Am J Physiol Cell Physiol Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 274: C39-C46, 1998;
0363-6143/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, S.-Y.
Right arrow Articles by Pearce, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, S.-Y.
Right arrow Articles by Pearce, D.
Vol. 274, Issue 1, C39-C46, January 1998

Aldosterone responsiveness of A6 cells is restored by cloned rat mineralocorticoid receptor

Sei-Yu Chen, Jian Wang, Weihong Liu, and David Pearce

Division of Nephrology, Department of Medicine, San Francisco General Hospital and Biomedical Sciences Program, University of California, San Francisco, California 94143

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

A6 cells, derived from Xenopus laevis renal tubule, form a high-resistance ion-transporting monolayer when grown on permeable supports and can generate a short-circuit current (SCC) that is stimulated by high levels of the mineralocorticoid aldosterone. Surprisingly, A6 SCC is more responsive to glucocorticoids than to mineralocorticoids, suggesting the possibility that these cells do not contain transcriptionally active mineralocorticoid receptor (MR) and that glucocorticoid receptor (GR) mediates MR-like responses in these collecting duct-like cells. We have examined the response of both SCC and a transfected reporter gene to mineralocorticoids and glucocorticoids in the presence and absence of transfected rat MR (rMR). We found that, in the absence of transfected MR, a reporter gene that can be activated by MR or GR was more responsive to glucocorticoids such as dexamethasone and RU-28362 than to mineralocorticoids such as aldosterone. Transfected rMR underwent mineralocorticoid-dependent nuclear localization and restored both transcriptional sensitivity of a reporter gene and SCC response to mineralocorticoids. These data demonstrate that A6 cells contain transcriptionally active GR but not MR and thus suggest a molecular basis for the defect in A6 cell SCC response to aldosterone. Our results also demonstrate that GR is capable of mediating hormone stimulation of SCC, a classic mineralocorticoid response. Finally, the observation that heterologous expression of rMR can localize normally to the A6 nucleus in a hormone-dependent fashion and restore both the transcriptional and SCC response to mineralocorticoids suggests that MR function is conserved in species as distantly related as toads and mammals.

dexamethasone; sodium transport; short-circuit current; transcriptional activation; nuclear localization; glucocorticoid receptor; species specificity

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

ELECTROGENIC SODIUM TRANSPORT in intact renal collecting duct is stimulated by mineralocorticoids such as aldosterone or desoxycorticosterone but not by glucocorticoids such as corticosterone, dexamethasone, or RU-28362 (34). This specificity is, at least in part, determined by the selective inactivation of glucocorticoids by the enzyme 11-beta -hydroxysteroid dehydrogenase (11-HSD) (14, 18). In the absence of 11-HSD, endogenous glucocorticoids such as corticosterone and cortisol bind with high affinity and activate mineralocorticoid receptor (MR), thus leading to induction of mineralocorticoid effects. A defect in 11-HSD has been shown to underlie the disease called apparent mineralocorticoid excess (15, 17, 35, 54). However, whether the endogenous glucocorticoids can act through glucocorticoid receptor (GR) to mediate mineralocorticoid-like effects has been controversial (16, 30, 36, 47).

MR and GR bind to and stimulate transcription from a common DNA site (see Ref. 38 for review) and, moreover, in some cell culture models of Na transport GR has been found to mediate MR-like effects, e.g., in primary cultures of rabbit cortical collecting duct, Na transport was found to be stimulated by both glucocorticoids and mineralocorticoids (36), whereas, in stable lines such as M1 and A6, the response was actually more sensitive to stimulation by glucocorticoids and the response to aldosterone occurred only at high concentrations capable of activating GR (47, 48, 53). These surprising observations suggested that not only could GR mediate classic mineralocorticoid responses but, moreover, the stable cell lines M1 and A6, which demonstrate a number of differentiated properties of cortical collecting duct (notably morphological features and the capacity to form a high-resistance monolayer capable of steroid responsive vectoral Na transport), lacked the capacity to mediate a mineralocorticoid response through MR. Whether this inability to demonstrate an MR-mediated response was due to an intrinsic defect in MR or a defect elsewhere in the signal transduction pathway has not been determined. Indeed, receptors with hormone-binding characteristics of MR present in A6 cells suggested that the lack of MR response is not due to a lack of MR expression (10, 47, 53).

There are at least three possible explanations for the observations: 1) there is a block in the signal transduction pathway extrinsic to the receptor, 2) GR not MR is the normal mediator of changes in ion transport in Xenopus kidney, and 3) there is an intrinsic defect in either receptor number or in its ability to activate transcription. We set out to distinguish these possibilities and, furthermore, to determine whether the MR signal transduction machinery was sufficiently well preserved that rat MR (rMR) would function in Xenopus collecting duct cells. We report here that A6 cells are deficient in transcriptionally competent MR and that rMR is able to complement this defect and function normally with respect to nuclear localization, transcriptional activity, and stimulation of short-circuit current (SCC).

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Cell culture and transfection. A6 cells were originally obtained from the American Type Culture Collection. Passages from 75 to 86 were used for all experiments in this study. Cells were maintained in 75-cm2 plastic cell culture flasks (Falcon) at 28°C in a humidified incubator with 1% CO2 in air. The culture medium was a mixture of Dulbecco's modified Eagle's medium (DME-H16) with 1 g/l glucose, 2× DME-H16 without glucose and without bicarbonate (University of California San Francisco Cell Culture Facility) supplemented with 5% fetal calf serum (GIBCO BRL), L-glutamine (2 mM; GIBCO BRL), and N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid buffer (25 mM; GIBCO BRL). Cells were transfected by the lipofectAMINE method as described (GIBCO BRL). For transient transfection, 20 ng of reporter TAT3-LUC (31) with or without 10 ng rMR-expressing plasmid (6RMR) were used. Rous sarcoma virus-beta -gal plasmid (20 ng) was included as an internal standard, and the Bluescript KS- vector plasmid was used as carrier to bring the total amount of DNA to 1 µg. Fresh medium containing 5% stripped serum (charcoal treated to remove endogenous steroids) was added to cells 18 h before transfection. Cells were incubated in the medium containing DNA-lipid complexes for 5 h. Cells were then washed two times in phosphate-buffered saline (PBS) and refed with fresh stripped medium. Sixteen hours later, medium containing specific steroids was added to one of two identical transfections; 24 h later cells were harvested, and extracts were prepared as previously described (31). The extracts were assayed for luciferase activity and were normalized to protein content and to beta -galactosidase activity (expression driven by the Rous sarcoma virus promoter). To obtain stable rMR-expressing cell clones, 1 µg of pCMV-neo-rMR or the vector plasmid pCMV4/neo was used. Two days after transfection, the cytotoxic neomycin analog G418 was introduced into culture medium at the concentration of 1,000 µg/ml. G418-resistant individual clones were obtained by modifying the limiting dilution method (19). Each clone was cultured and expanded. Each clone was then transiently transfected with TAT3-LUC, and luciferase activity was assayed to identify the rMR-expressing clones. A total of 11 G418-resistant clones were isolated. Among those, five clones showed at least twofold higher reporter activity than the mock-transfected cells.

Plasmid construction. The plasmid pCMV-neo-rMR was constructed by inserting the rMR cDNA into pCMV4/neo plasmid (a generous gift from Dr. Mark Goldsmith). The rMR fragment from pC7/MR (40) was first excised by Not I digestion, and the digested Not I site was filled in by Klenow. The DNA was then cut with Spe I. This blunt-ended Not I/Spe I MR fragment was then ligated with pCMV4/neo plasmid DNA previously digested with Xba I and Sma I. The plasmid pEGFP-rMR, containing sequences encoding jellyfish green fluorescent protein (GFP) (8, 23) fused to full-length rMR, was constructed by inserting the rMR cDNA fragment into pEGFP-C1 (Clontech). This construct was made using the following procedures. 1) The sequence from amino acid 1 to the Nco I site in MR was first amplified by polymerase chain reaction (PCR) using 6RMR plasmid as the template. An additional Bgl II site was introduced at the 5' end by PCR. The PCR product was then digested with both Bgl II and Nco I. 2) The remaining MR sequence was obtained by Nco I and Xba I digestion of 6RMR. 3) The above two partial MR fragments were ligated with the Nco I/Xba I digested vector, pEGFP-C1.

Measurement of transmonolayer electrical variables. For the study of transepithelial transport, cells were grown on collagen (type VI; Sigma)-coated filter inserts (0.4-µm pores; Costar). These inserts were placed in 12-well dishes (Costar). Cells were seeded in filter inserts at a greater than confluent density (106 cells/cm2). Medium inside the insert (0.5 ml) bathes the apical surface, and medium outside and below (1.0 ml) bathes the basolateral surface of the cells. Transepithelial resistance (R) and potential difference (PD) were determined under sterile conditions with the Millicell-ERS (Millipore), and effective SCC was computed as PD/R. Experiments were performed after epithelia had developed a stable R and PD, (~7-9 days). Cells were first incubated with medium made with charcoal-stripped fetal bovine serum (FBS) for 3 days, and steroids were then administered to both sides of the epithelia in media with the stripped FBS. The effect of steroids was measured after a 24-h incubation.

Nuclear localization. To examine the nuclear translocation of MR on steroid induction, cells were transiently transfected with pEGFP-rMR, and translocation of the jellyfish green fluorescent protein (GFP)-rMR fusion protein was visualized with an ultraviolet (UV) epifluorescence microscope. First, 105 A6 cells were grown in each well of the cell culture six-well plates layered with coverslips. Transient transfection was performed as described above, except that 500 ng of pEGFP-rMR were used. After incubation with lipofectAMINE-DNA complexes for 5 h, cells were incubated in media with stripped FBS overnight. Medium was replaced in the morning, and cells were allowed to recover for 24 h before further treatment and imaging. To study hormone-dependent nuclear translocation, coverslips with cells were removed from the cell culture wells and were placed inverted with 15 µl PBS solution or PBS solution containing different hormones onto the microscope slides. The translocation of MR into the nucleus was then visualized using a UV epifluorescence microscope (Leitz Diaplam), and images were acquired with a high-resolution camera (Leica, Photoautomat).

Reverse transcriptase-PCR. The mock-transfected cells (cells transfected with empty vector) and the rMR-expressing clone M5 were used in this experiment. Total RNA was extracted from cells by using the RNeasy kit from Qiagen. The concentration and purity of RNA was then determined by measuring the absorbance at 260 and 280 nm. Reverse transcriptase (RT)-PCR was performed based on the manufacturer's procedures (GeneAmp; Perkin-Elmer Cetus). Primers used to amplify different fragments are as follows (5' to 3'): for actin, ACAGGACAGTGTTGGCATACA and GAAGATCTGGCATCACACCTTC; for Xenopus GR, GCTAAGTCATTGGCCCCAGAT and AGAAATTGGCCGGTCTGCACTG; and for rMR, GGAAAGGGCCCATAAAGCAAGAGTCAAGCAAGCAC and GGAAAGATC TGAGCACCAATCCGGTAGTGAAAG. PCR reactions were performed using the PCR Supermix from GIBCO BRL. The thermal cycler condition used was 94°C for 45 s, 58°C for 1 min, and 72°C for 1 min 30 s, for 30 cycles. The PCR products were analyzed by 2% agarose gel electrophoresis, and the amplified DNA fragments were visualized by staining the gel with ethidium bromide.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Characterization of steroid effects on reporter gene transcriptional activation in A6 cells. Previous work using selective agonists and antagonists had demonstrated that the steroid-induced increase in Na transport and SCC in A6 cells is mediated by GR, not MR (47, 53). We initially wanted to determine what point in the signal transduction pathway was defective in the response to mineralocorticoids. A lack of MR-mediated stimulation of SCC could be due to a defect at any point in the pathway from hormone entry into the cell to activity of the effectors (such as Na channel or Na-K-ATPase). We first examined whether the defect in MR-mediated stimulation of SCC was accompanied by a defect in MR-mediated transcriptional activity. If this were not the case and mineralocorticoids were able to induce a transcriptional response characteristic of MR, then the defect in SCC induction would likely lie downstream of the hormone induction of receptor activity, e.g., in a particular target gene or essential coactivator. We therefore examined the transcriptional response of a reporter gene to various agonists and antagonists. For these experiments, we used the reporter TAT3-LUC that contains a promiscuous hormone response element (HRE) able to respond to either GR or MR (2, 39). The hormone response profile of luciferase activity was then used as an indication of a transcription response to MR, GR, or both. As shown in Fig. 1, the highly GR-specific agonist RU-28362 stimulated the TAT3-LUC reporter with a 50% effective concentration (EC50) of 1 × 10-9 M, a value very close to that reported previously for GR. A similar effect was observed when dexamethasone was used (data not shown). On the other hand, aldosterone stimulated the same reporter with an EC50 of 5 × 10-8 M, typical of GR and ~50-fold that of MR. The addition of RU-486 inhibited both RU-28362 and aldosterone-induced reporter activity. Note that RU-486 also caused a small but significant increase in basal reporter activity (compare curves with and without RU-486 at zero aldosterone). This may due to the weak agonist activity of RU-486 on GR (23). We conclude that steroid-induced activation of an HRE-containing reporter in A6 cells is mediated by GR not MR and that signaling through MR is defective.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1.   Defect in A6 cell mineralocorticoid receptor (MR) transcriptional activity. TAT3-LUC plasmid was transiently transfected into A6 cells as reporter to indicate transcriptional activity of endogenous glucocorticoid receptor (GR) and MR. Cells were incubated with medium containing either GR-specific agonist RU-28362 (A) or aldosterone (B). Parallel experiments with the GR antagonist RU-486 (1,000 nM) were included. After harvest, cellular lysates were analyzed for luciferase activity, beta -galactosidase activity, and protein concentration.

In principle, this defect in mineralocorticoid signaling could be due to a defect in the expression or activity of MR itself or to a defect in a component of the signal transduction pathway extrinsic to MR, e.g., in hormone entry or metabolism (18, 28), in nuclear localization (40, 41), or in coactivators essential to MR activation of transcription (22, 37). Previous hormone-binding studies indicated that MR was present in A6 cells, albeit at reduced levels relative to GR (10, 47, 53). To determine whether the defect in mineralocorticoid signaling was extrinsic to the receptor or was due to a receptor defect itself, we wanted next to determine whether heterologous MR could restore normal mineralocorcoid activities to A6 cells. Thus we examined the ability of aldosterone to stimulate nuclear localization, reporter gene transcriptional activation, and SCC in A6 cells transfected with cloned rMR.

Steroid-dependent nuclear localization of rMR in A6 cells. We first examined nuclear localization. A6 cells were transiently transfected with a fusion protein comprised of jellyfish GFP fused to full-length rMR (GFP-rMR). The transfected cells were then examined using a UV epifluorescence microscope. As shown in Fig. 2, in the absence of hormone, the GFP-rMR fusion protein was localized largely to the cytoplasm (Fig. 2A). In response to 10-8 M aldosterone, receptor was largely localized to the nucleus (Fig. 2B). This concentration is well below the aldosterone EC50 and the dissociation constant for GR, both of which are ~3-5 × 10-8 M. In parallel experiments, the plasmid pEGFP-rMR was transfected into monkey kidney cells (CV-1), and nuclear localization was qualitatively the same (data not shown). In parallel experiments, the fusion protein was found to activate transcription of the TAT3-LUC reporter in response to aldosterone with an EC50 comparable with that of wild-type rMR. Its response to spironolactone was also comparable with that of wild type (data not shown).


View larger version (90K):
[in this window]
[in a new window]
 
Fig. 2.   Nuclear localization of rat MR (rMR) in A6 cells. A6 cells grown on coverslips were transiently transfected with pEGFP-rMR (see METHODS). To examine hormone-dependent nuclear translocation, coverslips with cells were placed inverted with phosphate-buffered saline solution containing different hormones onto the microscope slides. Nuclear translocation of the jellyfish green fluorescent protein-rMR fusion protein was visualized with an ultraviolet epifluorescence microscope, and images were acquired with a high-resolution camera. A: no hormone. B: aldosterone (10 nM). C: spironolactone (1,000 nM).

Thus the heterologous fusion protein GFP-rMR appears to localize to the nucleus with appropriate aldosterone sensitivity, suggesting that the signal transduction machinery is intact to that point and, moreover, that rMR is handled appropriately by the Xenopus nuclear translocation machinery. Importantly, these data are inconsistent with the idea that aldosterone is metabolized or pumped out of the cell. As shown in Fig. 2C, it is also interesting to note that the MR antagonist, spironolactone, induced full nuclear translocation, while having only weak agonist activity (see DISCUSSION).

Characterization of steroid effects on reporter transcription activation in A6 cells transiently transfected with rMR. We next examined the ability of heterologous MR to restore transcriptional activity on a reporter gene. Wild-type rMR was cotransfected with the same TAT3-LUC reporter used in Fig. 1, and the ligand response profile was examined. As shown in Fig. 3, the aldosterone sensitivity markedly increased in the MR-transfected cells, with an EC50 of 5 × 10-9 M (compared with 5 × 10-8 M in non-MR-transfected cells), and the maximal reporter activity at the highest aldosterone concentration used was much higher than that in the non-MR-transfected cells. At high concentration, aldosterone activates both MR and GR, but the GR contribution can be inhibited by RU-486. Thus, when RU-486 was included, only 50% of the maximal aldosterone effect was inhibited. This is in marked contrast to the almost complete inhibition of aldosterone activity in cells without transfected rMR or the inhibition of RU-28362 activity in both MR-transfected and untransfected cells (see Fig. 1). These data suggested that rMR was expressed and was transcriptionally active in the A6 cells. In parallel experiments, the activity on TAT3-LUC of the GFP-rMR fusion was tested with similar results (data not shown).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.   Transient transfection of rMR restores MR transcriptional activity on a reporter gene. A6 cells were cotransfected with TAT3-LUC reporter and expression vector for rMR. Cells were then incubated with medium containing increasing concentrations of either RU-28362 (A) or aldosterone (B) as shown. RU-486 (1,000 nM) was included to block GR-mediated effects. After harvest, cellular lysate was analyzed for luciferase activity, beta -galactosidase activity, and protein concentration.

The above observations demonstrate that rMR is able to translocate normally to the nucleus and is transcriptionally active at a simple, nonspecific HRE at appropriate hormone concentrations in Xenopus cells. However, unlike the transfected simple HRE reporter, the SCC response requires the coordinated regulation of a family of genes, some of which may be controlled by complex HREs whose receptor response involves both protein-protein and protein-DNA interactions, as well as chromatin effects (38, 51). Steroid receptors including MR and GR have been shown previously to function on simple HRE reporters in organisms as distant from mammals as Drosophila and yeast (6, 13, 46). However, the function of the more complex HREs is not as well preserved (Keith Yamamoto, personal communication). Thus we next wanted to determine directly whether rMR can restore mineralocorticoid-responsive SCC to A6 cells.

Stimulation of aldosterone-responsive SCC response in A6 cells stably transfected with rMR. Because SCC is a global behavior requiring the coordinated activity of an entire monolayer, we needed to transfect a high percentage of the cells with rMR to see a response. Transient transfection only resulted in 6-8% of cells expressing MR (data not shown). After attempting various enrichment procedures, we settled on stable transfection as the most effective approach to achieve sufficient uniformity of rMR expression. We generated A6 lines stably transfected with either expression vector for rMR or with empty vector expressing only the neomycin resistance marker (see METHODS). Once stably transfected lines were established and shown to have MR activity on the TAT3-LUC reporter gene (not shown), the cells were seeded on permeable supports and PD and R were measured in the absence and presence of aldosterone plus RU-486 (to specifically activate MR but not GR). In rMR-transfected cells, aldosterone induced an approximately threefold increase in PD from ~4.5 to 11.6 mV and a concomitant modest decrease in R from ~6,000 to 4,200 Omega  · cm2. Effective SCC was then calculated as PD/R. As shown in Fig. 4, aldosterone plus RU-486 stimulation of SCC in cells stably transfected with rMR was significantly greater than that of the mock-transfected or wild-type (untransfected) cells. We attribute the effect on SCC of aldosterone plus RU-486 in the mock-transfected cells and untransfected cells to the partial agonist activity of RU-486; this treatment induced a modest effect on reporter activity (Figs. 1 and 3) as well, and, furthermore, unlike the rMR-transfected cells, the SCC response to aldosterone plus RU-486 in the mock-transfected and untransfected A6 cells was not inhibited by spironolactone, consistent with their exerting a partial agonist effect through GR (not shown). Less likely but worth considering is the possibility that aldosterone can stimulate SCC through a nongenomic action.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4.   Stably transfected rMR restores MR-mediated stimulation of short-circuit current (SCC). Cells stably transfected with rMR were seeded on filter inserts and cultured as described in METHODS. Cells were incubated with media containing aldosterone (Aldo; 10 nM) and RU-486 (1,000 nM) for 24 h, and then potential difference (PD) and transepithelial resistance (R) were measured as described in METHODS. SCC is effective SCC taken as ratio PD/R. Mock, cells transfected with empty vector; M5, rMR-expressing cells; Con, control.

Detection of rMR expression in rMR-transfected A6 cells. Although significantly greater than background, the aldosterone plus RU-486 effect in MR-transfected cells was smaller than the GR-mediated response of wild-type cells, i.e., pure glucocorticoids stimulate SCC approximately six to eightfold (Ref. 47 and data not shown). Using RT-PCR to examine the expression level of rMR in the M5 stable line, we found that rMR was expressed at much lower levels than endogenous GR (Fig. 5). Thus, while the relatively modest effect on SCC mediated by rMR could be due to an inherent defect in its function in Xenopus cells, we believe that it is due to its level of expression.


View larger version (74K):
[in this window]
[in a new window]
 
Fig. 5.   Expression of rMR as determined by reverse transcriptase (RT)-polymerase chain reaction. Total RNA was isolated from MR-transfected cells (M5) or mock-transfected cells and used for reverse transcription; 0.5, 2, and 2 µl of the RT reaction were used, respectively, to amplify actin, endogenous Xenopus GR (x.GR), and rMR. Mock, cells transfected with vector plasmid; M5, MR-expressing clone.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

MR and GR are both essential to life (5, 11), and the physiological responses that they mediate are quite distinct. In some tissues, specificity may be due largely to selective receptor expression (33, 49) or hormone-metabolizing enzymes (30, 36, 47), not to inherent differences in the transcriptional specificity of the receptors (16). However, it appears that, in other tissues, MR and GR mediate distinct physiological responses by differentially regulating transcription (24, 45). Our data concur with prior observations that GR can mediate a stimulation of SCC in A6 cells. These observations, along with data from other cell culture models (30, 36), support the idea that GR can "substitute" for MR in mediating mineralocorticoid-like effects on ion transport in cultured collecting duct cells. In A6 cells, the steroid-induced increase in SCC appears to be mediated exclusively by GR, consistent either with the idea that the mineralocorticoid signaling pathway in these cells is nonfunctional or that it is the normal function of GR, not MR, in these cells that normally mediates changes in SCC.

Two aspects of our present data support the idea that an intrinsic defect in Xenopus MR (xMR) underlies the failure in mineralocorticoid signaling in these cells. First, mineralocorticoids can stimulate neither transcriptional activity nor SCC through endogenous xMR. This suggests a defect in xMR, since there is a high degree of homology between rMR and xMR (12) and the reporter that we used is driven by generic HRE that supports a transcriptional response to rGR, rMR, and xMR (12). Second, transfected rMR behaved normally with respect to nuclear translocation as well as restoring the transcriptional and SCC response to mineralocorticoids, to an extent that was appropriate for the amount of receptor present (see below). These observations are inconsistent with the idea that there is a defect in aldosterone entry of the cell or the metabolism of the hormone.

On the basis of our RT-PCR data and reporter activities, the stably transfected A6 cells expressed only modest levels of rMR. This provides the most likely explanation for the modest stimulation of SCC achieved in response to aldosterone. It is possible that rMR is not capable of fully regulating a gene (or genes) critical to the control of SCC in stably transfected A6 cells. However, the levels of rMR expression are clearly low in the stably transfected M5 cell line. Furthermore, rMR is fully active on a reporter gene in transiently transfected cells (where expression is limited to 8% of cells but is quite high in those cells). In view of these observations, we favor the conclusion that the inherent activity of rMR in stimulating SCC in A6 cells is preserved but that M5 and the other clones express MR only at low levels. This observation in conjunction with prior observations that cells in culture tend to lose active MR (4, 48) suggests the interesting possibility that MR is toxic to cells grown in culture. In fact, in our stable transfection experiments, we were unable to obtain large numbers of high-rMR-expressing clones. Moreover, a few rMR-expressing clones gradually lost the ability to stimulate reporter activity after several cell passages.

Although we can conclude with some certainty that the defect in mineralocorticoid signaling in A6 cells is intrinsic to xMR, we cannot be certain whether the defect is qualitative or quantitative. Hormone binding assays indicate that, although GR is more abundant, MR is expressed at a level that should be sufficient for activity (10, 47, 53). However, the data in Fig. 1 imply that there is no detectable MR activity on TAT3-LUC. Perhaps there is a threshold in A6 cells below which no MR-mediated transcriptional activity can be detected. The other possibility is that there is a qualitative defect in A6 MR. A partial-length xMR clone has been isolated from a Xenopus laevis library and has been shown to be transcriptionally active (12). However, xMR has not been cloned from A6 cells, a step that will be essential to determine whether it has an inactivating mutation. It is unlikely that the defect is due to deficiency in a modifying enzyme or coactivator, since rMR reconstitutes MR activity.

It is interesting to note that the antagonist spironolactone triggers nuclear localization. This implies that spironolactone induces dissociation of MR from the aporeceptor complex (42) and activates the hormone-dependent nuclear localization signals (41), leading to stable localization to the nucleus. This is similar to the effect of the antagonist RU-486 on GR (23), which triggers full nuclear localization with only partial agonist activity on transcriptional activity. In conjunction with other reports demonstrating that antagonists can stimulate DNA binding (7, 29), these observations demonstrate that ligand binding and nuclear translocation are necessary but not sufficient for full transcriptional activity, consistent with the idea that hormone-induced exposure of a key activation function is an essential component of transcriptional activity.

There has been considerable controversy (16) over the determinants of MR and GR specificity. In some studies, MR and GR have mediated largely indistinguishable physiological responses (36), whereas in others their activities have been quite different, even opposite (3, 25, 26, 45, 52). At the transcriptional level, MR and GR activities have also varied depending on the context; in some cases MR and GR were virtually indistinguishable (38, 39), whereas in others they differed moderately (1, 44, 50) or even dramatically (21, 39, 55). Our data are consistent with several previous observations that, in cultured kidney cells, GR can elicit MR-like stimulation of ion transport (20, 30, 36, 47, 48), although, in one report, GR and MR appeared to differ in their downstream effects (30). The bulk of evidence, however, favors the conclusion that specificity in these tissues depends largely on factors that influence intracellular hormone concentration such as 11-HSD (14, 18) and possibly steroid transport proteins (27, 28, 43). The situation is quite different in nonclassical MR-expressing tissues such as hippocampus and heart, where specificity almost certainly does not rely on selective hormone metabolism or transport (26, 45).

SCC is an easily measured physiological end point of tight epithelial function. Although numerous studies have examined the function of transfected wild-type and mutant receptors in stimulating transcription of a reporter gene, little is known about their behavior in eliciting an integrated physiological response. SCC measurement provides such an opportunity. A6 cells can be transfected with various receptor mutants, and their transcriptional activity can be compared with their ability to stimulate SCC. Different classes of response elements are differentially influenced by disruption of different receptor functions. For example, the dimer interface mutations decrease receptor activity at some HREs, increase activity at others, and have no effect on repression (9, 32, 55). Thus the type of system that we have developed for MR in A6 cells could be used to examine the activity of mutant receptors in mediating stimulation of SCC, thereby yielding important information about the transcriptional mechanisms underlying this essential physiological response. Our current data clearly show that rMR can function in toad cells, implying conservation of the regulatory machinery in species as distantly related as rodent and amphibian.

    ACKNOWLEDGEMENTS

Dr. Michael H. Humphreys is gratefully acknowledged for his careful reading and helpful comments on the manuscript. We are grateful to Dr. Jonathan Widdicombe for providing the use of his Ussing chamber and for helpful hints in performing the SCC measurement. We thank Dr. Eric Wieder for assistance in using the cell sorter and epifluorescence microscope. We thank Dr. Mark Goldsmith for the plasmid pCMV4/neo. Guiqiu Yu is gratefully acknowledged for her technical assistance.

    FOOTNOTES

This work was supported by a Grant-in-Aid from the American Heart Association, California Affiliate. S.-Y. Chen is supported by a National Institutes of Health training grant.

Address for reprint requests: D. Pearce, Division of Nephrology, Dept. of Medicine, San Francisco General Hospital and Biomedical Sciences Program, Univ. of California, San Francisco, San Francisco, CA 94143.

Received 9 July 1997; accepted in final form 22 September 1997.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Arriza, J. L., R. B. Simerly, L. W. Swanson, and R. M. Evans. The neuronal mineralocorticoid receptor as a mediator of glucocorticoid response. Neuron 1: 887-900, 1988[Medline].

2.   Arriza, J. L., C. Weinberger, G. Cerelli, T. M. Glaser, B. L. Handelin, D. E. Housman, and R. M. Evans. Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237: 268-275, 1987[Abstract/Free Full Text].

3.   Bastl, C. P., G. Schulman, and E. J. Cragoe. Low-dose glucocorticoids stimulate electroneutral NaCl absorption in rat colon. Am. J. Physiol. 257 (Renal Fluid Electrolyte Physiol. 26): F1027-F1038, 1989[Abstract/Free Full Text].

4.   Blazer, Y. B., M. Geheb, A. Preston, J. Handler, and M. Cox. Aldosterone-induced proteins in renal epithelia. Biochim. Biophys. Acta 719: 158-161, 1982[Medline].

5.  Blendy, J., T. Cole, S. Berger, D. Rudolph, W. Schmid, and G. Schutz. Analysis of glucocorticoid and cAMP signaling by gene targeting (Abstract). Proc. Int. Congr. Endocrinol. 10th San Francisco, CA 1996, p. 701.

6.   Bohen, S. P., and K. R. Yamamoto. Isolation of Hsp90 mutants by screening for decreased steroid receptor function. Proc. Natl. Acad. Sci. USA 90: 11424-11428, 1993[Abstract/Free Full Text].

7.   Burnstein, K. L., C. M. Jewell, and J. A. Cidlowski. Evaluation of the role of ligand and thermal activation of specific DNA binding by in vitro synthesized human glucocorticoid receptor. Mol. Endocrinol. 5: 1013-1022, 1991[Abstract/Free Full Text].

8.   Chalfie, M., Y. Tu, G. Euskirchen, W. W. Ward, and D. C. Prasher. Green fluorescent protein as a marker for gene expression. Science 263: 802-805, 1994[Abstract/Free Full Text].

9.   Chen, S.-Y., G.-Q. Yu, J. Wang, and D. Pearce. Androgen and glucocorticoid receptor heterodimer formation: a possible mechanism for mutual inhibition of transcriptional activity. J. Biol. Chem. 272: 14087-14092, 1997[Abstract/Free Full Text].

10.   Claire, M., B. Machard, M. Lombes, M. E. Oblin, J. P. Bonvalet, and N. Farman. Aldosterone receptors in A6 cells: physicochemical characterization and autoradiographic study. Am. J. Physiol. 257 (Cell Physiol. 26): C665-C677, 1989[Abstract/Free Full Text].

11.   Cole, T. J., J. A. Blendy, A. P. Monaghan, K. Krieglstein, W. Schmid, A. Aguzzi, G. Fantuzzi, E. Hummler, K. Unsicker, and G. Schutz. Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 9: 1608-1621, 1995[Abstract/Free Full Text].

12.   Csikos, T., J. Tay, and M. Danielsen. Expression of the Xenopus laevis mineralocorticoid receptor during metamorphosis. Recent Prog. Horm. Res. 50: 393-396, 1995.

13.   Diamond, M. I., J. N. Miner, S. K. Yoshinaga, and K. R. Yamamoto. Transcription factor interactions: selectors of positive or negative regulation from a single DNA element. Science 249: 1266-1272, 1990[Abstract/Free Full Text].

14.   Edwards, C. R. W., P. M. Stewart, D. Burt, L. Brett, M. A. McIntyre, W. S. Sutanto, E. R. DeKloet, and C. Monder. Localisation of 11beta -hydroxysteroid dehydrogenase-tissue specific protector of the mineralocorticoid receptor. Lancet 2: 986-989, 1988[Medline].

15.   Ferrari, P., V. R. Obeyesekere, K. Li, R. C. Wilson, M. I. New, J. W. Funder, and Z. S. Krozowski. Point mutations abolish 11beta -hydroxysteroid dehydrogenase type II activity in three families with the congenital syndrome of apparent mineralocorticoid excess. Mol. Cell. Endocrinol. 119: 21-24, 1996[Medline].

16.   Funder, J. W. Mineralocorticoids, glucocorticoids, receptors and response elements. Science 259: 1132-1133, 1993[Free Full Text].

17.   Funder, J. W., P. T. Pearce, K. Myles, and L. P. Roy. Apparent mineralocorticoid excess, pseudohypoaldosteronism, and urinary electrolyte excretion: toward a redefinition of mineralocorticoid action. FASEB J. 4: 3234-3238, 1990[Abstract].

18.   Funder, J. W., P. T. Pearce, R. Smith, and A. I. Smith. Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242: 583-585, 1988[Abstract/Free Full Text].

19.   Galfre, G., and C. Milstein. Preparation of monoclonal antibodies: strategies and procedures. Methods Enzymol. 73B: 3-46, 1981[Medline].

20.   Handler, J. S., F. M. Perkins, and J. P. Johnson. Hormone effects on transport in cultured epithelia with high electrical resistance. Am. J. Physiol. 240 (Cell Physiol. 9): C103-C105, 1981[Abstract/Free Full Text].

21.   Heck, S., M. Kullmann, A. Gast, H. Ponta, H. J. Rahmsdorf, P. Herrlich, and A. C. Cato. A distinct modulating domain in glucocorticoid receptor monomers in the repression of activity of the transcription factor AP-1. EMBO J. 13: 4087-4095, 1994[Medline].

22.   Hong, H., K. Kohli, A. Trivedi, D. L. Johnson, and M. R. Stallcup. GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. USA 93: 4948-4952, 1996[Abstract/Free Full Text].

23.   Htun, H., J. Barsony, I. Renyi, D. L. Gould, and G. L. Hager. Visualization of glucocorticoid receptor translocation and intranuclear organization in living cells with a green fluorescent protein chimera. Proc. Natl. Acad. Sci. USA 93: 4845-4850, 1996[Abstract/Free Full Text].

24.   Joels, M., and E. R. de Kloet. Coordinative mineralocorticoid and glucocorticoid receptor-mediated control of responses to serotonin in rat hippocampus. Neuroendocrinology 55: 344-350, 1992[Medline].

25.   Joels, M., and E. R. de Kloet. Effect of corticosteroid hormones on electrical activity in rat hippocampus. J. Steroid Biochem. Mol. Biol. 40: 83-86, 1991[Medline].

26.   Joels, M., and E. R. de Kloet. Mineralocorticoid receptor-mediated changes in membrane properties of rat CA1 pyramidal neurons in vitro. Proc. Natl. Acad. Sci. USA 87: 4495-4498, 1990[Abstract/Free Full Text].

27.   Kralli, A., S. P. Bohen, and K. R. Yamamoto. LEM1, an ATP-binding-cassette transporter, selectively modulates the biological potency of steroid hormones. Proc. Natl. Acad. Sci. USA 92: 4701-4705, 1995[Abstract/Free Full Text].

28.   Kralli, A., and K. R. Yamamoto. An FK506-sensitive transporter selectively decreases intracellular levels and potency of steroid hormones. J. Biol. Chem. 271: 17152-17156, 1996[Abstract/Free Full Text].

29.   Kumar, V., and P. Chambon. The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer. Cell 55: 145-156, 1988[Medline].

30.   Laplace, J. R., R. F. Husted, and J. B. Stokes. Cellular responses to steroids in the enhancement of Na transport by rat collecting duct cells in culture: differences between glucocorticoid and mineralocorticoid hormones. J. Clin. Invest. 90: 1370-1378, 1992.

31.   Liu, W., J. Wang, N. K. Sauter, and D. Pearce. Steroid receptor heterodimerization demonstrated in vitro and in vivo. Proc. Natl. Acad. Sci. USA 92: 12480-12484, 1995[Abstract/Free Full Text].

32.   Liu, W., J. Wang, G. Yu, and D. Pearce. Steroid receptor transcriptional synergy is potentiated by disruption of the DNA-binding domain dimer interface. Mol. Endocrinol. 10: 1399-1406, 1996[Abstract/Free Full Text].

33.   Lowy, M. T. Quantification of type I and II adrenal steroid receptors in neuronal, lymphoid and pituitary tissues. Brain Res. 503: 191-197, 1989[Medline].

34.   Marver, D., and J. P. Kokko. Renal target sites and the mechanism of action of aldosterone. Miner. Electrolyte Metab. 9: 1-18, 1983[Medline].

35.   Mune, T., F. M. Rogerson, H. Nikkila, A. K. Agarwal, and P. C. White. Human hypertension caused by mutations in the kidney isozyme of 11beta -hydroxysteroid dehydrogenase. Nat. Genet. 10: 394-399, 1995[Medline].

36.   Naray-Fejes-Toth, A., and T. G. Fejes. Glucocorticoid receptors mediate mineralocorticoid-like effects in cultured collecting duct cells. Am. J. Physiol. 259 (Renal Fluid Electrolyte Physiol. 28): F672-F678, 1990[Abstract/Free Full Text].

37.   Onate, S. A., S. Y. Tsai, M. J. Tsai, and B. W. O'Malley. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270: 1354-1357, 1995[Abstract/Free Full Text].

38.   Pearce, D. A mechanistic basis for distinct mineralocorticoid and glucocorticoid receptor transcriptional specificities. Steroids 59: 153-159, 1994[Medline].

39.   Pearce, D., and K. R. Yamamoto. Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element. Science 259: 1161-1165, 1993[Abstract/Free Full Text].

40.   Picard, D., V. Kumar, P. Chambon, and K. R. Yamamoto. Signal transduction by steroid hormones: nuclear localization is differentially regulated in estrogen and glucocorticoid receptors. Cell Regul. 1: 291-299, 1990[Medline].

41.   Picard, D., and K. R. Yamamoto. Two signals mediate hormone-dependent nuclear localization of the glucocorticoid receptor. EMBO J. 6: 3333-3340, 1987[Medline].

42.   Pratt, W. B., and M. J. Welsh. Chaperone functions of the heat shock proteins associated with steroid receptors. Semin. Cell Biol. 5: 83-93, 1994[Medline].

43.   Ribeiro, R., R. R. Cavalieri, N. Lomri, C. M. Rahmaoui, J. D. Baxter, and B. F. Scharschmidt. Thyroid hormone export regulates cellular hormone content and response. J. Biol. Chem. 271: 17147-17151, 1996[Abstract/Free Full Text].

44.   Rupprecht, R., J. L. Arriza, D. Spengler, J. M. Reul, R. M. Evans, F. Holsboer, and K. Damm. Transactivation and synergistic properties of the mineralocorticoid receptor: relationship to the glucocorticoid receptor. Mol. Endocrinol. 7: 597-603, 1993[Abstract/Free Full Text].

45.   Sato, A., and J. Funder. High glucose stimulates aldosterone-induced hypertrophy via type I mineralocorticoid receptors in neonatal rat cardiomyocytes. Endocrinology. 137: 4145-4153, 1996[Abstract].

46.   Schena, M., and K. R. Yamamoto. Mammalian glucocorticoid receptor derivatives enhance transcription in yeast. Science 241: 965-967, 1988[Abstract/Free Full Text].

47.   Schmidt, T. J., R. F. Husted, and J. B. Stokes. Steroid hormone stimulation of Na+ transport in A6 cells is mediated via glucocorticoid receptors. Am. J. Physiol. 264 (Cell Physiol. 33): C875-C884, 1993[Abstract/Free Full Text].

48.   Stoos, B. A., A. Naray-Fejes-Toth, O. A. Carretero, S. Ito, and G. Fejes-Toth. Characterization of a mouse cortical collecting duct cell line. Kidney Int. 39: 1168-1175, 1991[Medline].

49.   Strahle, U., M. Boshart, G. Klock, F. Stewart, and G. Schutz. Glucocorticoid- and progesterone-specific effects are determined by differential expression of the respective hormone receptors. Nature 339: 629-632, 1989[Medline].

50.   Trapp, T., R. Rupprecht, M. Castren, J. M. Reul, and F. Holsboer. Heterodimerization between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid action in the CNS. Neuron 13: 1457-1462, 1994[Medline].

51.   Truss, M., and M. Beato. Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr. Rev. 14: 459-479, 1993[Abstract/Free Full Text].

52.   Turnamian, S. G., and H. J. Binder. Aldosterone and glucocorticoid receptor-specific agonists regulate ion transport in rat proximal colon. Am. J. Physiol. 238 (Gastrointest. Liver Physiol. 21): G492-G498, 1990.

53.   Watlington, C. O., F. M. Perkins, P. J. Munson, and J. S. Handler. Aldosterone and corticosterone binding and effects on Na+ transport in cultured kidney cells. Am. J. Physiol. 242 (Renal Fluid Electrolyte Physiol. 11): F610-F619, 1982.

54.   Wilson, R. C., Z. S. Krozowski, K. Li, V. R. Obeyesekere, A. M. Razzaghy, M. D. Harbison, J. Q. Wei, C. H. Shackleton, J. W. Funder, and M. I. New. A mutation in the HSD11B2 gene in a family with apparent mineralocorticoid excess. J. Clin. Endocrinol. Metab. 80: 2263-2266, 1995[Abstract].

55.   Yamamoto, K. R., D. Pearce, J. Thomas, and J. N. Miner. Combinatorial regulation at a mammalian composite response element. In: Transcriptional Regulation, edited by S. L. McKnight, and K. R. Yamamoto. Cold Spring Harbor, NY: Cold Spring Harbor, 1992, p. 1169-1192.


AJP Cell Physiol 274(1):C39-C46
0363-6143/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
L. Yu, H.-F. Bao, J. L. Self, D. C. Eaton, and M. N. Helms
Aldosterone-induced increases in superoxide production counters nitric oxide inhibition of epithelial Na channel activity in A6 distal nephron cells
Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1666 - F1677.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. D. Stockand and J. G. Meszaros
Aldosterone stimulates proliferation of cardiac fibroblasts by activating Ki-RasA and MAPK1/2 signaling
Am J Physiol Heart Circ Physiol, January 1, 2003; 284(1): H176 - H184.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas
Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region
Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. S. Edinger, S. C. Watkins, D. Pearce, and J. P. Johnson
Effect of immunosuppressive agents on glucocorticoid receptor function in A6 cells
Am J Physiol Renal Physiol, August 1, 2002; 283(2): F254 - F261.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. J. Rozansky, J. Wang, N. Doan, T. Purdy, T. Faulk, A. Bhargava, K. Dawson, and D. Pearce
Hypotonic induction of SGK1 and Na+ transport in A6 cells
Am J Physiol Renal Physiol, July 1, 2002; 283(1): F105 - F113.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. D. Stockand
New ideas about aldosterone signaling in epithelia
Am J Physiol Renal Physiol, April 1, 2002; 282(4): F559 - F576.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Wang, P. Barbry, A. C. Maiyar, D. J. Rozansky, A. Bhargava, M. Leong, G. L. Firestone, and D. Pearce
SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport
Am J Physiol Renal Physiol, February 1, 2001; 280(2): F303 - F313.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
B. Spindler and F. Verrey
Aldosterone action: induction of p21ras and fra-2 and transcription-independent decrease in myc, jun, and fos
Am J Physiol Cell Physiol, May 1, 1999; 276(5): C1154 - C1161.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S.-y. Chen, A. Bhargava, L. Mastroberardino, O. C. Meijer, J. Wang, P. Buse, G. L. Firestone, F. Verrey, and D. Pearce
Epithelial sodium channel regulated by aldosterone-induced protein sgk
PNAS, March 2, 1999; 96(5): 2514 - 2519.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. F. Husted, C. Zhang, and J. B. Stokes
Concerted actions of IL-1beta inhibit Na+ absorption and stimulate anion secretion by IMCD cells
Am J Physiol Renal Physiol, December 1, 1998; 275(6): F946 - F954.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. O. Watlington
Focus on "Aldosterone responsiveness of A6 cells is restored by cloned rat mineralocorticoid receptor"
Am J Physiol Cell Physiol, January 1, 1998; 274(1): C38 - C38.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, S.-Y.
Right arrow Articles by Pearce, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, S.-Y.
Right arrow Articles by Pearce, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online