirm that the results observed were not peculiar to the 1A7 cells. Although the absolute level of stimulation varied, the results were a consistent activation of the promoter by a number of mitogens. The amount of activation was approximately from 50% up to a threefold activation depending on the cell line and the type of stimulation. The same trend was seen with the luciferase reporter as with the CAT reporter. We also found that in intact NIH/3T3 cells there was an increase in NHE1 message in proliferating in comparison with quiescent cells. These results show that the NHE1 promoter is activated by mitogenic stimulation and that the NHE1 message is also elevated.
Serum, EGF, thrombin, and insulin all activated the NHE1 promoter, and these same compounds are also known to stimulate cell proliferation. In the case of serum, it has been shown that serum can act as a hyperplastic agonist and cause large increases in NHE1 mRNA levels in vascular smooth muscle cells (34). EGF is a mitogen that is widely recognized to stimulate cell replication (19, 27, 31, 37). Thrombin has been reported to be a mitogenic stimulus in some cell types, either alone or in conjunction with growth factors (7). Similarly, insulin by itself or in combination with other factors can stimulate cell proliferation (26).
Insulin and thrombin also activated the NHE1 promoter (Fig. 2). Insulin and thrombin stimulate cellular proliferation (7, 26). It is interesting to note that in some cell types the effect of insulin on cell proliferation may be at least partially mediated by the Na+/H+ exchanger. Insulin can act to elevate intracellular pH, which may be necessary for cell growth depending on the cell type and extracellular pH (14, 15, 26). Cells treated with thrombin and insulin demonstrated increases in [3H]thymidine incorporation (data not shown), which is consistent with their known mitogenic effect. This indicates that alterations in the NHE1 promoter activity may result from the stimulation of proliferation in these cells.
PKC has been suggested to be involved in regulation of the NHE1
promoter (21). In addition, stimulation of PKC acts as a mitogen
similar to EGF, possibly working through phosphorylation of MAP kinase
(6). In initial experiments to test the role of PKC in regulation of
the NHE1 promoter, 1A7 cells were subjected to treatment with the
phorbol ester PMA. PMA treatment produced significant increases in NHE1
promoter activity in NIH/3T3 cells. The inactive form of PMA
(4
-PMA), however, produced no increase in NHE1 transcription. Also,
the PKC inhibitor H-7 eliminated the effects of PMA completely. The
mechanism of action of PMA on the NHE1 promoter is not yet known.
First, PMA could act through PKC in the activation of some
transcription factor that can transactivate the NHE1 gene. The second
possibility for the involvement of PKC in activating NHE1 transcription
is through its mitogenic properties, which have been demonstrated
earlier (8). In support of this concept was the finding that the more
specific PKC inhibitor GF-109203X appeared to have a stimulatory effect
on the activity of the promoter (Fig. 4) at concentrations that
specifically inhibit PKC (40). At higher concentrations above those
normally used for PKC inhibition, the effect was reduced. This could
indicate that inhibition of another kinase occurred. It therefore seems
that some other aspects of the mitogenic stimulation rather than PKC
itself may be responsible for activating the promoter. Thus it is
possible that PMA acts through the same general mechanism as the other
growth factors and serum, activating NHE1 transcription through a
mechanism dependent on mitogenic stimulation and other protein kinases
aside from direct dependence on PKC. The effect of GF-109203X only
occurred in cells stimulated with serum. Thus PKC may only play this
modulatory (inhibitory) role in active proliferating cells.
The initial events in the actions of EGF are the activation of tyrosine kinases with a subsequent effect on a large number of protein substrates (19). Our results with EGF show that this factor increases NHE1 promoter-driven transcription. To determine the role of tyrosine kinases in this process, the tyrosine kinase inhibitor genistein was used. Genistein has been shown to inhibit the mitogenic effects of EGF in many cell types (26, 27, 31), and we found that it inhibited the mitogenic effects of EGF on cell proliferation. However, surprisingly, cells treated with EGF and genistein showed no decrease in activation of the promoter and an increase in activity over basal rates (Figs. 2 and 3). Because genistein inhibits tyrosine kinase activity, it is most likely that the inhibition of the kinase results in an eventual increase in NHE1 promoter activity. Exactly how this occurred is as yet unclear. A similar result occurred with the specific MAP kinase inhibitor PD-98059 (Fig. 4). In the concentrations that were typical of those used to specifically inhibit MEK (41), the NHE1 promoter was activated. At high concentrations of inhibitor, the effect was reversed, possibly because of inhibition of some other kinases that might normally play a stimulatory role on the promoter (Fig. 4). Thus it appears that MEK and the MAP kinase cascade may normally play an inhibitory role in NHE1 transcription. The results do suggest that neither a tyrosine nor the MAP kinase cascade is directly responsible for stimulating activity of the NHE1 promoter. Possibly activation occurs through the action of some as yet unidentified kinases in combination with a mitogenic effect on the cell.
To localize the region of the gene involved in mitogenic stimulation, we used transient transfections of a series of constructs. Their sizes were from 1.1 kb to ~100 bp from the start site of transcription. The results (Fig. 5) showed that only the full-length construct was effectively stimulated by EGF, PMA, and serum. This suggested that this distal region was involved in the mitogenic stimulation. To examine this further, we used gel mobility shift assays. Proteins from nuclear extracts bound to this region of the promoter (Fig. 6). Specific competitor removed the binding while poly(dI:dC) did not. Poly(dA:dT) did reduce the binding, which suggested that the protein binding region was AT rich. Using fragments of this region, we attempted to localize the region involved. Neither the 64- nor the 94-bp fragment bound significant amount of protein, and both the 192- and 199-bp fragment did bind the nuclear extracts. This suggests that a Dra I-Dde I 140-bp region may contain the sequence involved. A search of this region using the transcription factor database (43) showed no regions with a high homology to known transcription factor binding sites. What transcription factor is involved has yet to be determined.
Because of the observed increase in NHE1 promoter activity due to mitogenic stimuli, we examined whether an increase in the NHE1 promoter activity could be detected in any specific stage of the cell cycle. Cells were sorted according to the phases of the cell cycle. We saw a small 2.7-fold increase in NHE1 promoter activity when the cells enter G2 phase (Fig. 9) immediately before mitosis. Because the amount of DNA per cell is significantly increased, the results do not suggest a dramatic increase in activity of the promoter. The effect of mitogenic agents on NHE1 promoter activity must therefore be a more general effect throughout the cell cycle and is not specifically confined to one phase of growth.
The role of the Na+/H+ exchanger in cell growth and proliferation has not been firmly established. There is indirect evidence demonstrating the role of cytoplasmic pH in growth control and in the activation of metabolism in resting cells (33). Also, actively proliferating tumor cells are often more alkaline than normal cells, and inhibitors of the exchanger help reduce their rate of proliferation (44). Cellular proliferation can often be increased by mitogenic stimulation. An early event in the response of certain cells to mitogenic factors is often the activation of the NHE1 protein (28). Moreover, intracellular protons have been reported to be essential during the initiation of mitogenic responses. Indeed, the concentrations of H+ themselves can affect the transmission of secondary messengers leading to DNA synthesis and mitosis (25). Our study has shown the effects of specific mitogens on the NHE1 promoter and has demonstrated a link between NHE1 promoter activity and proliferation. We cannot conclude, however, that this activation is essential for the cells to progress through the cell cycle. We suggest that alterations in the NHE1 gene activity may play an important role in facilitating cell growth and proliferation. Recently, we have shown that the antiporter plays an important role in neuronal cell differentiation (39). Future experiments will investigate if this also occurs in cell proliferation in a number of cell lines.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to D. Rutkowski for the work performed on the flow cytometer. We also thank Olivia Tsai for excellent technical assistance.
| |
FOOTNOTES |
|---|
This work was supported by Medical Research Council of Canada Program Grant PG11440. P. Besson was a recipient of a postdoctoral grant from the Region Center, France.
Address for reprint requests: L. Fliegel, Dept. of Biochemistry, Faculty of Medicine, Univ. of Alberta, 347 Medical Science Bldg., Edmonton, AB, Canada T6G 2H7.
Received 27 March 1997; accepted in final form 10 November 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alvarez, J.,
J. Garcia-Sancho,
F. Mollinedo,
and
A. Sanchez.
Intracellular Ca2+ potentiates Na+/H+ exchange and cell differentiation induced by phorbol ester in U937 cells.
Eur. J. Biochem.
183:
709-714,
1989[Medline].
2.
Arsenis, G.
Regulation of Na+/H+ exchange in rat adipocytes: effects of insulin.
Endocrinology
136:
1920-1927,
1995[Abstract].
3.
Besterman, J. M.,
and
P. Cuatrecasas.
Phorbol esters rapidly stimulate amiloride-sensitive Na+/H+ exchange in a human leukemic cell line.
J. Cell Biol.
99:
340-343,
1984
4.
Boron, W. F.,
and
E. L. Boulpaep.
Intracellular pH regulation in the renal proximal tubule of the salamander.
J. Gen. Physiol.
81:
29-52,
1983
5.
Bradshaw, D.,
C. H. Hill,
J. S. Nixon,
and
S. E. Wilkinson.
Therapeutic potential of protein kinase C inhibitors.
Agents Actions
38:
135-147,
1993[Medline].
6.
Briehl, M. M.,
and
R. L. Miesfeld.
Isolation and characterization of transcripts induced by androgen withdrawal and apoptotic cell death in the rat ventral prostate.
Mol. Endocrinol.
5:
1381-1388,
1991
7.
Caterina, R.,
and
R. Sicari.
Cellular effects of thrombin: pharmacology of the receptor(s) in various cell types and possible development of receptor antagonists.
Pharmacol. Res.
27:
1-19,
1993.
8.
Chao, T.-S. O.,
D. A. Foster,
U. R. Rapp,
and
M. R. Rosner.
Differential Raf requirement for activation of mitogen-activated protein kinase by growth factors, phorbol esters, and calcium.
J. Biol. Chem.
269:
7337-7341,
1994
9.
Dovrzanski, P.,
T. Noguchi,
K. Kovary,
C. A. Rizzo,
P. S. Lazo,
and
R. Bravo.
Both products of the fosB gene, Fosb and its short form, FosB/SF are transcriptional activators in fibroblasts.
Mol. Cell. Biol.
11:
5470-5478,
1991
10.
Dyck, J. R. B.,
and
L. Fliegel.
Specific activation of the Na+/H+ exchanger during neuronal differentiation of embryonal carcinoma cells.
J. Biol. Chem.
270:
10420-10427,
1995
11.
Dyck, J. R. B.,
N. L. C. L. Silva,
and
L. Fliegel.
Activation of the Na+/H+ exchanger gene by the transcription factor AP-2.
J. Biol. Chem.
270:
1375-1381,
1995
12.
Elsing, C.,
J. Reichem,
U. Marti,
and
E. L. Renner.
Hepatocellular Na+/H+ exchange is activated at transcriptional and posttranslational levels in rat biliary cirrhosis.
Gastroenterology
107:
468-478,
1994[Medline].
13.
Fliegel, L.,
and
O. Frohlich.
The Na+/H+ exchanger: an update on structure, regulation and cardiac physiology.
Biochem. J.
296:
273-285,
1993.
14.
Franchi, A.,
E. J. Cragoe,
and
J. Pouysségur.
Isolation and properties of fibroblast mutants overexpressing an altered Na+/H+ antiporter
J. Biol. Chem.
261:
14614-14620,
1986
15.
Franchi, A.,
D. Perruca-Lostanen,
and
J. Pouyssegur.
Functional expression of a transfected Na+/H+ antiporter human gene into antiporter-deficient mouse L cells.
Proc. Natl. Acad. Sci. USA
83:
9388-9392,
1986
16.
Grinstein, S.,
C. A. Clarke,
and
A. Rothstein.
Activation of Na+/H+ exchange in lymphocytes by osmotically induced volume changes and by cytoplasmic acidification.
J. Gen. Physiol.
82:
619-638,
1983
17.
Grinstein, S.,
D. Rotin,
and
M. J. Mason.
Na+/H+ exchange and growth factor-induced cytosolic pH changes. Role in cellular proliferation.
Biochim. Biophys. Acta
988:
73-97,
1989[Medline].
18.
Hazav, P.,
S. Shany,
A. Moran,
and
R. Levy.
Involvement of intracellular pH elevation in the effect of 1,25-dihydroxyvitamin D3 on HL60 cells.
Cancer Res.
49:
72-75,
1989
19.
Hollenberg, M. D.
Tyrosine kinase pathways and the regulation of smooth muscle contractility.
Trends Pharmacol. Sci.
15:
108-114,
1994[Medline].
20.
Horie, S.,
O. Moe,
R. T. Miller,
and
R. Alpern.
Long term activation of protein kinase C causes chronic Na+/H+ antiporter stimulation in cultured proximal tubule cells.
J. Clin. Invest.
89:
365-372,
1992.
21.
Horie, S.,
O. Moe,
Y. Yamaji,
A. Cano,
R. T. Miller,
and
R. J. Alpern.
Role of protein kinase C and transcription factor AP-1 in the acid-induced increase in Na+/H+ antiporter activity.
Proc. Natl. Acad. Sci. USA
89:
5236-5240,
1992
22.
Kolyada, A. Y.,
T. V. Lebedeva,
C. A. Johns,
and
N. E. Madias.
Proximal regulatory elements and nuclear activities required for transcription of the human Na/H exchanger (NHE-1) gene.
Biochim. Biophys. Acta
1217:
54-64,
1994[Medline].
23.
Krapf, R.,
D. Pearce,
C. Lynch,
X. P. Xi,
T. L. Reudelhuber,
J. Pouyssegur,
and
F. C. Rector, Jr.
Expression of rat renal Na/H antiporter mRNA levels in response to respiratory and metabolic acidosis.
J. Clin. Invest.
87:
747-751,
1991.
24.
Ladoux, A.,
E. J. Cragoe,
B. Geny,
J. P. Abita,
and
C. Frelin.
Differentiation of human promyelocytic HL 60 cells by retinoic acid is accompanied by an increase in the intracellular pH.
J. Biol. Chem.
262:
811-816,
1987
25.
Lagarde, A. E.,
and
J. M. Pouyssegur.
The Na:H antiport in cancer.
Cancer Biochem. Biophys.
9:
1-14,
1986[Medline].
26.
Lapointe, M. S., and D. C. Batlle.
Na+/H+
exchange and vascular smooth muscle proliferation.
Am. J. Med. Sci. 307, Suppl. 1: S9-S16, 1994.
27.
Linassier, C.,
M. Pierre,
J. B. Le Pecq,
and
J. Pierre.
Mechanisms of action in NIH/3T3 cells of genistein, an inhibitor of EGF receptor tyrosine kinase activity.
Biochem. Pharmacol.
39:
187-193,
1990[Medline].
28.
Mahnensmith, R. L.,
and
P. S. Aronson.
The plasma membrane sodium-hydrogen exchanger and its role in physiological and pathophysiological processes.
Circ. Res.
56:
773-785,
1985
29.
Miller, R. T.,
L. Counillon,
G. Pages,
R. P. Lifton,
C. Sardet,
and
J. Pouyssegur.
Structure of the 5'-flanking regulatory region and gene for the human growth factor-activatable Na/H exchanger NHE-1.
J. Biol. Chem.
266:
10813-10819,
1991
30.
Mitsuka, M.,
and
B. C. Berk.
Long-term regulation of Na+-H+ exchange in vascular smooth muscle cells: role of protein kinase C.
Am J. Physiol.
260 (Cell Physiol. 29):
C562-C569,
1991
31.
Piontek, M.,
S. K. J. Hengel,
R. Porschen,
and
G. Strohmeyer.
Antiproliferative effect of tyrosine kinase inhibitors in epidermal growth factor-stimulated growth of human gastric cancer cells.
Anticancer Res.
13:
2119-2123,
1993[Medline].
32.
Pouyssegur, J.
The growth factor-activatable Na+/H+ exchange system: a genetic approach.
Trends Biochem. Sci.
10:
453-455,
1985.
33.
Pouyssegur, J.,
A. Franchi,
M. Kohno,
G. L'Allemain,
and
S. Paris.
Na-H exchange and growth control in fibroblasts: a genetic approach.
Curr. Top. Membr. Transp.
26:
210-219,
1986.
34.
Rao, G. N.,
C. Sardet,
J. Pouyssegur,
and
B. C. Berk.
Differential regulation of Na+/H+ antiporter gene expression in vascular smooth muscle cells by hypertrophic and hyperplastic stimuli.
J. Biol. Chem.
265:
19393-19396,
1990
35.
Rao, G. N.,
C. Sardet,
J. Pouyssegur,
and
B. C. Berk.
Na+/H+ antiporter gene expression increases during retinoic acid-induced granulocytic differentiation of HL60 cells.
J. Cell. Physiol.
151:
361-366,
1992[Medline].
36.
Schreiber, E.,
P. Matthias,
M. M. Muller,
and
W. Schaffner.
Rapid detection of octamer binding proteins with "mini-extracts," prepared from a small number of cells.
Nucleic Acids Res.
17:
6419,
1989
37.
Stephan, E. B.,
and
R. Dziak.
Effects of genistein, tryphostin, and pertussis toxin on EGF-induced mitogenesis in primary culture and clonal osteoblastic cells.
Calcif. Tissue Int.
54:
409-413,
1994[Medline].
38.
Vairo, G.,
and
J. A. Hamilton.
Evidence against a requirement for Na+/H+ exchange activity for proliferation or differentiation of HL 60 leukemic cells.
Cell Growth Differ.
4:
461-466,
1993[Abstract].
39.
Wang, H.,
D. Singh,
and
L. Fliegel.
The Na+/H+ antiporter potentiates growth and retinoic acid-induced differentiation of P19 embryonal carcinoma cells.
J. Biol. Chem.
272:
26545-26549,
1997
40.
Wang, Q. J.,
P. Acs,
J. Goodnight,
T. Giese,
P. M. Blumberg,
H. Mischak,
and
J. F. Mushinski.
The catalytic domain of protein kinase C-
in reciprocal
and E chimeras mediates phorbol ester-induced macrophage differentiation of mouse promyelocytes.
J. Biol. Chem.
272:
76-82,
1997
41.
Wartmann, M.,
P. Hofer,
P. Turowski,
A. R. Saltiel,
and
N. E. Hynes.
Negative modulation of membrane localization of the Raf-1 protein kinase by hyperphosphorylation.
J. Biol. Chem.
272:
3915-3923,
1997
42.
Williams, B.,
and
R. L. Howard.
Glucose-induced changes in Na+/H+ antiport activity and gene expression in cultured vascular smooth muscle cells: role of protein kinase C.
J. Clin. Invest.
93:
2623-2631,
1994.
43.
Wingender, E.,
P. Dietze,
H. Karas,
and
R. Knuppel.
TRANSFAC: a database on transcription factors and their DNA binding sites.
Nucleic Acid Res.
24:
238-241,
1996
44.
Yamagata, Y.,
and
I. F. Tannock.
Therapeutic potential of inhibitors of Na+/H+ exchanger activity in tumor selective therapy.
In: The Na+/H+ Exchanger, edited by L. Fliegel. Austin, TX: Landes, 1996, p. 269-291.
45.
Yang, W.,
J. R. B. Dyck,
and
L. Fliegel.
Regulation of NHE-1 expression in L6 muscle cells.
Biochim. Biophys. Acta
1306:
107-113,
1996[Medline].
46.
Yang, W.,
J. R. B. Dyck,
H. Wang,
and
L. Fliegel.
Regulation of the NHE-1 promoter in the mammalian myocardium.
Am. J. Physiol.
270 (Heart Circ. Physiol. 39):
H259-H266,
1996
This article has been cited by other articles:
![]() |
A. L. Grenier, K. Abu-ihweij, G. Zhang, S. M. Ruppert, R. Boohaker, E. R. Slepkov, K. Pridemore, J.-J. Ren, L. Fliegel, and A. R. Khaled Apoptosis-induced alkalinization by the Na+/H+ exchanger isoform 1 is mediated through phosphorylation of amino acids Ser726 and Ser729 Am J Physiol Cell Physiol, October 1, 2008; 295(4): C883 - C896. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Schelling and B. G. Abu Jawdeh Regulation of cell survival by Na+/H+ exchanger-1 Am J Physiol Renal Physiol, September 1, 2008; 295(3): F625 - F632. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Rios, M. Fallon, J. Wang, and L. A. Shimoda Chronic hypoxia elevates intracellular pH and activates Na+/H+ exchange in pulmonary arterial smooth muscle cells Am J Physiol Lung Cell Mol Physiol, November 1, 2005; 289(5): L867 - L874. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Wu, S. Khan, S. Lakhe-Reddy, L. Wang, G. Jarad, R. T. Miller, M. Konieczkowski, A. M. Brown, J. R. Sedor, and J. R. Schelling Renal tubular epithelial cell apoptosis is associated with caspase cleavage of the NHE1 Na+/H+ exchanger Am J Physiol Renal Physiol, April 1, 2003; 284(4): F829 - F839. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. V. Rieder and L. Fliegel Developmental regulation of Na+/H+ exchanger expression in fetal and neonatal mice Am J Physiol Heart Circ Physiol, July 1, 2002; 283(1): H273 - H283. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Melvin, H.-V. Nguyen, K. Nehrke, C. M. Schreiner, K. G. Ten Hagen, and W. Scott Targeted disruption of the Nhe1 gene fails to inhibit {beta}1-adrenergic receptor-induced parotid gland hypertrophy Am J Physiol Gastrointest Liver Physiol, April 1, 2001; 280(4): G694 - G700. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |