|
|
||||||||
1 University of Minnesota Medical School, Minneapolis, Minnesota 55455; 3 State University of New York, Brooklyn, New York 11203-2012; and 2 Jichi Medical School, Minamikawachi 329-0498, Japan
| |
ABSTRACT |
|---|
|
|
|---|
Na-K-ATPase plays a central role in a variety of physiological
processes, including ion transport and regulation of cell volume. Our
previous data showed that hyperoxia increased the expression of
Na-K-ATPase
1 and
1 mRNA in lung type II cells.
We similarly show that hyperoxia (
95%
O2 for 24-48 h) increased
steady-state mRNA levels in both Na-K-ATPase subunits in Madin-Darby
canine kidney (MDCK) cells. The mechanism of gene regulation by
hyperoxia was assessed. Stability of the Na-K-ATPase mRNA levels of
both subunits was unchanged in hyperoxia-exposed MDCK cells. To
determine whether gene transcription was augmented by hyperoxia, MDCK
cells were transfected with a
1-subunit promoter-reporter
construct. Transfection with the wild-type promoter
(
1-817) revealed a
1.9 ± 0.2-fold increase in promoter activity. Transfection with
5' deletion constructs identified a 61-base pair (bp) region
between
102 and
41 that was necessary for this increase
in promoter activity by hyperoxia. Incorporation of this 61-bp region
into a minimal promoter (mouse mammary tumor virus) similarly increased promoter activity 2.3-fold in the presence of hyperoxia. This increase
in promoter activity was not seen when MDCK cells were incubated with
various concentrations of hydrogen peroxide. In summary, hyperoxia
increased Na-K-ATPase
1-subunit
mRNA steady-state level due to increased transcription in MDCK cells. A
region necessary for this hyperoxic effect on
1 transcription is located
between base pairs
102 and
41 on the promoter.
ribonucleic acid stability; transcription; transfection; sodium pump; oxidants; Madin-Darby canine kidney cells
| |
INTRODUCTION |
|---|
|
|
|---|
MAINTAINING INTRACELLULAR ionic gradients and concentrations is key for cellular survival. During oxidant injury, intracellular ion concentrations can be disturbed by the oxidation of regulatory proteins and the disruption of cellular membranes. The upregulation of cellular mechanisms that maintain intracellular ionic balance may serve to counteract this effect. Oxidant injury has a complex effect on Na transport, depending on cell and oxidant type and the duration of the exposure. In some systems, oxidant injury upregulates both the Na channel and the Na-K-ATPase; both are important in cellular ionic homeostasis (3, 12, 15, 25, 27, 32a, 36, 41).
The Na-K-ATPase plays a central role in a variety of physiological
processes, including transepithelial ion transport, regulation of cell
volume, Na-coupled uptake of metabolic substrates (glucose, amino
acids), and the propagation of the action potential of muscle and nerve
(34). The Na pump utilizes 10-30% of cellular ATP to actively
transport Na and K ions across the cell membrane and maintain the
transmembrane Na gradient. Although present to some extent in all
cells, Na-K-ATPase is present in high density on the basolateral
membranes of many epithelial cells specialized for Na transport, such
as renal tubular epithelial cells. The Na-K-ATPase is a heterodimer of
- and
-subunits, with several isoforms described for each
subunit. The major isoforms expressed in most epithelial cells are the
1- and
1-isoforms. The
-subunit contains the catalytic site, whereas the
-subunit appears to be
required for plasma membrane targeting (13).
Expression of the Na-K-ATPase mRNA isoforms is regulated in a
tissue-specific and developmental fashion (16, 22). In addition, Na
pump transcription can be upregulated two- to fourfold by changes in
ion concentrations (24), and gene expression is increased to similar
degrees by glucocorticoids, aldosterone, and thyroid hormone
(3,5,3'-triiodothyronine) in certain tissues (9,
31). A Na pump-specific positive transcription regulatory element has been characterized in the proximal promoter region of the
1-subunit (20). The 5'
flanking regions of both
1 and
1-subunits have several
potential regulatory sites that may bind known transcription factors
(20, 31). These include putative SP1, antioxidant responsive element (ARE), and nuclear factor-
B (NF
B) sites and glucocorticoid response elements. However, the functional activity of
these sites remains undefined (23).
Recently, the roles of oxygen or oxidants in regulating gene expression
have been recognized as important in both prokaryotic and eukaryotic
systems, but the regulatory mechanisms involved are not well understood
(28). Many of the genes regulated by hyperoxia or oxidants are involved
in the homeostatic antioxidant response (14). Oxygen tension and
oxidants also can influence the expression of genes not involved
directly in the antioxidant response, such as surfactant apoprotein A,
-tubulin,
-actin, and the Na-K-ATPase (14, 15, 27). Although
these proteins are not directly involved in the antioxidant process,
they may play a key role in the maintenance of cell homeostasis in the face of hyperoxic or oxidant injury.
Our investigations have focused on oxidant regulation of Na-K-ATPase.
We found that hyperoxia increased the steady-state levels of
Na-K-ATPase mRNA in Madin-Darby canine kidney (MDCK) cells but did not
alter the mRNA half-life of either subunit. The increase in
1 mRNA resulted from increased
1 transcription as demonstrated by transfecting cells with a promoter-reporter construct and measuring promoter activity. Deletion mutants identified a 61-base pair (bp)
region of the
1 promoter
between
102 and
41 bp upstream of the transcription
initiation site that is necessary for the hyperoxic upregulation of
promoter activity.
| |
METHODS |
|---|
|
|
|---|
Cell culture and hyperoxia exposure. The low-resistance MDCK cell line was obtained from American Type Culture Collection (ATCC CCL 34). Cells were cultured on plastic tissue culture dishes and were incubated in media containing 10% fetal bovine serum (FBS; GIBCO) and 100 U/ml penicillin, 100 µg/ml streptomycin, and 2.5 µg/ml amphotericin B (GIBCO) in Eagle's minimum essential medium (MEM) with Earle's salts (GIBCO). Cells were cultured with 5% CO2-95% air at 37°C before experiments. Cells at ~40-50% confluence were exposed to hyperoxia by placing the plates in a humidified, sealed chamber (Billups) that was flushed with 5% CO2-95% O2 at 5 l/min for 5-10 min each day. The chamber was placed in the incubator at 37°C for various time intervals. Cells continued to divide in the presence of hyperoxia and became confluent between 24 and 48 h.
RNA analysis. Total cellular RNA was
extracted and isolated by the guanidinium method as previously
published (2). Northern analysis was performed as previously described
(27); 20 µg of total RNA were loaded onto 1% agarose and
formaldehyde gels and electrophoresed in
3-(N-morpholino)propanesulfonic acid buffer. The RNA was
transferred to nylon membranes in 10× standard sodium citrate
(SSC) overnight, and the membranes were heat fixed at 80°C for 2 h.
Multiple photographic negatives of the ultraviolet fluorescence of the
28S and 18S RNA on the nylon membranes were obtained to normalize for
loading and to assure that the exposure was within the linear range of
the film. Membranes were prehybridized in 10% dextran sulfate, 50%
formamide, 1% sodium dodecyl sulfate (SDS), Denhardt's
solution, salmon sperm DNA, and 1 M NaCl at 42°C for 2 h. The
1 and
1 Na-K-ATPase probes used were
full-length rat cDNAs (gifts of E. Benz, Johns Hopkins University). The
probes were multiprime labeled (Promega) with
32P, and 1 × 106 counts/ml of solution was
added to the hybridization solution overnight at 42°C as previously
described (27). The membranes were washed two times in each of the
following conditions: 5 min at room temperature with 2× SSC; 20 min at 50°C with 2× SSC- 1% SDS; and 1 h at 68°C with
0.1× SSC-0.1% SDS. The membranes then were placed on film for
24-72 h. The RNA integrated optical density (IOD) was determined
using Densitometry Image software. The
1 mRNA had two transcripts on
Northern analysis. Both transcripts were included in the IOD
measurements for the
1-subunit.
The RNA densitometry values were normalized to the 18S and 28S RNA densitometry value from the film negative from ethidium bromide-stained RNA fixed to nylon membranes (6). This method has been reliable for
normalization and eliminates the issue of variability of certain housekeeping genes, such as actin, to hyperoxia and also eliminates the
need for a second hybridization (6). Because 18S and 28S represent
>90% of the RNA, apart from variations in loading, large changes in
the rRNA would need to be seen to influence normalization. All
experiments were performed at least in triplicate.
RNA stability. Stability of Na-K-ATPase mRNA was measured as described by Chambers et al. (4). To inhibit mRNA synthesis, cells were treated with 10 µg/ml actinomycin D for various time intervals during the final portion of 24 h of incubation in either hyperoxia or room air (controls). Twenty-four hours of hyperoxia was chosen, since the maximal increase in steady-state mRNA levels was seen at this time. Preliminary data showed that <20% of the original Na-K-ATPase mRNA was present after 8 h of actinomycin D; therefore, cells were treated for 2, 4, 6, and 8 h with actinomycin D at the final portion of the 24 h of incubation. Total RNA was isolated, probed, and analyzed at the end of the designated time intervals using the method described above. To calculate the half-life of each subunit in both normoxia and hyperoxia, the densitometry (IOD) from each time point was divided by that at time 0 in that specific (normoxic or hyperoxic) condition and plotted on a log scale using previously published methods (4). Therefore, mRNA levels for each condition were designated 100% at time 0 for all conditions to enable half-life determination, although hyperoxia-exposed cells had higher initial mRNA levels. Chambers et al. (4) reported superinduction of Na-K-ATPase mRNA within the first 2 h of actinomycin D treatment. To eliminate any possible influence of superinduction on our half-life determinations, half-lives were calculated with and without time 0. Because there was no change in half-lives between normoxia and hyperoxia by both methods, we reported the half-lives using time 0.
DNA transfection experiments. The
Na-K-ATPase
1 promoter-reporter
constructs consisted of the 5' promoter region upstream from the
transcription start site plus 151 bp of the first exon linked to a
promoterless firefly luciferase expression vector (pXP1-luc), as
previously reported (32). Briefly, an
EcoR
I/Pvu II restriction fragment within
the 5' end of the Na-K-ATPase
1 gene (
817 to +151 bp)
was inserted into a promoterless firefly luciferase expression vector
(pXP1) to yield a hybrid gene designated
1-817. The two 5'
deletion mutants included 102 and 41 bp upstream from the transcription
start site (hybrids were designated
1-102 and
1-41, respectively; Fig.
1). These mutants were generated by
exonuclease III digestion of
1-817 as previously described, and each of these clones was sequenced to confirm the appropriate sequence and orientation (32).
|
MDCK cells were plated at a density of 8 × 106 cells/35-mm plate in MEM with
Earle's salts and 10% FBS. On day 2 of culture, cells were transfected with Lipofectin (GIBCO) and the
1 promoter-reporter construct
was isolated from maxi-preps (Qiagen). Prior studies to optimize DNA
and lipofectin concentrations determined the optimal condition to be 1 µg DNA and 60 µl lipofectin per 35-mm plate. Lipofection was
carried out using the manufacturer's recommendation (GIBCO) for a
total of 4 h in serum-free and antibiotic-free MEM with Earle's salts.
After lipofection, the cells were incubated for 48 h in MEM with
Earle's salts media plus 10% FBS in normoxia or hyperoxia. In four
experiments, cells were cotransfected with 0.3 µg of cytomegalovirus
(CMV)
-galactosidase. Cells were lysed and assayed for luciferase
activity (Luciferase Assay System; Promega) or
-galactosidase
activity (Clontech) in a luminometer (LB 9501; Berthold), and protein
concentration was determined by the bicinchoninic acid system of
Pierce. Relative luciferase activity was normalized to
either
-galactosidase activity or protein concentration and in some
experiments to both. The results from the four experiments with
cotransfection of
-galactosidase demonstrated identical
normalization to either
-galactosidase activity or protein
concentration; therefore, the remainder of the experiments were
normalized to protein. During our experiments, MDCK cells grew to near
confluence in hyperoxia; however, overall cell number and total protein
were less in hyperoxia. This decrease in cell number was corrected for
by normalizing the luciferase values to either
-galactosidase
activity or protein concentration. All normalized promoter activity was
reported as a percent activity over control. The control is designated
as the full-length promoter (
1-817) in normoxia.
Plasmid constructions. To confirm that
the region from
102 to
41 was necessary for hyperoxic
induction, an oligonucleotide spanning this region was subcloned into a
minimal promoter to determine whether this region could upregulate a
nonspecific promoter in the presence of hyperoxia. A 119-bp
oligonucleotide was synthesized that spanned from
157 to
38 using polymerase chain reaction (PCR) amplification
(5'-CTAGCCTAGCCGGCTCCTTTGTGCCGGCCCCACGCCCGCCCCTTCGGGCTCAGGCCCGCCTTCTCGGCACCGGCGATTGGCCTGCGGTGCCGCCGGTAGGCGGAGCTACGGATGGTGGAG-3') and was subcloned into a luciferase vector containing a minimal promoter of the mouse mammary tumor virus (MMTV; ATCC 37582) (Fig. 2). The minimal promoter consisted of 109 bp of the 5' proximal promoter of the MMTV, which was not
upregulated by hyperoxia. PCR amplification reactions were performed in
a DNA thermal cycler (Perkin-Elmer) for 30 cycles of a three-step
program (step 1, 1-min incubation at
96°C; step 2, 1-min incubation at
60°C; step 3, 1-min incubation at
72°C) using 2.5 units of Pyrococcus furiosus (Pfu)
(Stratagene) and 120 ng of EcoR I
linearized plasmid containing the
817 bp promoter (
817 to
+151, pXP1-luc). The reactions contained 10 µl of 10× PCR
buffer (Stratagene) and 20 pmol of each primer (5' primer, 22-bp
oligonucleotide from
157 to
136; 3' primer, 23-bp
oligonucleotide spanning
60 to
38). A gel-purified PCR fragment was cloned into the Srf I
site of a PCR-script plasmid (Stratagene). After
Escherichia coli transformation,
plasmid DNA was isolated and digested with
Hind III and
Sac I to produce a 190-bp
oligonucleotide that contained the 119-bp oligonucleotide and was
subcloned into Hind
III/Sac I-digested MMTV-luc plasmid. Plasmids were isolated using the Qiagen maxi-prep and designated MMTV-
119.
|
Data analysis. Results are means ± SE of three to seven experiments. Paired evaluations for the Northern analysis and hyperoxia transfection experiments were made for experimental and control conditions within each experiment, and significance was determined by Student's t-test. For the transfection experiments performed with multiple concentrations of hydrogen peroxide, an analysis of variance with a priori comparisons was performed. The post hoc test was accomplished using pairwise comparisons with a Mann-Whitney U and a Bonferroni adjustment. Statistical significance was set at P < 0.05, and trends were present with 0.05 < P < 0.10.
| |
RESULTS |
|---|
|
|
|---|
Effects of hyperoxia on Na-K-ATPase steady-state mRNA
levels. Previous studies have shown that hyperoxia
increased the steady-state levels of Na-K-ATPase
1 and
1 mRNA in intact rat lung and
primary cultures of rat alveolar epithelial cells (2, 3, 15, 27). We
hypothesized that hyperoxia can increase Na-K-ATPase mRNA steady-state levels in MDCK cells and that this occurs by an increase in
transcription. The canine kidney epithelial cell line (MDCK) has
abundant Na-K-ATPase mRNA and protein and has increased ion and fluid
transport in the presence of hyperoxia (8). MDCK cells were exposed to
normoxia or hyperoxia (95% O2-5%
CO2) for 24 and 48 h. Northern
analysis of total RNA revealed that hyperoxia increased
1 and
1 mRNA in MDCK cells 3.4 ± 1.2- and 5.2 ± 1.1-fold, respectively, over control conditions at
24 h (Fig. 3). The increase in the
1 mRNA steady-state levels
showed a statistical trend but was not statistically significant
(P < 0.10). The increased
mRNA levels in MDCK cells remained elevated 3.4-fold at 48 h for the
1-subunit but decreased to a
1.4-fold elevation in the
1-subunit compared with
normoxic controls (Fig. 3).
|
Effects of hyperoxia on Na-K-ATPase mRNA
stability. Hyperoxia can increase the stability of
specific mRNAs in certain tissues, such as catalase in the lung (5). To
determine whether the increase in Na-K-ATPase steady-state level of
mRNA was due to an increase in mRNA stability, hyperoxic and normoxic
MDCK cells were incubated in actinomycin D to inhibit RNA synthesis,
and Na-K-ATPase mRNA half-lives were measured. Half-lives were measured using previously published methods, by normalizing each time point by
the zero time point for that specific condition (normoxia or hyperoxia). The IOD at various time points was plotted on a log scale,
and the half-lives were calculated. Because the observed half-life of
Na-K-ATPase was relatively short, it was unlikely that the inhibition
of the synthesis of potential regulatory proteins influenced the
Na-K-ATPase half-life. Superinduction in the first hour of actinomycin
D treatment, which has been described by others (4), was not seen,
since our first time point occurred at 2 h of treatment. Half-life
determinations did not identify any differences between normoxia or
hyperoxia of either the
1 or
1 mRNA subunits (Fig.
4) with or without time point zero to
eliminate any potential effect of superinduction. The mRNA half-lives
of the
1-subunit were 4.4 h
(r = 0.96) and 4.7 h
(r = 0.90) in normoxia and hyperoxia,
respectively. Similarly, the
1-subunit mRNA half-lives were
5.9 h (r = 0.78) in normoxia and 6.2 h
(r = 0.80) in hyperoxia. Thus
hyperoxia did not increase the stability of either the
1 or
1 mRNAs, suggesting that the
increased steady-state mRNA levels were due to increased transcription.
|
Effects of hyperoxia on Na-K-ATPase
1 gene transcription.
We studied the transcription of the
1-subunit since it had a
greater and more sustained increase in steady-state levels of mRNA
compared with the
1-subunit. To
determine whether the increase in Na-K-ATPase
1 mRNA was due to increased
transcription, MDCK cells were transiently transfected with an
expression vector construct of the
1 promoter linked to a
luciferase reporter gene. Transfection with the
1-817 promoter construct
revealed a 1.9 ± 0.2-fold increase in luciferase activity in the
presence of hyperoxia compared with normoxia (Table
1).
|
1-102 and
1-41 bp). Promoter sequence analysis showed putative binding sites for redox-sensitive
transcription factors on the
1
promoter. Two consensus sequences for the ARE were located at
790 and
434. In addition, there was a consensus sequence
for NF
B at
796. If hyperoxia acted through these putative sites, then neither deletion mutant would have increased its promoter activity with hyperoxia (Fig. 5). In
normoxic MDCK cells, the basal promoter activity decreased as the
5' promoter size decreased (Table 1). The
1-102 deletion construct had
62.1% of the promoter activity of the wild-type construct, and the
1-41 deletion construct had
2.7% activity. In the presence of hyperoxia, promoter activity was
induced 1.9 ± 0.3-fold in the
1-102 deletion mutant, similar to the induction seen in the wild-type construct, even though this
deletion construct eliminated the putative ARE and NF
B sites. In
contrast, the
1-41 deletion
mutant had no inducible promoter activity with hyperoxia (Table 1).
Thus the region between
41 and
102 both contributed to
basal activity of the promoter and was necessary for the increase in
promoter activity by hyperoxia. This result also indicated that the
hyperoxic effect did not require the putative ARE and NF
B sites.
|
1
promoter identified a 61-bp region (
102 to
41) that was
necessary for the induction in promoter activity by hyperoxia. To
confirm that the 61-bp
1
promoter region identified (
102 to
41) was specific for
hyperoxia induction, a 119-bp oligonucleotide spanning this region
(
157 to
38) was subcloned into a luciferase vector
containing the minimal promoter of the MMTV (designated MMTV-
119).
The MMTV plasmid consisted of 119 bp of the proximal promoter of the
MMTV in a luciferase vector. Transfection experiments with the MMTV plasmid alone revealed minimal promoter activity that was not inducible
by hyperoxia, whereas transfection with MMTV-
119 showed an increase
in promoter activity in normoxia that was induced an additional 2.3 ± 0.2-fold in the presence of hyperoxia. This induction by
hyperoxia was identical to that seen in the native Na-K-ATPase
promoter, confirming that this region is specific and sufficient for
the hyperoxia induction.
Effects of hydrogen peroxide on Na-K-ATPase gene
transcription. There are multiple mechanisms by which
hyperoxia could affect gene expression, including specific oxidants and
partial pressure of oxygen or indirectly through cellular injury.
Because hyperoxia can generate reactive oxygen species, including
hydrogen peroxide, one possibility was that hyperoxia induced gene
transcription through the effect of hydrogen peroxide on the
1 promoter. Hydrogen peroxide
has high cellular permeability and activates the ARE in other genes
(33). To test this possibility, we transfected MDCK cells with the
1-817 construct in the presence
of hydrogen peroxide for 48 h at concentrations known to activate the
ARE in other cell systems and measured promoter activity. At low
concentrations of hydrogen peroxide, cells proliferated and became
confluent, whereas cellular injury was evident at higher concentrations
(50 µM), since cells were observed to be 50-60% confluent after
48 h of hydrogen peroxide exposure. Hydrogen peroxide did not increase promoter activity in cells transfected with the
1-817 at any concentration
(Fig. 6), even after correcting for total
protein, which decreased with the higher concentrations of hydrogen
peroxide. There was a slight increase in promoter activity at the 10 µM dose; however, this was not statistically significant and was much
less than the hyperoxic induction. Therefore, the increase in
1 promoter activity in
hyperoxia does not appear to be mediated via hydrogen peroxide. This
lack of hydrogen peroxide response, along with the 5' deletion
studies, indicated that the two putative ARE consensus sites were not
responsible for the hyperoxic response.
|
| |
DISCUSSION |
|---|
|
|
|---|
Oxidant injury can oxidize regulatory proteins, disrupt the cell membrane, and subsequently perturb intracellular ion concentrations. Upregulation of cellular mechanisms to maintain Na and ion concentrations would be essential to preserve cellular and organ homeostasis. Determining the effects of oxidant injury on the Na-K-ATPase is of major importance, since the Na-K-ATPase, along with the Na channel, are key proteins in maintaining intracellular Na homeostasis and in vectorial Na transport. Previous studies have shown that hyperoxia and other oxidants can upregulate the Na-K-ATPase and the Na channel (2, 12, 15, 25, 39).
The effects of oxidant injury on the Na-K-ATPase are complex. Hyperoxia increased Na-K-ATPase mRNA steady-state levels consistently in type II cells and MDCK cells (3, 7, 12, 27). It is unclear whether this was a direct effect of oxygen tension or was due to the production of reactive oxygen species (ROS). The effects of oxidant injury on Na-K-ATPase protein concentrations and activity likely depend on the type and concentration of oxidant species, cell or tissue type, duration of injury, and available antioxidant defenses. As an example, subacute hyperoxia increased Na-K-ATPase protein concentrations and pump activity in alveolar epithelial cells, whereas higher concentrations of sustained hyperoxia suppressed protein concentration, which then increased in recovery (3, 27, 30). Duration of exposure may also be important, since short durations of hyperbaric oxygen increased activity in both cerebrocortical membranes and alveolar epithelial cells (12, 42). Na-K-ATPase activity has a variable response to reactive oxygen species, depending on the specific oxygen species and cell type. Cardiac myocytes decrease Na-K-ATPase activity in the presence of xanthine/xanthine oxidase, whereas hydrogen peroxide increases activity in vascular endothelial cells (8, 39).
The functional significance of the increased pump transcription with hyperoxia is uncertain. Our preliminary data (not shown) did not demonstrate an increase in Na-K-ATPase protein concentrations in MDCK cells exposed to 24-48 h of hyperoxia. However, this may be due to a suppression of translation or increased protein degradation by oxidants, as previously reported for the isolated Na pump (38). The increased transcription could play an important role in maintaining normal protein levels. Alternatively, the increase in Na-K-ATPase mRNA may prime the cell with available mRNA ready for protein synthesis once the ROS are cleared, similar to the results seen in alveolar epithelial cells.
Oxidant stress or hyperoxia increases the expression of multiple genes in many different tissues. Many genes regulated by hyperoxia or oxidants are involved in the antioxidant response. These genes include the tissue inhibitor of metalloproteinases in mesenchymal cells and manganese superoxide dismutase and catalase in kidney and lung epithelial cells (14). The magnitude of the effect of hyperoxia or oxidants on gene expression typically is three- to sixfold for antioxidant enzymes (14), in contrast to larger increases for heat shock protein genes and other stress response genes (14). Other classes of genes not involved in the antioxidant process, but necessary for cellular and organ homeostasis, such as the Na-K-ATPase or surfactant, are upregulated by hyperoxia or oxidants as well. The magnitude of gene induction in these genes tends to be similar to that of antioxidant enzyme genes and less than the induction of stress response genes.
We previously reported that hyperoxia increased the steady-state level of Na-K-ATPase mRNA in rat lung in vivo (27) and rat alveolar epithelial cells in vitro (2, 3) three- to fivefold. Similarly, we now demonstrate that this increased gene expression also occurred in MDCK cells using a model of in vitro hyperoxia. These renal tubular epithelial cells are responsible for vectoral Na transport and have abundant Na-K-ATPase (7). In addition, hyperoxia upregulated fluid transport in MDCK cells as indicated by the formation of domes in the presence of hyperoxia (7). We believe this degree of gene upregulation is physiologically significant because 1) it is similar to the extent of upregulation observed for some antioxidant enzymes upregulated by oxidants or hyperoxia (33), 2) it is similar to the degree of upregulation in Na-K-ATPase gene expression in other physiological states such as changes in intracellular ion concentration or hormonal stimulation (9, 32), and 3) the relatively high basal gene expression of Na-K-ATPase suggests that a small change in gene expression may induce relatively large changes in steady-state protein levels, although this may not occur until the cell is recovering from the oxidant stress.
To determine whether the increase in Na-K-ATPase mRNA steady-state
levels in MDCK cells was due to transcriptional or posttranscriptional regulation, we measured the mRNA half-lives of the Na-K-ATPase subunits
in normoxia and hyperoxia. The mRNA half-lives of some genes increased
in the presence of hyperoxia, such as catalase (5); however, hyperoxia
did not change the half-lives of either Na-K-ATPase subunit mRNA in our
studies. To determine whether the increased mRNA levels were due to
transcription, we transfected MDCK cells with a
1-subunit promoter-reporter
construct and measured promoter activity in normoxia and hyperoxia. Our
studies focused on the
1
promoter, since it had a greater and more sustained increase in
steady-state levels of mRNA. Transfection experiments demonstrated an
almost twofold increase in promoter activity in our wild-type construct
containing 817 bp upstream of the transcription initiation site. With
the use of deletion mutants of the
1 promoter, we localized a
61-bp region between
102 and
41 that was necessary for
this hyperoxia effect.
Transcription of many genes in prokaryotes and eukaryotes can be
induced by oxygen partial pressure or ROS. The mechanism most clearly
was described for the oxy-R regulon in E. coli. In this system, the oxidation of the oxy-R
protein caused a conformational change of this protein, while
constitutively bound to DNA, which increased transcription of several
antioxidant enzyme genes (35). In eukaryotes, oxygen tension regulated
the erythropoietin gene expression via the hypoxia-inducible factor-1
transcription factor (10). The best-characterized eukaryotic system
with oxidant regulation of gene expression is the ARE (33).
Transcription of the glutathione
S-reductase Ya subunit and
NADPH-quinone reductase genes were upregulated by hydrogen peroxide and
other aromatic organic redox compounds through an active ARE (33).
Several other eukaryotic transcription factors are functionally altered by the redox state, including AP-1 and NF
B, and play a role in the
gene induction by reactive oxygen species (26). NF
B was activated by
ROS in many cell types, including the kidney and the lung, and has been
linked to the upregulation of nitric oxide synthase expression and the
induction of lung inflammation (1).
Relatively little is known about the regulation of transcription of the
Na-K-ATPase subunits. Current knowledge of the
1 promoter region is summarized
in Table 2. There are several putative sites for redox regulation of the
1-subunit gene, since the
promoter contains two partial consensus sequences for ARE and one for
NF
B. We localized an area necessary for the regulation by hyperoxia to a 61-bp region between
41 and
102 bp. This region is
distinct from the location of the putative consensus sequences for an
ARE (
790 and
434) and NF
B (
796). To test
directly whether the ARE consensus sequence was active, the impact of
hydrogen peroxide exposure was assessed, since hydrogen peroxide
activated the ARE in other cell systems (33). In our system, hydrogen
peroxide did not activate transcription of the
1-817 construct containing the
putative ARE sites and our identified hyperoxia site (
102 to
41). Although there was a small increase in promoter activity at
10 µM hydrogen peroxide, this was not statistically significant or
was not as large as the hyperoxia effect. Therefore, the induction by
hyperoxia is not mediated through hydrogen peroxide or through the
putative ARE sites.
|
Sequence homology analysis of the 61-bp hyperoxic regulatory region
(
41 to
102) did not identify other consensus sequences with possible oxygen or oxidant sensitivity, such as AP-1 or NF
B. This 61-bp promoter region is very GC rich and has several partial consensus sequences for the SP1 transcription factor. SP1 is a common
transcription factor that serves as a regulatory site for basal
promoter activity. SP1 transcription factors can be involved in oxidant
gene regulation, since they contain thiol groups that are redox
susceptible when the factor is in its unbound state (19). In addition,
they may serve as a transcription cofactor for sites of promoter
induction (17). Each putative SP1 site identified on this 61-bp
1 promoter region has a
consensus for five of the six core bases but much less homology for the
two flanking bases on each side of the core. These SP1 sites may
represent possible primary redox regulatory sites for hyperoxia, acting as a transcription cofactor for hyperoxia, or the induction by hyperoxia may act through a unique, previously undefined mechanism.
The Na-K-ATPase is an important protein for vectoral ion and fluid
transport and for maintaining cellular homeostasis, especially in the
face of injury. Models of renal reperfusion have identified oxidant-induced upregulation of several genes, such as superoxide dismutase, that may be protective to further oxidant injury (40). The
upregulation of kidney Na-K-ATPase during oxidant injury may play a
role in preserving cellular homeostasis and in maintaining normal Na
balance. In this model system, we demonstrated that hyperoxia increased
Na-K-ATPase gene expression and transcription of the
1-subunit and localized one
region of the
1 promoter required for this response. Future identification of the transcription factors and core sequence involved in this induction by hyperoxia will
add to our growing knowledge of oxygen and oxidant effects on gene
transcription.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Peter Bitterman for critical review of the manuscript, Kay Savik for statistical analysis, and Rosalyn Washington for help in manuscript preparation.
| |
FOOTNOTES |
|---|
C. H. Wendt was supported by National Institutes of Health (NIH) Grant K08-HL-03114-01 and by an American Heart Association (AHA) Research Grant-in-Aid. D. H. Ingbar was supported by a grant from NIH-Specialized Center of Research, an American Lung Association Clinical Investigator Award, and an AHA Research Grant-in-Aid.
Address for reprint requests: C. H. Wendt, Box 276 University of Minnesota Heath Center, 420 Delaware St. SE, Minneapolis, MN 55455.
Received 11 November 1996; accepted in final form 22 October 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Blackwell, T. S.,
T. R. Blackwell,
E. P. Holden,
B. W. Christman,
and
J. W. Christman.
In vivo antioxidant treatment suppresses nuclear factor-kappa B activation and neutrophilic lung inflammation.
J. Immunol.
157:
1630-1637,
1996[Abstract].
2.
Carter, E. P.,
S. E. Duvick,
C. H. Wendt,
J. Dunitz,
L. Nici,
O. D. Wangensteen,
and
D. H. Ingbar.
Hyperoxia increases active alveolar Na+ resorption in vivo and type II cell Na,K-ATPase in vitro.
Chest
105:
75S-78S,
1994.
3.
Carter, E. P.,
O. D. Wangensteen,
S. M. O'Grady,
and
D. H. Ingbar.
Effects of hyperoxia on type II cell Na-K-ATPAse function and expression.
Am. J. Physiol.
272 (Lung Cell. Mol. Physiol. 16):
L542-L551,
1997
4.
Chambers, S. K.,
M. Gilmore-Hebert,
B. M. Kacinski,
and
E. J. Benz.
Changes in Na,K-ATPase gene expression during granulocytic differentiation of HL60 cells.
Blood
80:
1559-1564,
1992
5.
Clerch, L. B.,
and
D. Massoro.
Oxidation-reduction-sensitive binding of lung protein to rat mRNA.
J. Biol. Chem.
267:
2853-2855,
1992
6.
Correa-Rotter, R.,
C. N. Mariash,
and
M. E. Rosenberg.
Loading and transfer control for northern hybridization.
Biotechniques
12:
154-158,
1992[Medline].
7.
Dreher, D.,
and
T. Tochat.
Hyperoxia induces alkalinization and dome formation in MDCK epithelial cells.
Am. J. Physiol.
262 (Cell Physiol. 31):
C358-C364,
1992
8.
Elliott, S. J.,
and
W. P. Schilling.
Oxidant stress alters Na+ pump and Na+-K+-Cl
cotransporter activities in vascular endothelial cells.
Am. J. Physiol.
263 (Heart Circ. Physiol. 32):
H96-H102,
1992
9.
Gick, G. G.,
F. Ismail-Beigi,
and
I. S. Edelman.
Thyroidal regulation of rat renal and hepatic Na,K-ATPase gene expression.
J. Biol. Chem.
263:
16610-16618,
1988
10.
Goldberg, M. A.,
S. P. Dunning,
and
H. F. Bunn.
Regulation of the erythropoietin gene: evidence that the oxygen sensor is a heme protein.
Science
242:
1412-1414,
1988
11.
Gonzalez-Flecha, B.,
P. Evelson,
K. Ridge,
and
J. I. Sznajder.
Hydrogen peroxide increases Na+/K+-ATPase function in alveolar type II cells.
Biochim. Biophys. Acta
1290:
46-52,
1996[Medline].
12.
Harris, Z. L.,
K. M. Ridge,
B. Gonzalez-Flecha,
L. Gottlieb,
A. Zucker,
and
J. I. Sznajder.
Hyperbaric oxygenation upregulates rat lung Na,K-ATPase.
Eur. Respir. J.
9:
472-477,
1996[Abstract].
13.
Horisberger, J.,
V. Lemas,
J.-P. Kraehenbuhl,
and
B. C. Rossier.
Structure-function relationship of Na,K-ATPase.
Annu. Rev. Physiol.
53:
565-584,
1991[Medline].
14.
Horowitz, S.,
N. Dafni,
D. L. Shapiro,
B. A. Holm,
R. H. Notter,
and
D. J. Quible.
Hyperoxic exposure alters gene expression in the lung: induction of the tissue inhibitor of metalloproteinases mRNA and other mRNAs.
J. Biol. Chem.
264:
7092-7095,
1989
15.
Ingbar, D. H.,
S. E. Duvick,
C. H. Wendt,
and
L. Nici.
Hyperoxia in vitro increases type II cell Na,K-ATPase (Abstract).
Am. Rev. Respir. Dis.
147:
A1007,
1993.
16.
Ingbar, D. H.,
C. B. Weeks,
M. Gilmore-Hebert,
E. Jacobsen,
S. Duvick,
R. Dowin,
S. K. Savik,
and
J. D. Jamieson.
Developmental regulation of Na,K-ATPase in rat lung.
Am. J. Physiol.
270 (Lung Cell. Mol. Physiol. 14):
L619-L629,
1996
17.
Karlsleder, J.,
H. Rotheneder,
and
E. Wintersberger.
Interaction of Sp1 with the growth- and cell cycle-regulated transcription factor E2F.
Mol. Cell. Biol.
16:
1659-1667,
1996
19.
Knoepfel, L.,
C. Steinkuhler,
M. T. Carri,
and
G. Rotilio.
Role of zinc-coordination and of the glutathione redox couple in the redox susceptibility of human transcription factor Sp1.
Biochem. Biophys. Res. Commun.
210:
871-877,
1994.
20.
Kobayashi, M.,
and
K. Kawakami.
ATF-1CREB heterodimer is involved in constitutive expression of the housekeeping Na,K-ATPase
1 subunit gene.
Nucleic Acids Res.
23:
2848-2855,
1995
21.
Kukreja, R. C.,
A. B. Weaver,
and
M. L. Hess.
Sarcolemmal Na+-K+-ATPase: inactivation by neutrophil-derived free radicals and oxidants.
Am. J. Physiol.
259 (Heart Circ. Physiol. 28):
H1330-H1336,
1990
22.
Lingrel, J. B.,
J. Orlowski,
M. M. Shull,
and
E. M. Price.
Molecular genetics of Na,K-ATPase.
Prog. Nucleic Acids Res.
38:
37-89,
1990.[Medline]
23.
Liu, B.,
and
G. Gick.
Characterization of the 5' flanking region of the rat Na+/K+-ATPase
1 subunit gene.
Biochim. Biophys. Acta
1130:
336-338,
1992[Medline].
24.
McDonough, A. A.,
M. J. Tang,
and
L. Lescale-Matys.
Ionic regulation of the biosynthesis of Na,K-ATPase subunits.
Semin. Nephrol.
10:
400-409,
1990[Medline].
25.
Meharg, J. V.,
J. McGowan-Jordan,
A. Charles,
J. T. Parmelee,
M. V. Cutaia,
and
S. Rounds.
Hydrogen peroxide stimulates sodium-potassium pump activity in cultured pulmonary arterial endothelial cells.
Am. J. Physiol.
265 (Lung Cell. Mol. Physiol. 9):
L613-L621,
1993
26.
Meyer, M.,
R. Schreck,
and
P. A. Baeuerle.
H2O2 and antioxidants have opposite effects on activation of Nfnd AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor.
EMBO J.
12:
2005-2015,
1993[Medline].
27.
Nici, L.,
R. Dowin,
M. Gilmlore-Hebert,
J. D. Jamieson,
and
D. H. Ingbar.
Upregulation of rat lung Na-K-ATPase during hyperoxic injury.
Am. J. Physiol.
261 (Lung Cell. Mol. Physiol. 5):
L307-L314,
1991
28.
Nogee, L. M.,
J. R. Wispe,
J. C. Clarke,
T. E. Weaver,
and
J. A. Whitsett.
Increased expression of pulmonary surfactant proteins in oxygen-exposed rats.
Am. J. Respir. Cell Mol. Biol.
4:
102-107,
1991.
29.
Olivera, W. G.,
K. M. Ridge,
and
J. I. Sznajder.
Lung liquid clearance and Na,K-ATPase during acute hyperoxia and recovery in rats.
Am. J. Respir. Crit. Care Med.
152:
1229-1234,
1995[Abstract].
30.
Olivera, W. G.,
K. M. Ridge,
L. D. H. Wood,
and
J. I. Sznajder.
Active sodium transport and alveolar epithelial Na-K-ATPase increase during subacute hyperoxia in rats.
Am. J. Physiol.
266 (Lung Cell. Mol. Physiol. 10):
L577-L584,
1994
31.
Orlowski, J.,
and
J. B. Lingrel.
Thyroid and glucocorticoid hormones regulate the expression of multiple Na,K-ATPase genes in cultured neonatal rat cardiac myocytes.
J. Biol. Chem.
265:
3462-3470,
1990
32.
Qin, X.,
B. Liu,
and
G. Gick.
Low external K+ regulates Na,K-ATPase
1 and
1 gene expression in rat cardiac myocytes.
Am. J. Hypertens.
7:
96-99,
1994[Medline].
32a.
Robison, T. W.,
and
K.-J. Kim.
Enhancement of airway epithelial Na+,K+-ATPAse activity by NO2 and protective role of nordihydroguaiaretic acid.
Am. J. Physiol.
270 (Lung Cell. Mol. Physiol. 14):
L266-L272,
1996
33.
Rushmore, T. H.,
M. R. Morton,
and
C. B. Pickett.
The antioxidant responsive element.
J. Biol. Chem.
266:
11632-11639,
1991
34.
Skou, J. C.
Overview. The Na,K-pump.
Methods Enzymol.
156:
1-25,
1988[Medline].
35.
Storz, G.,
L. Tartaglia,
and
B. Ames.
Transcriptional regulator of oxidative stress-inducible genes: direct activation by oxidation.
Science
248:
189-194,
1990
36.
Sznajder, J. I.,
W. G. Olivera,
K. M. Ridge,
and
D. H. Rutschman.
Mechanisms of lung liquid clearance during hyperoxia in isolated rat lungs.
Am. J. Respir. Crit. Care Med.
151:
1519-1525,
1995[Abstract].
37.
Thomas, C. E.,
and
D. J. Reed.
Radical-induced inactivation of kidney Na+,K+-ATPase: sensitivity to membrane lipid peroxidation and the protective effect of vitamin E.
Arch. Biochem. Biophys.
281:
96-105,
1990[Medline].
38.
Wu-Hsiung, H.,
Y. Wang,
and
A. Askari.
(Na+ + K+)-ATPase: inactivation and degradation induced by oxygen radicals.
Int. J. Biochem.
24:
621-626,
1992[Medline].
39.
Xie, Z.,
Y. Wang,
A. Askari,
W. Huang,
J. E. Klaunig,
and
A. Askari.
Studies on the specificity of the effects of oxygen metabolites on cardiac sodium pump.
J. Mol. Cell. Cardiol.
22:
911-920,
1990[Medline].
40.
Yoshioka, T.,
T. Homma,
B. Meyrick,
M. Takeda,
T. M. Jarrett,
V. Kon,
and
I. Ichikawa.
Oxidants induce transcriptional activation of manganese superoxide dismutase in glomerular cells.
Kidney Int.
46:
405-413,
1994[Medline].
41.
Yue, G.,
W. J. Russell,
D. J. Benos,
R. M. Jackson,
M. A. Olman,
and
S. Matalon.
Increased expression and activity of sodium channels in alveolar type II of hyperoxic rats.
Proc. Natl. Acad. Sci. USA
92:
8418-8422,
1995
42.
Yufu, K.,
T. Itoh,
R. Edamatsu,
A. Mori,
and
M. Hirakawa.
Effect of hyperbaric oxygenation on the Na+, K+-ATPase and membrane fluidity of cerebrocortical membranes after experimental subarachnoid hemorrhage.
Neurochem. Res.
18:
1033-1039,
1993[Medline].
This article has been cited by other articles:
![]() |
R. J. Clifford and J. H. Kaplan Regulation of Na,K-ATPase Subunit Abundance by Translational Repression J. Biol. Chem., August 21, 2009; 284(34): 22905 - 22915. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Matlhagela and M. Taub Regulation of the Na-K-ATPase beta1-subunit promoter by multiple prostaglandin-responsive elements Am J Physiol Renal Physiol, September 1, 2006; 291(3): F635 - F646. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hao, C. H. Wendt, G. Sandhu, and D. H. Ingbar Dexamethasone stimulates transcription of the Na+-K+-ATPase {beta}1 gene in adult rat lung epithelial cells Am J Physiol Lung Cell Mol Physiol, September 1, 2003; 285(3): L593 - L601. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. I. Sznajder, P. Factor, and D. H. Ingbar Lung Edema Clearance: 20 Years of Progress: Invited Review: Lung edema clearance: role of Na+-K+-ATPase J Appl Physiol, November 1, 2002; 93(5): 1860 - 1866. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Bremner, T. Freywald, H. M. O'Brodovich, and G. Otulakowski Promoter analysis of the gene encoding the beta -subunit of the rat amiloride-sensitive epithelial sodium channel Am J Physiol Lung Cell Mol Physiol, January 1, 2002; 282(1): L124 - L134. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Clanton, V. P. Wright, P. J. Reiser, P. F. Klawitter, and N. R. Prabhakar Physiological and Genomic Consequences of Intermittent Hypoxia: Selected Contribution: Improved anoxic tolerance in rat diaphragm following intermittent hypoxia J Appl Physiol, June 1, 2001; 90(6): 2508 - 2513. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wodopia, H. S. Ko, J. Billian, R. Wiesner, P. Bartsch, and H. Mairbaurl Hypoxia decreases proteins involved in epithelial electrolyte transport in A549 cells and rat lung Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1110 - L1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Green, B. Roy, S. Grant, M. Burnett, R. Tupling, C. Otto, A. Pipe, and D. McKenzie Downregulation in muscle Na+-K+-ATPase following a 21-day expedition to 6,194 m J Appl Physiol, February 1, 2000; 88(2): 634 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chalaka, D. H. Ingbar, R. Sharma, Z. Zhau, and C. H. Wendt Na+-K+-ATPase gene regulation by glucocorticoids in a fetal lung epithelial cell line Am J Physiol Lung Cell Mol Physiol, July 1, 1999; 277(1): L197 - L203. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Wendt, R. Sharma, H. Towle, G. Gick, and D. H. Ingbar Hyperoxia Upregulated Na,K-Adenosine Triphosphatase {beta}1 Gene Transcription Chest, July 1, 1999; 116 (2009): 87S - 88S. [Full Text] |
||||
![]() |
Z. Borok, S. Mihyu, V. F. J. Fernandes, X.-L. Zhang, K.-J. Kim, and R. L. Lubman KGF prevents hyperoxia-induced reduction of active ion transport in alveolar epithelial cells Am J Physiol Cell Physiol, June 1, 1999; 276(6): C1352 - C1360. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Green, J. MacDougall, M. Tarnopolsky, and N. L. Melissa Downregulation of Na+-K+-ATPase pumps in skeletal muscle with training in normobaric hypoxia J Appl Physiol, May 1, 1999; 86(5): 1745 - 1748. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhuang, C. Wendt, and G. Gick Regulation of Na,K-ATPase beta 1 Subunit Gene Transcription by Low External Potassium in Cardiac Myocytes. ROLE OF Sp1 AND Sp3 J. Biol. Chem., July 28, 2000; 275(31): 24173 - 24184. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Wendt, G. Gick, R. Sharma, Y. Zhuang, W. Deng, and D. H. Ingbar Up-regulation of Na,K-ATPase beta 1 Transcription by Hyperoxia Is Mediated by SP1/SP3 Binding J. Biol. Chem., December 22, 2000; 275(52): 41396 - 41404. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |