|
|
||||||||
Division of Nephrology, Department of Medicine, San Francisco General Hospital and Biomedical Sciences Program, University of California, San Francisco, California 94143
| |
ABSTRACT |
|---|
|
|
|---|
A6 cells, derived from Xenopus laevis renal tubule, form a high-resistance ion-transporting monolayer when grown on permeable supports and can generate a short-circuit current (SCC) that is stimulated by high levels of the mineralocorticoid aldosterone. Surprisingly, A6 SCC is more responsive to glucocorticoids than to mineralocorticoids, suggesting the possibility that these cells do not contain transcriptionally active mineralocorticoid receptor (MR) and that glucocorticoid receptor (GR) mediates MR-like responses in these collecting duct-like cells. We have examined the response of both SCC and a transfected reporter gene to mineralocorticoids and glucocorticoids in the presence and absence of transfected rat MR (rMR). We found that, in the absence of transfected MR, a reporter gene that can be activated by MR or GR was more responsive to glucocorticoids such as dexamethasone and RU-28362 than to mineralocorticoids such as aldosterone. Transfected rMR underwent mineralocorticoid-dependent nuclear localization and restored both transcriptional sensitivity of a reporter gene and SCC response to mineralocorticoids. These data demonstrate that A6 cells contain transcriptionally active GR but not MR and thus suggest a molecular basis for the defect in A6 cell SCC response to aldosterone. Our results also demonstrate that GR is capable of mediating hormone stimulation of SCC, a classic mineralocorticoid response. Finally, the observation that heterologous expression of rMR can localize normally to the A6 nucleus in a hormone-dependent fashion and restore both the transcriptional and SCC response to mineralocorticoids suggests that MR function is conserved in species as distantly related as toads and mammals.
dexamethasone; sodium transport; short-circuit current; transcriptional activation; nuclear localization; glucocorticoid receptor; species specificity
| |
INTRODUCTION |
|---|
|
|
|---|
ELECTROGENIC SODIUM TRANSPORT in intact renal
collecting duct is stimulated by mineralocorticoids such as aldosterone
or desoxycorticosterone but not by glucocorticoids such as
corticosterone, dexamethasone, or RU-28362 (34). This specificity is,
at least in part, determined by the selective inactivation of
glucocorticoids by the enzyme 11-
-hydroxysteroid dehydrogenase
(11-HSD) (14, 18). In the absence of 11-HSD, endogenous glucocorticoids
such as corticosterone and cortisol bind with high affinity and
activate mineralocorticoid receptor (MR), thus leading to induction of
mineralocorticoid effects. A defect in 11-HSD has been shown to
underlie the disease called apparent mineralocorticoid
excess (15, 17, 35, 54). However, whether the endogenous
glucocorticoids can act through glucocorticoid receptor (GR) to mediate
mineralocorticoid-like effects has been controversial (16, 30, 36, 47).
MR and GR bind to and stimulate transcription from a common DNA site (see Ref. 38 for review) and, moreover, in some cell culture models of Na transport GR has been found to mediate MR-like effects, e.g., in primary cultures of rabbit cortical collecting duct, Na transport was found to be stimulated by both glucocorticoids and mineralocorticoids (36), whereas, in stable lines such as M1 and A6, the response was actually more sensitive to stimulation by glucocorticoids and the response to aldosterone occurred only at high concentrations capable of activating GR (47, 48, 53). These surprising observations suggested that not only could GR mediate classic mineralocorticoid responses but, moreover, the stable cell lines M1 and A6, which demonstrate a number of differentiated properties of cortical collecting duct (notably morphological features and the capacity to form a high-resistance monolayer capable of steroid responsive vectoral Na transport), lacked the capacity to mediate a mineralocorticoid response through MR. Whether this inability to demonstrate an MR-mediated response was due to an intrinsic defect in MR or a defect elsewhere in the signal transduction pathway has not been determined. Indeed, receptors with hormone-binding characteristics of MR present in A6 cells suggested that the lack of MR response is not due to a lack of MR expression (10, 47, 53).
There are at least three possible explanations for the observations: 1) there is a block in the signal transduction pathway extrinsic to the receptor, 2) GR not MR is the normal mediator of changes in ion transport in Xenopus kidney, and 3) there is an intrinsic defect in either receptor number or in its ability to activate transcription. We set out to distinguish these possibilities and, furthermore, to determine whether the MR signal transduction machinery was sufficiently well preserved that rat MR (rMR) would function in Xenopus collecting duct cells. We report here that A6 cells are deficient in transcriptionally competent MR and that rMR is able to complement this defect and function normally with respect to nuclear localization, transcriptional activity, and stimulation of short-circuit current (SCC).
| |
METHODS |
|---|
|
|
|---|
Cell culture and transfection. A6
cells were originally obtained from the American Type Culture
Collection. Passages from 75 to 86 were used for all experiments in
this study. Cells were maintained in
75-cm2 plastic cell culture flasks
(Falcon) at 28°C in a humidified incubator with 1%
CO2 in air. The culture medium was
a mixture of Dulbecco's modified Eagle's medium
(DME-H16) with 1 g/l glucose, 2× DME-H16 without
glucose and without bicarbonate (University of California San Francisco
Cell Culture Facility) supplemented with 5% fetal calf serum (GIBCO
BRL), L-glutamine (2 mM; GIBCO BRL), and
N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic
acid buffer (25 mM; GIBCO BRL). Cells were transfected by the
lipofectAMINE method as described (GIBCO BRL). For transient
transfection, 20 ng of reporter TAT3-LUC (31) with or without 10 ng
rMR-expressing plasmid (6RMR) were used. Rous sarcoma virus-
-gal
plasmid (20 ng) was included as an internal standard, and the
Bluescript KS
vector plasmid was used as carrier to bring the
total amount of DNA to 1 µg. Fresh medium containing 5% stripped
serum (charcoal treated to remove endogenous steroids) was added to
cells 18 h before transfection. Cells were incubated in the medium
containing DNA-lipid complexes for 5 h. Cells were then washed two
times in phosphate-buffered saline (PBS) and refed with fresh stripped medium. Sixteen hours later, medium containing specific steroids was
added to one of two identical transfections; 24 h later cells were
harvested, and extracts were prepared as previously described (31). The
extracts were assayed for luciferase activity and were normalized to
protein content and to
-galactosidase activity (expression driven by
the Rous sarcoma virus promoter). To obtain stable rMR-expressing cell
clones, 1 µg of pCMV-neo-rMR or the vector plasmid pCMV4/neo was
used. Two days after transfection, the cytotoxic neomycin analog G418
was introduced into culture medium at the concentration of 1,000 µg/ml. G418-resistant individual clones were obtained by modifying
the limiting dilution method (19). Each clone was cultured and
expanded. Each clone was then transiently transfected with TAT3-LUC,
and luciferase activity was assayed to identify the rMR-expressing
clones. A total of 11 G418-resistant clones were isolated. Among those,
five clones showed at least twofold higher reporter activity than the
mock-transfected cells.
Plasmid construction. The plasmid pCMV-neo-rMR was constructed by inserting the rMR cDNA into pCMV4/neo plasmid (a generous gift from Dr. Mark Goldsmith). The rMR fragment from pC7/MR (40) was first excised by Not I digestion, and the digested Not I site was filled in by Klenow. The DNA was then cut with Spe I. This blunt-ended Not I/Spe I MR fragment was then ligated with pCMV4/neo plasmid DNA previously digested with Xba I and Sma I. The plasmid pEGFP-rMR, containing sequences encoding jellyfish green fluorescent protein (GFP) (8, 23) fused to full-length rMR, was constructed by inserting the rMR cDNA fragment into pEGFP-C1 (Clontech). This construct was made using the following procedures. 1) The sequence from amino acid 1 to the Nco I site in MR was first amplified by polymerase chain reaction (PCR) using 6RMR plasmid as the template. An additional Bgl II site was introduced at the 5' end by PCR. The PCR product was then digested with both Bgl II and Nco I. 2) The remaining MR sequence was obtained by Nco I and Xba I digestion of 6RMR. 3) The above two partial MR fragments were ligated with the Nco I/Xba I digested vector, pEGFP-C1.
Measurement of transmonolayer electrical variables. For the study of transepithelial transport, cells were grown on collagen (type VI; Sigma)-coated filter inserts (0.4-µm pores; Costar). These inserts were placed in 12-well dishes (Costar). Cells were seeded in filter inserts at a greater than confluent density (106 cells/cm2). Medium inside the insert (0.5 ml) bathes the apical surface, and medium outside and below (1.0 ml) bathes the basolateral surface of the cells. Transepithelial resistance (R) and potential difference (PD) were determined under sterile conditions with the Millicell-ERS (Millipore), and effective SCC was computed as PD/R. Experiments were performed after epithelia had developed a stable R and PD, (~7-9 days). Cells were first incubated with medium made with charcoal-stripped fetal bovine serum (FBS) for 3 days, and steroids were then administered to both sides of the epithelia in media with the stripped FBS. The effect of steroids was measured after a 24-h incubation.
Nuclear localization. To examine the nuclear translocation of MR on steroid induction, cells were transiently transfected with pEGFP-rMR, and translocation of the jellyfish green fluorescent protein (GFP)-rMR fusion protein was visualized with an ultraviolet (UV) epifluorescence microscope. First, 105 A6 cells were grown in each well of the cell culture six-well plates layered with coverslips. Transient transfection was performed as described above, except that 500 ng of pEGFP-rMR were used. After incubation with lipofectAMINE-DNA complexes for 5 h, cells were incubated in media with stripped FBS overnight. Medium was replaced in the morning, and cells were allowed to recover for 24 h before further treatment and imaging. To study hormone-dependent nuclear translocation, coverslips with cells were removed from the cell culture wells and were placed inverted with 15 µl PBS solution or PBS solution containing different hormones onto the microscope slides. The translocation of MR into the nucleus was then visualized using a UV epifluorescence microscope (Leitz Diaplam), and images were acquired with a high-resolution camera (Leica, Photoautomat).
Reverse transcriptase-PCR. The mock-transfected cells (cells transfected with empty vector) and the rMR-expressing clone M5 were used in this experiment. Total RNA was extracted from cells by using the RNeasy kit from Qiagen. The concentration and purity of RNA was then determined by measuring the absorbance at 260 and 280 nm. Reverse transcriptase (RT)-PCR was performed based on the manufacturer's procedures (GeneAmp; Perkin-Elmer Cetus). Primers used to amplify different fragments are as follows (5' to 3'): for actin, ACAGGACAGTGTTGGCATACA and GAAGATCTGGCATCACACCTTC; for Xenopus GR, GCTAAGTCATTGGCCCCAGAT and AGAAATTGGCCGGTCTGCACTG; and for rMR, GGAAAGGGCCCATAAAGCAAGAGTCAAGCAAGCAC and GGAAAGATC TGAGCACCAATCCGGTAGTGAAAG. PCR reactions were performed using the PCR Supermix from GIBCO BRL. The thermal cycler condition used was 94°C for 45 s, 58°C for 1 min, and 72°C for 1 min 30 s, for 30 cycles. The PCR products were analyzed by 2% agarose gel electrophoresis, and the amplified DNA fragments were visualized by staining the gel with ethidium bromide.
| |
RESULTS |
|---|
|
|
|---|
Characterization of steroid effects on reporter gene
transcriptional activation in A6 cells. Previous work
using selective agonists and antagonists had demonstrated that the
steroid-induced increase in Na transport and SCC in A6 cells is
mediated by GR, not MR (47, 53). We initially wanted to determine what
point in the signal transduction pathway was defective in the response to mineralocorticoids. A lack of MR-mediated stimulation of SCC could
be due to a defect at any point in the pathway from hormone entry into
the cell to activity of the effectors (such as Na channel or
Na-K-ATPase). We first examined whether the defect in MR-mediated stimulation of SCC was accompanied by a defect in MR-mediated transcriptional activity. If this were not the case and
mineralocorticoids were able to induce a transcriptional response
characteristic of MR, then the defect in SCC induction would likely lie
downstream of the hormone induction of receptor activity, e.g., in a
particular target gene or essential coactivator. We therefore examined
the transcriptional response of a reporter gene to various agonists and
antagonists. For these experiments, we used the reporter TAT3-LUC that
contains a promiscuous hormone response element (HRE) able to respond
to either GR or MR (2, 39). The hormone response profile of luciferase
activity was then used as an indication of a transcription response to
MR, GR, or both. As shown in Fig. 1, the highly GR-specific
agonist RU-28362 stimulated the TAT3-LUC reporter with a 50% effective
concentration (EC50) of 1 × 10
9 M, a value very
close to that reported previously for GR. A similar effect was observed
when dexamethasone was used (data not shown). On the other hand,
aldosterone stimulated the same reporter with an
EC50 of 5 × 10
8 M, typical of GR and
~50-fold that of MR. The addition of RU-486 inhibited both RU-28362
and aldosterone-induced reporter activity. Note that RU-486 also caused
a small but significant increase in basal reporter activity (compare
curves with and without RU-486 at zero aldosterone). This may due to
the weak agonist activity of RU-486 on GR (23). We conclude that
steroid-induced activation of an HRE-containing reporter in A6 cells is
mediated by GR not MR and that signaling through MR is defective.
|
In principle, this defect in mineralocorticoid signaling could be due to a defect in the expression or activity of MR itself or to a defect in a component of the signal transduction pathway extrinsic to MR, e.g., in hormone entry or metabolism (18, 28), in nuclear localization (40, 41), or in coactivators essential to MR activation of transcription (22, 37). Previous hormone-binding studies indicated that MR was present in A6 cells, albeit at reduced levels relative to GR (10, 47, 53). To determine whether the defect in mineralocorticoid signaling was extrinsic to the receptor or was due to a receptor defect itself, we wanted next to determine whether heterologous MR could restore normal mineralocorcoid activities to A6 cells. Thus we examined the ability of aldosterone to stimulate nuclear localization, reporter gene transcriptional activation, and SCC in A6 cells transfected with cloned rMR.
Steroid-dependent nuclear localization of rMR in A6
cells. We first examined nuclear localization. A6 cells
were transiently transfected with a fusion protein comprised of
jellyfish GFP fused to full-length rMR (GFP-rMR). The transfected cells
were then examined using a UV epifluorescence microscope. As shown in
Fig. 2, in the absence of hormone, the
GFP-rMR fusion protein was localized largely to the cytoplasm (Fig.
2A). In response to
10
8 M aldosterone, receptor
was largely localized to the nucleus (Fig.
2B). This concentration is well
below the aldosterone EC50 and the
dissociation constant for GR, both of which are
~3-5 × 10
8 M. In parallel experiments, the plasmid pEGFP-rMR was transfected into
monkey kidney cells (CV-1), and nuclear localization was qualitatively
the same (data not shown). In parallel experiments, the fusion protein
was found to activate transcription of the TAT3-LUC reporter in
response to aldosterone with an
EC50 comparable with that of
wild-type rMR. Its response to spironolactone was also comparable with
that of wild type (data not shown).
|
Thus the heterologous fusion protein GFP-rMR appears to localize to the nucleus with appropriate aldosterone sensitivity, suggesting that the signal transduction machinery is intact to that point and, moreover, that rMR is handled appropriately by the Xenopus nuclear translocation machinery. Importantly, these data are inconsistent with the idea that aldosterone is metabolized or pumped out of the cell. As shown in Fig. 2C, it is also interesting to note that the MR antagonist, spironolactone, induced full nuclear translocation, while having only weak agonist activity (see DISCUSSION).
Characterization of steroid effects on reporter
transcription activation in A6 cells transiently transfected with
rMR. We next examined the ability of heterologous MR to
restore transcriptional activity on a reporter gene. Wild-type rMR was
cotransfected with the same TAT3-LUC reporter used in Fig. 1, and the
ligand response profile was examined. As shown in Fig.
3, the aldosterone sensitivity markedly
increased in the MR-transfected cells, with an
EC50 of 5 × 10
9 M (compared with 5 × 10
8 M in
non-MR-transfected cells), and the maximal reporter activity at the
highest aldosterone concentration used was much higher than that in the
non-MR-transfected cells. At high concentration, aldosterone activates
both MR and GR, but the GR contribution can be inhibited by RU-486.
Thus, when RU-486 was included, only 50% of the maximal aldosterone
effect was inhibited. This is in marked contrast to the almost complete
inhibition of aldosterone activity in cells without transfected rMR or
the inhibition of RU-28362 activity in both MR-transfected and
untransfected cells (see Fig. 1). These data suggested that rMR was
expressed and was transcriptionally active in the A6 cells. In parallel
experiments, the activity on TAT3-LUC of the GFP-rMR fusion was tested
with similar results (data not shown).
|
The above observations demonstrate that rMR is able to translocate normally to the nucleus and is transcriptionally active at a simple, nonspecific HRE at appropriate hormone concentrations in Xenopus cells. However, unlike the transfected simple HRE reporter, the SCC response requires the coordinated regulation of a family of genes, some of which may be controlled by complex HREs whose receptor response involves both protein-protein and protein-DNA interactions, as well as chromatin effects (38, 51). Steroid receptors including MR and GR have been shown previously to function on simple HRE reporters in organisms as distant from mammals as Drosophila and yeast (6, 13, 46). However, the function of the more complex HREs is not as well preserved (Keith Yamamoto, personal communication). Thus we next wanted to determine directly whether rMR can restore mineralocorticoid-responsive SCC to A6 cells.
Stimulation of aldosterone-responsive SCC response in
A6 cells stably transfected with rMR. Because SCC is a
global behavior requiring the coordinated activity of an entire
monolayer, we needed to transfect a high percentage of the cells with
rMR to see a response. Transient transfection only resulted in
6-8% of cells expressing MR (data not shown). After attempting
various enrichment procedures, we settled on stable transfection as the most effective approach to achieve sufficient uniformity of rMR expression. We generated A6 lines stably transfected with either expression vector for rMR or with empty vector expressing only the
neomycin resistance marker (see
METHODS). Once stably transfected lines were established and shown to have MR activity on the TAT3-LUC reporter gene (not shown), the cells were seeded on permeable supports
and PD and R were measured in the
absence and presence of aldosterone plus RU-486 (to specifically
activate MR but not GR). In rMR-transfected cells, aldosterone induced
an approximately threefold increase in PD from ~4.5 to 11.6 mV and a
concomitant modest decrease in R from
~6,000 to 4,200
· cm2.
Effective SCC was then calculated as
PD/R. As shown in Fig. 4, aldosterone plus RU-486 stimulation of
SCC in cells stably transfected with rMR was significantly greater than
that of the mock-transfected or wild-type (untransfected) cells. We
attribute the effect on SCC of aldosterone plus RU-486 in the
mock-transfected cells and untransfected cells to the partial agonist
activity of RU-486; this treatment induced a modest effect on reporter activity (Figs. 1 and 3) as well, and, furthermore, unlike the rMR-transfected cells, the SCC response to aldosterone plus RU-486 in
the mock-transfected and untransfected A6 cells was not inhibited by
spironolactone, consistent with their exerting a partial agonist effect
through GR (not shown). Less likely but worth considering is the
possibility that aldosterone can stimulate SCC through a nongenomic
action.
|
Detection of rMR expression in rMR-transfected A6 cells. Although significantly greater than background, the aldosterone plus RU-486 effect in MR-transfected cells was smaller than the GR-mediated response of wild-type cells, i.e., pure glucocorticoids stimulate SCC approximately six to eightfold (Ref. 47 and data not shown). Using RT-PCR to examine the expression level of rMR in the M5 stable line, we found that rMR was expressed at much lower levels than endogenous GR (Fig. 5). Thus, while the relatively modest effect on SCC mediated by rMR could be due to an inherent defect in its function in Xenopus cells, we believe that it is due to its level of expression.
|
| |
DISCUSSION |
|---|
|
|
|---|
MR and GR are both essential to life (5, 11), and the physiological responses that they mediate are quite distinct. In some tissues, specificity may be due largely to selective receptor expression (33, 49) or hormone-metabolizing enzymes (30, 36, 47), not to inherent differences in the transcriptional specificity of the receptors (16). However, it appears that, in other tissues, MR and GR mediate distinct physiological responses by differentially regulating transcription (24, 45). Our data concur with prior observations that GR can mediate a stimulation of SCC in A6 cells. These observations, along with data from other cell culture models (30, 36), support the idea that GR can "substitute" for MR in mediating mineralocorticoid-like effects on ion transport in cultured collecting duct cells. In A6 cells, the steroid-induced increase in SCC appears to be mediated exclusively by GR, consistent either with the idea that the mineralocorticoid signaling pathway in these cells is nonfunctional or that it is the normal function of GR, not MR, in these cells that normally mediates changes in SCC.
Two aspects of our present data support the idea that an intrinsic defect in Xenopus MR (xMR) underlies the failure in mineralocorticoid signaling in these cells. First, mineralocorticoids can stimulate neither transcriptional activity nor SCC through endogenous xMR. This suggests a defect in xMR, since there is a high degree of homology between rMR and xMR (12) and the reporter that we used is driven by generic HRE that supports a transcriptional response to rGR, rMR, and xMR (12). Second, transfected rMR behaved normally with respect to nuclear translocation as well as restoring the transcriptional and SCC response to mineralocorticoids, to an extent that was appropriate for the amount of receptor present (see below). These observations are inconsistent with the idea that there is a defect in aldosterone entry of the cell or the metabolism of the hormone.
On the basis of our RT-PCR data and reporter activities, the stably transfected A6 cells expressed only modest levels of rMR. This provides the most likely explanation for the modest stimulation of SCC achieved in response to aldosterone. It is possible that rMR is not capable of fully regulating a gene (or genes) critical to the control of SCC in stably transfected A6 cells. However, the levels of rMR expression are clearly low in the stably transfected M5 cell line. Furthermore, rMR is fully active on a reporter gene in transiently transfected cells (where expression is limited to 8% of cells but is quite high in those cells). In view of these observations, we favor the conclusion that the inherent activity of rMR in stimulating SCC in A6 cells is preserved but that M5 and the other clones express MR only at low levels. This observation in conjunction with prior observations that cells in culture tend to lose active MR (4, 48) suggests the interesting possibility that MR is toxic to cells grown in culture. In fact, in our stable transfection experiments, we were unable to obtain large numbers of high-rMR-expressing clones. Moreover, a few rMR-expressing clones gradually lost the ability to stimulate reporter activity after several cell passages.
Although we can conclude with some certainty that the defect in mineralocorticoid signaling in A6 cells is intrinsic to xMR, we cannot be certain whether the defect is qualitative or quantitative. Hormone binding assays indicate that, although GR is more abundant, MR is expressed at a level that should be sufficient for activity (10, 47, 53). However, the data in Fig. 1 imply that there is no detectable MR activity on TAT3-LUC. Perhaps there is a threshold in A6 cells below which no MR-mediated transcriptional activity can be detected. The other possibility is that there is a qualitative defect in A6 MR. A partial-length xMR clone has been isolated from a Xenopus laevis library and has been shown to be transcriptionally active (12). However, xMR has not been cloned from A6 cells, a step that will be essential to determine whether it has an inactivating mutation. It is unlikely that the defect is due to deficiency in a modifying enzyme or coactivator, since rMR reconstitutes MR activity.
It is interesting to note that the antagonist spironolactone triggers nuclear localization. This implies that spironolactone induces dissociation of MR from the aporeceptor complex (42) and activates the hormone-dependent nuclear localization signals (41), leading to stable localization to the nucleus. This is similar to the effect of the antagonist RU-486 on GR (23), which triggers full nuclear localization with only partial agonist activity on transcriptional activity. In conjunction with other reports demonstrating that antagonists can stimulate DNA binding (7, 29), these observations demonstrate that ligand binding and nuclear translocation are necessary but not sufficient for full transcriptional activity, consistent with the idea that hormone-induced exposure of a key activation function is an essential component of transcriptional activity.
There has been considerable controversy (16) over the determinants of MR and GR specificity. In some studies, MR and GR have mediated largely indistinguishable physiological responses (36), whereas in others their activities have been quite different, even opposite (3, 25, 26, 45, 52). At the transcriptional level, MR and GR activities have also varied depending on the context; in some cases MR and GR were virtually indistinguishable (38, 39), whereas in others they differed moderately (1, 44, 50) or even dramatically (21, 39, 55). Our data are consistent with several previous observations that, in cultured kidney cells, GR can elicit MR-like stimulation of ion transport (20, 30, 36, 47, 48), although, in one report, GR and MR appeared to differ in their downstream effects (30). The bulk of evidence, however, favors the conclusion that specificity in these tissues depends largely on factors that influence intracellular hormone concentration such as 11-HSD (14, 18) and possibly steroid transport proteins (27, 28, 43). The situation is quite different in nonclassical MR-expressing tissues such as hippocampus and heart, where specificity almost certainly does not rely on selective hormone metabolism or transport (26, 45).
SCC is an easily measured physiological end point of tight epithelial function. Although numerous studies have examined the function of transfected wild-type and mutant receptors in stimulating transcription of a reporter gene, little is known about their behavior in eliciting an integrated physiological response. SCC measurement provides such an opportunity. A6 cells can be transfected with various receptor mutants, and their transcriptional activity can be compared with their ability to stimulate SCC. Different classes of response elements are differentially influenced by disruption of different receptor functions. For example, the dimer interface mutations decrease receptor activity at some HREs, increase activity at others, and have no effect on repression (9, 32, 55). Thus the type of system that we have developed for MR in A6 cells could be used to examine the activity of mutant receptors in mediating stimulation of SCC, thereby yielding important information about the transcriptional mechanisms underlying this essential physiological response. Our current data clearly show that rMR can function in toad cells, implying conservation of the regulatory machinery in species as distantly related as rodent and amphibian.
| |
ACKNOWLEDGEMENTS |
|---|
Dr. Michael H. Humphreys is gratefully acknowledged for his careful reading and helpful comments on the manuscript. We are grateful to Dr. Jonathan Widdicombe for providing the use of his Ussing chamber and for helpful hints in performing the SCC measurement. We thank Dr. Eric Wieder for assistance in using the cell sorter and epifluorescence microscope. We thank Dr. Mark Goldsmith for the plasmid pCMV4/neo. Guiqiu Yu is gratefully acknowledged for her technical assistance.
| |
FOOTNOTES |
|---|
This work was supported by a Grant-in-Aid from the American Heart Association, California Affiliate. S.-Y. Chen is supported by a National Institutes of Health training grant.
Address for reprint requests: D. Pearce, Division of Nephrology, Dept. of Medicine, San Francisco General Hospital and Biomedical Sciences Program, Univ. of California, San Francisco, San Francisco, CA 94143.
Received 9 July 1997; accepted in final form 22 September 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arriza, J. L.,
R. B. Simerly,
L. W. Swanson,
and
R. M. Evans.
The neuronal mineralocorticoid receptor as a mediator of glucocorticoid response.
Neuron
1:
887-900,
1988[Medline].
2.
Arriza, J. L.,
C. Weinberger,
G. Cerelli,
T. M. Glaser,
B. L. Handelin,
D. E. Housman,
and
R. M. Evans.
Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor.
Science
237:
268-275,
1987
3.
Bastl, C. P.,
G. Schulman,
and
E. J. Cragoe.
Low-dose glucocorticoids stimulate electroneutral NaCl absorption in rat colon.
Am. J. Physiol.
257 (Renal Fluid Electrolyte Physiol. 26):
F1027-F1038,
1989
4.
Blazer, Y. B.,
M. Geheb,
A. Preston,
J. Handler,
and
M. Cox.
Aldosterone-induced proteins in renal epithelia.
Biochim. Biophys. Acta
719:
158-161,
1982[Medline].
5.
Blendy, J., T. Cole, S. Berger, D. Rudolph, W. Schmid, and G. Schutz. Analysis of glucocorticoid and cAMP signaling by gene
targeting (Abstract). Proc. Int. Congr. Endocrinol.
10th San Francisco, CA 1996, p. 701.
6.
Bohen, S. P.,
and
K. R. Yamamoto.
Isolation of Hsp90 mutants by screening for decreased steroid receptor function.
Proc. Natl. Acad. Sci. USA
90:
11424-11428,
1993
7.
Burnstein, K. L.,
C. M. Jewell,
and
J. A. Cidlowski.
Evaluation of the role of ligand and thermal activation of specific DNA binding by in vitro synthesized human glucocorticoid receptor.
Mol. Endocrinol.
5:
1013-1022,
1991
8.
Chalfie, M.,
Y. Tu,
G. Euskirchen,
W. W. Ward,
and
D. C. Prasher.
Green fluorescent protein as a marker for gene expression.
Science
263:
802-805,
1994
9.
Chen, S.-Y.,
G.-Q. Yu,
J. Wang,
and
D. Pearce.
Androgen and glucocorticoid receptor heterodimer formation: a possible mechanism for mutual inhibition of transcriptional activity.
J. Biol. Chem.
272:
14087-14092,
1997
10.
Claire, M.,
B. Machard,
M. Lombes,
M. E. Oblin,
J. P. Bonvalet,
and
N. Farman.
Aldosterone receptors in A6 cells: physicochemical characterization and autoradiographic study.
Am. J. Physiol.
257 (Cell Physiol. 26):
C665-C677,
1989
11.
Cole, T. J.,
J. A. Blendy,
A. P. Monaghan,
K. Krieglstein,
W. Schmid,
A. Aguzzi,
G. Fantuzzi,
E. Hummler,
K. Unsicker,
and
G. Schutz.
Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation.
Genes Dev.
9:
1608-1621,
1995
12.
Csikos, T.,
J. Tay,
and
M. Danielsen.
Expression of the Xenopus laevis mineralocorticoid receptor during metamorphosis.
Recent Prog. Horm. Res.
50:
393-396,
1995.
13.
Diamond, M. I.,
J. N. Miner,
S. K. Yoshinaga,
and
K. R. Yamamoto.
Transcription factor interactions: selectors of positive or negative regulation from a single DNA element.
Science
249:
1266-1272,
1990
14.
Edwards, C. R. W.,
P. M. Stewart,
D. Burt,
L. Brett,
M. A. McIntyre,
W. S. Sutanto,
E. R. DeKloet,
and
C. Monder.
Localisation of 11
-hydroxysteroid dehydrogenase-tissue specific protector of the mineralocorticoid receptor.
Lancet
2:
986-989,
1988[Medline].
15.
Ferrari, P.,
V. R. Obeyesekere,
K. Li,
R. C. Wilson,
M. I. New,
J. W. Funder,
and
Z. S. Krozowski.
Point mutations abolish 11
-hydroxysteroid dehydrogenase type II activity in three families with the congenital syndrome of apparent mineralocorticoid excess.
Mol. Cell. Endocrinol.
119:
21-24,
1996[Medline].
16.
Funder, J. W.
Mineralocorticoids, glucocorticoids, receptors and response elements.
Science
259:
1132-1133,
1993
17.
Funder, J. W.,
P. T. Pearce,
K. Myles,
and
L. P. Roy.
Apparent mineralocorticoid excess, pseudohypoaldosteronism, and urinary electrolyte excretion: toward a redefinition of mineralocorticoid action.
FASEB J.
4:
3234-3238,
1990[Abstract].
18.
Funder, J. W.,
P. T. Pearce,
R. Smith,
and
A. I. Smith.
Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated.
Science
242:
583-585,
1988
19.
Galfre, G.,
and
C. Milstein.
Preparation of monoclonal antibodies: strategies and procedures.
Methods Enzymol.
73B:
3-46,
1981[Medline].
20.
Handler, J. S.,
F. M. Perkins,
and
J. P. Johnson.
Hormone effects on transport in cultured epithelia with high electrical resistance.
Am. J. Physiol.
240 (Cell Physiol. 9):
C103-C105,
1981
21.
Heck, S.,
M. Kullmann,
A. Gast,
H. Ponta,
H. J. Rahmsdorf,
P. Herrlich,
and
A. C. Cato.
A distinct modulating domain in glucocorticoid receptor monomers in the repression of activity of the transcription factor AP-1.
EMBO J.
13:
4087-4095,
1994[Medline].
22.
Hong, H.,
K. Kohli,
A. Trivedi,
D. L. Johnson,
and
M. R. Stallcup.
GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors.
Proc. Natl. Acad. Sci. USA
93:
4948-4952,
1996
23.
Htun, H.,
J. Barsony,
I. Renyi,
D. L. Gould,
and
G. L. Hager.
Visualization of glucocorticoid receptor translocation and intranuclear organization in living cells with a green fluorescent protein chimera.
Proc. Natl. Acad. Sci. USA
93:
4845-4850,
1996
24.
Joels, M.,
and
E. R. de Kloet.
Coordinative mineralocorticoid and glucocorticoid receptor-mediated control of responses to serotonin in rat hippocampus.
Neuroendocrinology
55:
344-350,
1992[Medline].
25.
Joels, M.,
and
E. R. de Kloet.
Effect of corticosteroid hormones on electrical activity in rat hippocampus.
J. Steroid Biochem. Mol. Biol.
40:
83-86,
1991[Medline].
26.
Joels, M.,
and
E. R. de Kloet.
Mineralocorticoid receptor-mediated changes in membrane properties of rat CA1 pyramidal neurons in vitro.
Proc. Natl. Acad. Sci. USA
87:
4495-4498,
1990
27.
Kralli, A.,
S. P. Bohen,
and
K. R. Yamamoto.
LEM1, an ATP-binding-cassette transporter, selectively modulates the biological potency of steroid hormones.
Proc. Natl. Acad. Sci. USA
92:
4701-4705,
1995
28.
Kralli, A.,
and
K. R. Yamamoto.
An FK506-sensitive transporter selectively decreases intracellular levels and potency of steroid hormones.
J. Biol. Chem.
271:
17152-17156,
1996
29.
Kumar, V.,
and
P. Chambon.
The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer.
Cell
55:
145-156,
1988[Medline].
30.
Laplace, J. R.,
R. F. Husted,
and
J. B. Stokes.
Cellular responses to steroids in the enhancement of Na transport by rat collecting duct cells in culture: differences between glucocorticoid and mineralocorticoid hormones.
J. Clin. Invest.
90:
1370-1378,
1992.
31.
Liu, W.,
J. Wang,
N. K. Sauter,
and
D. Pearce.
Steroid receptor heterodimerization demonstrated in vitro and in vivo.
Proc. Natl. Acad. Sci. USA
92:
12480-12484,
1995
32.
Liu, W.,
J. Wang,
G. Yu,
and
D. Pearce.
Steroid receptor transcriptional synergy is potentiated by disruption of the DNA-binding domain dimer interface.
Mol. Endocrinol.
10:
1399-1406,
1996
33.
Lowy, M. T.
Quantification of type I and II adrenal steroid receptors in neuronal, lymphoid and pituitary tissues.
Brain Res.
503:
191-197,
1989[Medline].
34.
Marver, D.,
and
J. P. Kokko.
Renal target sites and the mechanism of action of aldosterone.
Miner. Electrolyte Metab.
9:
1-18,
1983[Medline].
35.
Mune, T.,
F. M. Rogerson,
H. Nikkila,
A. K. Agarwal,
and
P. C. White.
Human hypertension caused by mutations in the kidney isozyme of 11
-hydroxysteroid dehydrogenase.
Nat. Genet.
10:
394-399,
1995[Medline].
36.
Naray-Fejes-Toth, A.,
and
T. G. Fejes.
Glucocorticoid receptors mediate mineralocorticoid-like effects in cultured collecting duct cells.
Am. J. Physiol.
259 (Renal Fluid Electrolyte Physiol. 28):
F672-F678,
1990
37.
Onate, S. A.,
S. Y. Tsai,
M. J. Tsai,
and
B. W. O'Malley.
Sequence and characterization of a coactivator for the steroid hormone receptor superfamily.
Science
270:
1354-1357,
1995
38.
Pearce, D.
A mechanistic basis for distinct mineralocorticoid and glucocorticoid receptor transcriptional specificities.
Steroids
59:
153-159,
1994[Medline].
39.
Pearce, D.,
and
K. R. Yamamoto.
Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element.
Science
259:
1161-1165,
1993
40.
Picard, D.,
V. Kumar,
P. Chambon,
and
K. R. Yamamoto.
Signal transduction by steroid hormones: nuclear localization is differentially regulated in estrogen and glucocorticoid receptors.
Cell Regul.
1:
291-299,
1990[Medline].
41.
Picard, D.,
and
K. R. Yamamoto.
Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor.
EMBO J.
6:
3333-3340,
1987[Medline].
42.
Pratt, W. B.,
and
M. J. Welsh.
Chaperone functions of the heat shock proteins associated with steroid receptors.
Semin. Cell Biol.
5:
83-93,
1994[Medline].
43.
Ribeiro, R.,
R. R. Cavalieri,
N. Lomri,
C. M. Rahmaoui,
J. D. Baxter,
and
B. F. Scharschmidt.
Thyroid hormone export regulates cellular hormone content and response.
J. Biol. Chem.
271:
17147-17151,
1996
44.
Rupprecht, R.,
J. L. Arriza,
D. Spengler,
J. M. Reul,
R. M. Evans,
F. Holsboer,
and
K. Damm.
Transactivation and synergistic properties of the mineralocorticoid receptor: relationship to the glucocorticoid receptor.
Mol. Endocrinol.
7:
597-603,
1993
45.
Sato, A.,
and
J. Funder.
High glucose stimulates aldosterone-induced hypertrophy via type I mineralocorticoid receptors in neonatal rat cardiomyocytes.
Endocrinology.
137:
4145-4153,
1996[Abstract].
46.
Schena, M.,
and
K. R. Yamamoto.
Mammalian glucocorticoid receptor derivatives enhance transcription in yeast.
Science
241:
965-967,
1988
47.
Schmidt, T. J.,
R. F. Husted,
and
J. B. Stokes.
Steroid hormone stimulation of Na+ transport in A6 cells is mediated via glucocorticoid receptors.
Am. J. Physiol.
264 (Cell Physiol. 33):
C875-C884,
1993
48.
Stoos, B. A.,
A. Naray-Fejes-Toth,
O. A. Carretero,
S. Ito,
and
G. Fejes-Toth.
Characterization of a mouse cortical collecting duct cell line.
Kidney Int.
39:
1168-1175,
1991[Medline].
49.
Strahle, U.,
M. Boshart,
G. Klock,
F. Stewart,
and
G. Schutz.
Glucocorticoid- and progesterone-specific effects are determined by differential expression of the respective hormone receptors.
Nature
339:
629-632,
1989[Medline].
50.
Trapp, T.,
R. Rupprecht,
M. Castren,
J. M. Reul,
and
F. Holsboer.
Heterodimerization between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid action in the CNS.
Neuron
13:
1457-1462,
1994[Medline].
51.
Truss, M.,
and
M. Beato.
Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors.
Endocr. Rev.
14:
459-479,
1993
52.
Turnamian, S. G.,
and
H. J. Binder.
Aldosterone and glucocorticoid receptor-specific agonists regulate ion transport in rat proximal colon.
Am. J. Physiol.
238 (Gastrointest. Liver Physiol. 21):
G492-G498,
1990.
53.
Watlington, C. O.,
F. M. Perkins,
P. J. Munson,
and
J. S. Handler.
Aldosterone and corticosterone binding and effects on Na+ transport in cultured kidney cells.
Am. J. Physiol.
242 (Renal Fluid Electrolyte Physiol. 11):
F610-F619,
1982.
54.
Wilson, R. C.,
Z. S. Krozowski,
K. Li,
V. R. Obeyesekere,
A. M. Razzaghy,
M. D. Harbison,
J. Q. Wei,
C. H. Shackleton,
J. W. Funder,
and
M. I. New.
A mutation in the HSD11B2 gene in a family with apparent mineralocorticoid excess.
J. Clin. Endocrinol. Metab.
80:
2263-2266,
1995[Abstract].
55.
Yamamoto, K. R.,
D. Pearce,
J. Thomas,
and
J. N. Miner.
Combinatorial regulation at a mammalian composite response element.
In: Transcriptional Regulation, edited by S. L. McKnight,
and K. R. Yamamoto. Cold Spring Harbor, NY: Cold Spring Harbor, 1992, p. 1169-1192.
This article has been cited by other articles:
![]() |
L. Yu, H.-F. Bao, J. L. Self, D. C. Eaton, and M. N. Helms Aldosterone-induced increases in superoxide production counters nitric oxide inhibition of epithelial Na channel activity in A6 distal nephron cells Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1666 - F1677. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Stockand and J. G. Meszaros Aldosterone stimulates proliferation of cardiac fibroblasts by activating Ki-RasA and MAPK1/2 signaling Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H176 - H184. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Edinger, S. C. Watkins, D. Pearce, and J. P. Johnson Effect of immunosuppressive agents on glucocorticoid receptor function in A6 cells Am J Physiol Renal Physiol, August 1, 2002; 283(2): F254 - F261. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Rozansky, J. Wang, N. Doan, T. Purdy, T. Faulk, A. Bhargava, K. Dawson, and D. Pearce Hypotonic induction of SGK1 and Na+ transport in A6 cells Am J Physiol Renal Physiol, July 1, 2002; 283(1): F105 - F113. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Stockand New ideas about aldosterone signaling in epithelia Am J Physiol Renal Physiol, April 1, 2002; 282(4): F559 - F576. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, P. Barbry, A. C. Maiyar, D. J. Rozansky, A. Bhargava, M. Leong, G. L. Firestone, and D. Pearce SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport Am J Physiol Renal Physiol, February 1, 2001; 280(2): F303 - F313. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Spindler and F. Verrey Aldosterone action: induction of p21ras and fra-2 and transcription-independent decrease in myc, jun, and fos Am J Physiol Cell Physiol, May 1, 1999; 276(5): C1154 - C1161. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-y. Chen, A. Bhargava, L. Mastroberardino, O. C. Meijer, J. Wang, P. Buse, G. L. Firestone, F. Verrey, and D. Pearce Epithelial sodium channel regulated by aldosterone-induced protein sgk PNAS, March 2, 1999; 96(5): 2514 - 2519. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Husted, C. Zhang, and J. B. Stokes Concerted actions of IL-1beta inhibit Na+ absorption and stimulate anion secretion by IMCD cells Am J Physiol Renal Physiol, December 1, 1998; 275(6): F946 - F954. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. O. Watlington Focus on "Aldosterone responsiveness of A6 cells is restored by cloned rat mineralocorticoid receptor" Am J Physiol Cell Physiol, January 1, 1998; 274(1): C38 - C38. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |