Am J Physiol Cell Physiol Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Cell Physiol 273: C2002-C2009, 1997;
0363-6143/97 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hubatsch, D. A.
Right arrow Articles by Jasmin, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hubatsch, D. A.
Right arrow Articles by Jasmin, B. J.
Vol. 273, Issue 6, C2002-C2009, December 1997

Mechanical stimulation increases expression of acetylcholinesterase in cultured myotubes

Douglas A. Hubatsch and Bernard J. Jasmin

Department of Physiology, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada K1H 8M5

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We tested the hypothesis that acetylcholinesterase (AChE) expression in skeletal muscle cells is increased by passive mechanical stimulation. To this end, primary cultures of myotubes were subjected to repeated cycles of stretch-relaxation for 5 min, 30 min, 3 h, and 24 h, using the Flexercell FX-2000 strain unit. Although mechanical stimulation did not affect AChE expression at early time points, it led to a significant increase (42%; P < 0.05) in total AChE activity at 24 h. This increase reflected a general elevation in the activity of all AChE molecular forms as opposed to a preferential increase in a specific form. Tetrodotoxin (TTX) treatment did not prevent the increase in AChE expression, whereas nifedipine partially blocked it. These changes in enzyme expression were accompanied by increases in the levels of AChE mRNA, suggesting the involvement of pretranslational regulatory mechanisms. Together, these results illustrate that, in addition to neural activation and trophic factors, passive mechanical forces modulate expression of AChE in skeletal muscle cells. Because TTX did not prevent the increase in AChE expression, it appears that the effects of mechanical stimulation are independent of electrical activity, which further indicates the use of an alternate signaling pathway.

rat; neuromuscular junction; synapse; stretch; mechanical cell stimulator

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

ACETYLCHOLINESTERASE (AChE) is an essential component of cholinergic synapses in both central and peripheral nervous systems, since it is responsible for the rapid hydrolysis of acetylcholine released from presynaptic nerve terminals (for review, see Ref. 22). An interesting feature of this enzyme is that it displays a marked and complex polymorphism. Indeed, AChE exists as a family of molecular forms that present distinct structural features and solubility characteristics. The various molecular forms may be classified as either homomeric or heteromeric on the basis of their association with specialized structural subunits. Although a single gene encodes AChE in vertebrates (see Ref. 22), alternative splicing and distinct processing of the polypeptide chain account for the multiplicity of AChE molecular forms expressed in a variety of tissues and subcellular locations. In skeletal muscle fibers, for example, asymmetric forms of AChE accumulate preferentially within the synaptic basal lamina (23), whereas G4 tetramers are highly concentrated within the perijunctional compartment (10).

AChE is of particular interest with regard to muscle plasticity, since expression of AChE is markedly influenced by the presence of the motor nerve. Denervation of muscle fibers, for example, results in a rapid and pronounced decrease in the content of AChE asymmetric forms (see Refs. 22, 24). Alternatively, enhanced neuromuscular activation achieved by exercise training programs and compensatory hypertrophy leads to significant increases in total AChE activity that, in fast muscle, are manifested by preferential changes in the levels of the various molecular forms (7, 13, 14, 29). Several lines of evidence also suggest that expression of AChE in muscle is modulated by nerve-derived trophic factors. For instance, chronic application of tetrodotoxin (TTX) onto the sciatic nerve, which inhibits electrical activity of muscle fibers without compromising axoplasmic transport, leads to reductions in AChE activity that are less pronounced than those induced by denervation (2, 4, 24). Recent studies have further shown that systemic administrations of ciliary neurotrophic factor (3) or calcitonin gene-related peptide (12) influence expression of AChE in rat skeletal muscle. Taken together, results from these studies indicate, therefore, that the regulation of AChE in skeletal muscle fibers is a multifactorial process that involves, in addition to the amount and pattern of nerve-evoked electrical activity, the release of nerve-derived trophic factors.

In recent years, it has become increasingly evident that several cell types respond to mechanical perturbations of their normal environment by displaying significant changes in their growth and differentiation patterns (1, 11, 30). Skeletal muscle is among the tissues known to be sensitive to mechanical stimulation, since, in response to these passive forces, muscle cells readily adapt by synthesizing, for example, large amounts of contractile proteins and by displaying hypertrophy (11, 31). Given the elevated levels of AChE seen previously in both exercise-trained and hypertrophied muscles (Refs. 7, 13, 14, 29 and references therein), the possibility that passive mechanical stimulation also increases AChE expression in muscle may therefore be envisaged. In the present study, we have thus tested this hypothesis by determining the impact of passive mechanical forces on AChE expression. To this end, we subjected cultures of myotubes to repeated cycles of stretch-relaxation, using a computerized mechanical cell stimulator.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Primary cultures of rat myotubes. Sprague-Dawley rats weighing ~50 g were anesthetized with pentobarbital sodium (35 mg/kg ip), and their hindlimb muscles were quickly excised under aseptic conditions. Muscles from four to five animals were pooled together for each experiment, thus giving an n of 1. Muscles were kept in ice-cold phosphate-buffered saline (PBS) until surgery on all animals was completed. Freshly dissected muscles were then minced in 8 volumes of minimum essential medium (MEM) containing 15% donor bovine serum (DBS), 1% penicillin-streptomycin, 0.1% fungizone, and collagenase (1.79 mg/g of tissue) until fragments of ~2 mm were obtained. The mixture was then incubated at 37°C for 1.75 h and spun subsequently at 250 g for 3 min at 4°C. The supernatant was discarded, and the soft pellet was resuspended in MEM as above, with the exception that dispase (20 mg/g of tissue) was added instead of collagenase. This mixture was then incubated at 37°C for 45 min. Digested muscle fibers were filtered through a 53-µm nylon filter, and the filtrate was spun at 4°C for 10 min at 250 g. The final pellet was resuspended in MEM with DBS and antibiotics. Satellite cells thus obtained were plated on Matrigel-coated (Collaborative Biomedical Products, Bedford, MA), six-well Flexercell plates (Flexcell International, McKeesport, PA). Cells were kept at 37°C in a water-saturated atmosphere containing 5% CO2. The medium was changed every other day until cells reached confluence. At this stage, DBS was reduced to 2% to promote differentiation of myoblasts into myotubes. Control cells were also grown on Flexercell plates to avoid substratum-induced selective expression of proteins. Cells were used for AChE analysis 8-10 days after initial plating. With this approach, we observed that at least 50% of the cells are myoblasts and that >70% of the myoblasts differentiate into myotubes.

Mechanical stimulation. Installation of the Flexercell FX-2000 strain unit was performed as described by the manufacturer (Flexcell International). This system consists of flexible-bottom culture plates, a vacuum base plate, hoses, and a computer. The computer controls the extent of stretch (measured as a percentage) imposed on the flexible-bottom culture wells and the duration of the mechanical stimulation. The actual mechanical stimulation of the cells occurs by creation of a vacuum below the flexible-bottom wells. This causes the substratum to deflect downward, increasing the surface area and stretching the cells growing on it. In preliminary experiments, rat myotubes were grown on the flexible-bottom wells stretched by either 12, 20, or 24% using a cyclical pattern of five stimulations of 2 s on and 2 s off, followed by a 10-s rest period. Cells were mechanically stimulated at 37°C using this pattern for 5 min, 30 min, 3 h, and 24 h. In these studies, we noted that the AChE response was the greatest with a 24% stretch imposed on the flexible-bottom culture wells (data not shown). This value was therefore used in all subsequent experiments (see also Refs. 27, 31, 34, 35). Examination of cultured myotubes under a microscope indicated that cell morphology did not change significantly as a result of mechanical stimulation. For some experiments, cultures of rat myotubes were subjected to 24% mechanical stimulation for 24 h in the presence of 10 µM TTX (Sigma, St. Louis, MO) or nifedipine (Miles Laboratories, Pittsburgh, PA) to block Na+ or L-type Ca2+ channels, respectively (see Refs. 21, 25).

Analysis of AChE. Myotubes within one set of experiments (n = 1; control, 5 min, 30 min, 3 h, 24 h) were harvested at the same time. Because they all originated from the same culture preparation (see Primary cultures of rat myotubes above), they were of the same developmental stage. This was achieved by first starting to stretch a plate of cells for 24 h; 21 h later, another plate of cells from the same culture preparation was stretched, in this case for 3 h. The protocol was to keep adding plates as time progressed, such that all cells were stimulated for the appropriate amount of time and ready for harvesting at the same time.

Cultures of myotubes were washed twice with ice-cold PBS and scraped into 600 µl of a high-salt buffer containing antiproteolytic agents [10 mM tris(hydroxymethyl)aminomethane (Tris) · HCl (pH 7.0), 10 mM EDTA, 1 M NaCl, 1% Triton X-100, 1 mg/ml bacitracin, and 25 U/ml aprotinin]. Cells were homogenized on ice for 2 × 15 s with a Polytron (Kinematica, Littan, Switzerland) set at 1. Homogenates were spun at 20,000 g at 4°C for 15 min, and the resulting supernatants were kept at -80°C.

AChE activity was measured using a modified version of the spectrophotometric method of Ellman et al. (6), as described previously (10, 14). Aliquots of 25 or 50 µl from the homogenates were incubated in 1 ml of a phosphate buffer solution (pH 7.0) containing 7.5 × 10-4 M acetylthiocholine iodide as the substrate, 5 × 10-4 M dithionitrobenzoic acid, and 10-5 M tetraisopropyl pyrophosphoramide (iso-OMPA), a nonspecific cholinesterase inhibitor. Nonspecific hydrolysis was measured at 412 nm in the presence of both iso-OMPA and the AChE-specific inhibitor 5-bis(4-allyldimethylammonium phenyl)pentan-3-dibromide. Protein concentration was determined using the bicinchoninic acid protein assay reagent kit (Pierce, Rockford, IL), as described by the manufacturer.

Analysis of AChE molecular forms was performed by velocity sedimentation, as described previously (10, 14). Aliquots (100 or 150 µl) from the homogenates were layered onto 5-20% sucrose gradients. Samples were centrifuged in a Beckman SW41 rotor at 40,000 revolutions/min for 16 h at 4°C. Approximately 45 fractions were collected from the bottoms of the tubes and assayed for AChE activity. Activity peaks were assigned different molecular forms according to their apparent sedimentation coefficients. Analysis of AChE molecular forms and processing of the raw data were performed as described elsewhere (14).

RNA extraction and reverse transcription-polymerase chain reaction. Total RNA from cultured myotubes was extracted using Trizol (GIBCO, Burlington, ON, Canada), as recommended by the manufacturer. Briefly, cells were scraped into 500 µl of Trizol and homogenized 2 × 15 s using a Polytron set at 1. After addition of 100 µl of chloroform, the solution was mixed vigorously and spun at 12,000 g for 15 min at 4°C. The aqueous layer was then transferred to a fresh tube, and 250 µl of ice-cold isopropanol were added. For RNA precipitation, the isopropanol mixture was spun, and the resultant pellets were washed three times with ice-cold 75% ethanol.

All final pellets were air dried and initially redissolved in 20 µl of diethylpyrocarbonate (DEPC)-treated water. Total RNA concentration for each sample was determined at 260 nm. Each sample RNA was subsequently further diluted to obtain a final concentration of 50 ng/µl. In our standard assays, only 2 µl of the diluted RNA were reverse transcribed. The reverse transcription (RT) mixture contained 5 mM MgCl2, 1× polymerase chain reaction (PCR) buffer II (50 mM KCl and 10 mM Tris · HCl, pH 8.3), 1 mM deoxynucleotide triphosphates, 20 units ribonuclease inhibitor, 50 units murine leukemia virus reverse transcriptase, and 2.5 mM random hexamer primers (GeneAmp RNA PCR kit, Perkin-Elmer Cetus Instruments, Branchburg, NJ). RT was performed at 42°C for 45 min, followed by heating at 99°C for 5 min to terminate the reaction.

To amplify AChE cDNAs, specific synthetic primers based on the rat AChE cDNA sequence were used (18). These 5' (CTGGGTGCGGATCGGT) and 3' (TCACAGGTCTGAGCAGCGTT) primers amplified a 670-base pair (bp) target sequence in the T transcript encoding the various AChE molecular forms expressed in muscle cells (see Ref. 22). Because these primers are located in different exons, the PCR products that we obtained originated from the cDNAs and not from contaminating genomic DNA. Egr-1 transcripts were selectively amplified using primers based on the rat Egr-1 cDNA (16). These 5' (GAGTTGGGACTGGTAGGTGT) and 3' (GCAACACTTTGTGGCCTGAA) primers amplified a 512-bp target sequence of the Egr-1 cDNA. PCR was performed by adding 5 µl of the RT mixture to 20 µl of a solution containing 0.625 units AmpliTaq DNA polymerase, 0.25 µg each of the appropriate 5' and 3' primers, MgCl2 (2 mM), and PCR buffer II (1×). PCR conditions for AChE consisted of a cycle of denaturation at 94°C for 1 min and primer annealing and extension at 70°C for 3 min. A final 10-min elongation step at 72°C was added after the last cycle. Cycle number for AChE was typically 42. Amplification conditions for Egr-1 transcripts were 94°C for 1 min, 65°C for 1 min, and 72°C for 1 min, followed by a 10-min elongation step after the last cycle. The cycle number for these experiments was 38. After amplification, 10 µl of the PCR mixture were visualized on either a 1 or 1.5% agarose gel containing ethidium bromide. The molecular mass of the PCR products was estimated by comparing product size to a 100-bp ladder marker (GIBCO).

Quantitative PCR was performed as previously described elsewhere in detail (15, 24, 29), under noncompetitive conditions, to determine the relative abundance of AChE transcripts in control vs. mechanically stimulated cells. Selected cDNAs were amplified using 32P-end-labeled primers. Radiolabeled PCR products were visualized on 1.5% agarose gels and excised using a scalpel. The counts per minute (cpm) present in these gel bands were determined directly by Cerenkov counting. Because in these experiments the amount of total RNA subjected to RT-PCR was equal for all samples (see above), our PCR data for both AChE and Egr-1 are normalized per unit of extracted total RNA.

We ascertained that, under our PCR conditions, all measurements were obtained during the linear phase of amplification (see Refs. 15, 24). This was done by serial dilutions of total RNA and by amplification of these dilutions for the appropriate number of cycles (see above). Plotting on a log-log scale the cpm obtained for each dilution vs. the input RNA yielded a linear curve (data not shown). On the basis of these results, all RT-PCR experiments aimed at determining the relative abundance of AChE and Egr-1 transcripts in control and experimental samples were performed using RNA concentrations that fell within the linear curve for that particular number of cycles. In each experiment, negative controls consisted of the same RT and PCR mixtures except that the input RNA was replaced with DEPC-treated water. RT-PCR conditions (primer concentrations, input RNA, choice of RT primer, cycling conditions, and so forth) were initially optimized, and they were identical for all samples. This was highly controlled between samples for some of these parameters, since we consistently used RT and PCR master mixes, and control and experimental samples were always run in parallel. Precautions were taken to avoid contamination from one sample to another and RNA degradation (use of filtered pipette tips and gloves, dedicated sets of pipettes for sample preparation and analysis, specific areas for pre- and post-PCR procedures, and so forth).

Statistical analysis. Paired Student's t-tests were performed to evaluate the effects of mechanical stimulation on expression of AChE. These tests were used to strictly compare the effects of mechanical stimulation vs. control conditions. Because we expected to observe an increase in AChE expression following mechanical stimulation (see introduction), one-tailed t-tests were used to determine significant differences among control and experimental groups. The level of significance was set at P < 0.05. Data are expressed as means ± SE throughout. The patterns of AChE molecular forms displayed in Figs. 4-6 are representative examples.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mechanical stimulation increases AChE activity in cultured myotubes. As shown in Fig. 1, total AChE activity remained initially unaffected by mechanical stimulation. After 24 h of mechanical stimulation, however, there was a significant increase (42%; P < 0.05) in AChE activity compared with the levels observed in control myotubes. TTX treatment of myotubes mechanically stimulated for 24 h did not block the increase in AChE activity following mechanical stimulation. In fact, the increase in AChE activity between myotubes subjected to mechanical stimulation with or without TTX differed by only ~7% (n = 5). By contrast, nifedipine blocked ~50% of the AChE increase seen following mechanical stimulation (Fig. 2).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1.   Total acetylcholinesterase (AChE) activity in myotubes subjected to mechanical stimulation (MS). Eight- to ten-day-old primary cultures of rat myotubes were subjected to 24% mechanical stimulation and harvested 5 min, 30 min, 3 h, and 24 h later. Data are means ± SE. * Significant difference from control (CTL; P < 0.05, n = 10).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of nifedipine treatment on AChE activity in myotubes subjected to mechanical stimulation. Primary cultures of rat myotubes were mechanically stimulated for 24 h in the presence of nifedipine, an L-type calcium channel blocker. Data (means ± SE) are expressed as percent of control. * Significant difference between experimental and control groups (P < 0.05, n = 3). ** Significant difference between mechanically stimulated and nifedipine + mechanically stimulated groups (P < 0.05, n = 3).

Mechanical stimulation increases all AChE molecular forms. To determine whether the increase in AChE activity observed in response to mechanical stimulation was caused by a general elevation in the activity of all molecular forms as opposed to an increase in a specific form, aliquots of muscle homogenates were separated by velocity sedimentation on sucrose gradients, and AChE activity was determined in each fraction. Control rat myotube cultures typically displayed a molecular form profile consisting of forms A12, A8, G4, and G1 (see, for example, Fig. 4A). After 24 h of mechanical stimulation, a similar AChE pattern was observed, indicating that this treatment increased the expression of all molecular forms. Quantitative analysis revealed that the activity of each molecular form, expressed as a percent of total activity, did not change following mechanical stimulation, thereby confirming that this experimental treatment led to an elevation in the levels of all AChE molecular forms as opposed to a preferential increase in a specific form (Fig. 3).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   Activity of AChE molecular forms in myotubes subjected to mechanical stimulation. Values represent relative activity of A12, A8, G4, and G1 forms present in primary cultures of rat myotubes before (control) and after 24 h of mechanical stimulation. Data (means ± SE; n = 3) are expressed as percent of total AChE activity.

As previously observed (see, for example, Refs. 8, 25), TTX treatment selectively decreased the amount of asymmetric forms present in these rat myotube cultures (Fig. 4B). Mechanically stimulating myotubes in the presence of TTX did not induce the reappearance or upregulation of the asymmetric forms (Fig. 4C). This was in fact confirmed by analysis of cultures that did not display significant amounts of spontaneous contractile activity. In these cultures, the levels of asymmetric forms were already low, and mechanical stimulation did not induce their expression (Fig. 5).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of tetrodotoxin (TTX) and mechanical stimulation on AChE molecular forms in rat myotubes. Molecular form profiles of control myotubes (A), TTX-treated myotubes (B), and TTX-treated myotubes with mechanical stimulation for 24 h (C). Note that asymmetric forms present in control cells disappeared following TTX treatment (B) and that these forms did not return following mechanical stimulation (C).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of TTX and mechanical stimulation on AChE molecular forms in noncontracting rat myotubes. Molecular form profiles of control myotubes (A), TTX-treated myotubes (B), and TTX-treated myotubes with mechanical stimulation for 24 h (C) are shown. Note that AChE molecular form profiles did not change in comparison with controls.

Mechanical stimulation increases secretion of AChE. Under control conditions, cultured myotubes secrete G4 into the culture medium (see Refs. 22, 25). We thus examined whether mechanical stimulation also increased secretion of AChE. Analysis of AChE levels in the medium collected from mechanically stimulated rat myotubes for 24 h revealed a 70% increase (P < 0.05) in total enzyme activity compared with controls (Fig. 6). As observed with AChE associated with muscle cells (see Figs. 4 and 5), TX treatment of cultured myotubes failed to prevent the increase in AChE secretion following mechanical stimulation (68% increase over control levels).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of mechanical stimulation on secretion of AChE. Medium was collected from rat myotube cultures mechanically stimulated for 24 h. A: total AChE activity (means ± SE) in media from control and mechanically stimulated myotubes. B: only G4 molecular form of AChE was present in medium from control myotubes. C: after mechanical stimulation, pattern of molecular forms secreted remained unchanged. * Significant difference between control and mechanically stimulated myotubes (P < 0.05, n = 3).

To determine whether passive mechanical forces altered the pattern of AChE molecular form secreted from the myotubes, an aliquot of the medium was separated by velocity sedimentation on sucrose gradients, and each fraction was analyzed for AChE activity. Figure 6B shows that only the G4 form of AChE was present in the medium of these control rat myotubes. Medium collected from myotubes mechanically stimulated for 24 h also contained only the G4 form of AChE although the amount had increased significantly (Fig. 6, B and C).

Mechanical stimulation increases AChE and Egr-1 mRNA levels. To determine the effects of mechanical stimulation on levels of AChE transcripts, quantitative RT-PCR was performed using total RNA extracted from primary cultures of rat myotubes. Selective amplification of AChE cDNAs produced the expected band of 670 bp. Analysis of PCR products revealed that AChE transcript levels per unit of extracted total RNA (see MATERIALS AND METHODS) increased progressively over the time course of the experiments (Fig. 7A) and reached a significant 3.5-fold increase at 24 h (P < 0.05) compared with control levels (Fig. 7B). The apparent early increase in AChE mRNA levels thus preceded the increase seen in total AChE activity (compare Figs. 1 and 7).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7.   Effects of mechanical stimulation on AChE transcript levels in rat myotubes. A: total RNA obtained from control myotubes (lane 1) and myotubes mechanically stimulated for 5 min (lane 2), 30 min (lane 3), 3 h (lane 4), and 24 h (lane 5) was pooled and subjected to reverse transcription-polymerase chain reaction (RT-PCR) for detection of AChE mRNAs; -, negative control lane; left, 100-base pair (bp) ladder. Quantitation of PCR products over the time course revealed maximal accumulation of AChE transcripts at 24 h (lane 5). B: quantitation of individual control and 24-h samples. * Significant difference between control myotubes and myotubes mechanically stimulated for 24 h (P < 0.05, n = 10). CPM, counts/min.

Because Egr-1 mRNA levels are known to increase in response to mechanical stress in other cell types (see, for example, Ref. 17), we also determined whether expression of this immediate-early gene was increased in rat myotubes following mechanical stimulation. Selective amplification of Egr-1 cDNAs produced the expected band of 512 bp. Levels of Egr-1 mRNAs (per unit of extracted total RNA) from mechanically stimulated cells were found to increase rapidly, peaking at 30 min and returning toward control levels thereafter (Fig. 8A). Quantitative analysis revealed a significant 2.3-fold increase (P < 0.05) over control levels at 30 min (Fig. 8B).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 8.   Effects of mechanical stimulation on Egr-1 mRNA levels in rat myotubes. A: total RNA obtained from control myotubes (lane 1) and myotubes mechanically stimulated for 5 min (lane 2), 30 min (lane 3), 3 h (lane 4), and 24 h (lane 5) was pooled and subjected to RT-PCR for detection of Egr-1 transcripts; -, negative control lane; left, 100-bp ladder. Quantitation of PCR products over the time course revealed maximal accumulation of Egr-1 transcripts at 30 min (lane 5). B: quantitation of individual control and 30-min samples. * Significant difference between control myotubes and myotubes mechanically stimulated for 30 min (P < 0.05, n = 10).

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mechanical stimulation of cultured myotubes using different intensities and frequencies can mimic the mechanical events occurring during various types of exercise in vivo (30). In the present study, we thus mechanically stimulated myotubes to determine whether this type of stimulation could, in addition to electrical activity and trophic factors (see introduction), increase expression of AChE. Although no significant changes in the levels of AChE were found up to 3 h after the onset of mechanical stimulation, we observed a significant increase in total AChE activity at 24 h, indicating that passive mechanical stimulation, indeed, increases expression of AChE in cultured rat myotubes. In addition, our results show that this increase in AChE expression was caused by a general elevation in the activity of all AChE molecular forms. Finally, analysis of AChE mRNA levels revealed that the observed increase in enzyme activity was accompanied by an increase in the levels of AChE transcripts, indicating the involvement of a pretranslational regulatory mechanism.

In vivo, skeletal muscles respond to enhanced levels of neuromuscular activity with a significant increase in AChE enzyme activity. Recent studies have shown that, in fast muscles, this increase in AChE expression results primarily from a selective increase in the content of G4, provided that the recruitment pattern of the muscle is phasic as opposed to tonic (2, 7, 14, 29). Therefore, in the present study, we also determined whether passive mechanical stimulation influenced preferentially the expression of a specific AChE molecular form. Sedimentation analysis revealed that the increase in total AChE was due to an elevation in the activity of all molecular forms. This type of general increase in all AChE molecular forms resembles that previously seen in response to compensatory hypertrophy (13, 29). This suggests, therefore, that the adaptive response of skeletal muscle fibers to mechanical stimulation is similar to that occurring in hypertrophying muscles. This conclusion is in fact coherent with other studies that have shown that cultured myotubes react to mechanical stimulation by displaying cell growth and hypertrophy (5, 31).

The delayed expression of AChE in response to mechanical stimulation has been observed previously for other molecules (see Ref. 32). This delay may be caused by the nature of the mechanogenic signaling pathway involved in regulating AChE expression. A muscle cell may respond to an external mechanical signal in a rapid (milliseconds), intermediate (minutes), or longer (hours, days) fashion (1). The minimum delay of 3 h that we observed for significant AChE induction suggests, in this case, the involvement of pretranslational regulatory mechanisms (1, 30). Accordingly, we examined the levels of AChE mRNA in response to mechanical stimulation and found that transcript levels accumulated progressively over the experimental time course, reaching a significant 3.5-fold increase over controls at 24 h.

The increased expression of AChE mRNAs following mechanical stimulation may have occurred via two mechanisms. First, mechanical stimulation may have caused a significant reduction in the degradation rate of AChE transcripts. This view is in fact strongly supported by the recent demonstration that, during myogenesis, AChE mRNA levels are upregulated via an increase in the stability of existing transcripts as opposed to the transcriptional activation of the AChE gene (9, 21). Alternatively, mechanical stimulation may have led to an increase in the expression of specific transcription factors with the subsequent transcriptional activation of the AChE gene. Expression of several immediate-early genes such as Egr-1 has already been shown to be exquisitely sensitive to the effects of mechanical stimulation in various cell types (for example, this study; for review, see Refs. 1, 17). Furthermore, a recent study has demonstrated that passive stretch can modulate expression of myogenin and muscle regulatory factor 4 in skeletal muscle fibers, indicating that these basic helix-loop-helix transcription factors may regulate gene expression under these conditions (20). Because the AChE promoter contains several binding sites for Egr-1 and myogenic factors (19), it is conceivable that the increased expression of these transcription factors following mechanical stimulation ultimately transactivates the AChE gene, thereby leading to an increased steady-state level of AChE mRNA. This view is particularly attractive, since Li et al. (19) have previously reported that mutation of the Egr-1 sites on the mouse AChE promoter results in a marked loss in the activity of a reporter gene in transfected cells.

Previous studies have highlighted the contribution of electrical activity in the regulation of AChE expression in vivo as well as in vitro. Using TTX, a potent Na+ channel blocker, we uncoupled the effects of electrical activity from those induced by mechanical stimulation on AChE expression. TTX treatment of cultured myotubes failed to prevent the increase in AChE expression and secretion following mechanical stimulation. The inability of TTX to block the increase in AChE expression following passive mechanical stimulation suggests that the regulatory mechanism involved in the adaptive response of AChE to mechanogenic forces is independent of electrical activity. These results are thus consistent with previous findings that have shown, for example, that TTX treatment of cultured myotubes subjected to mechanical stimulation also failed to prevent increases in the expression of cyclooxygenase (34), phospholipases (33), and other proteins required for cell growth and hypertrophy (31, 32).

The notion that mechanical stimulation regulates AChE expression via an electrical activity-independent pathway is corroborated by examination of the molecular form profiles in cultured myotubes subjected to passive mechanical forces in the presence of TTX. TTX treatment of spontaneously contracting myotubes decreased the levels of asymmetric forms, and mechanical stimulation failed to restore their levels. Similarly, mechanical stimulation of noncontracting cultures did not induce the appearance of the asymmetric forms of AChE. Because, in cultured muscle cells, it is well established that expression of the asymmetric forms depends largely on electrical activity (see Refs. 8, 25), these results strengthened the notion that mechanical stimulation increases expression of AChE by a mechanism distinct altogether from that involved in the activity-linked regulation of AChE.

Cells subjected to mechanical stimulation respond to mechanogenic forces by exhibiting a variety of changes, including a rise in intracellular Ca2+ levels. This rise in intracellular Ca2+ can occur quickly, increasing by 50% within the first 10 min after the onset of stimulation (1, 17). Because intracellular Ca2+ entering myotubes via L-type channels has been shown to be a key modulator of AChE mRNA expression (21), we determined whether this pathway was involved in the overall response of AChE to mechanical stimulation. L-type channels were blocked using nifedipine, and myotubes were mechanically stimulated for 24 h. Nifedipine was able to partially block the increase seen in response to mechanical stimulation. These results suggest that Ca2+ indeed plays a role in modulating AChE expression in response to mechanogenic forces. In addition, they demonstrate that, although entry of Ca2+ through L-type channels is necessary for the full adaptive response to occur, it is not the sole signal transduction system involved, since the AChE response was only partially abolished. Additional Ca2+ influx from alternative sources such as mechanosensitive ion channels and/or distinct signaling pathways may thus also participate in initiating the overall adaptive changes in the expression of AChE following mechanical stimulation.

In conclusion, AChE expression in skeletal muscle fibers is known to be significantly influenced by the presence of motoneurons. However, the results of the present study showing that passive mechanical forces regulate expression of AChE in cultured myotubes offer an additional mechanism by which AChE levels may be modified. This mechanism likely plays important functional roles in the control of AChE expression both in developing muscle fibers and at mature neuromuscular junctions. During embryogenesis and myogenesis, for example, mechanical forces have undoubtedly significant physiological ramifications, since, during differentiation of skeletal muscle, developing fibers are likely subjected to the effects of passive mechanical forces as a result of the growth of the bones (28). In addition, a recent study has demonstrated that neuromuscular junctions undergo intense mechanical distortions during cycles of muscle contraction and relaxation (26). Given that AChE expression in this region of muscle fibers is known to be exquisitely sensitive to neural influences (15, 24), mechanical stimulation may therefore represent an additional regulatory factor affecting AChE expression markedly yet independently of the well-known effects of the motor nerve. In this context, it would therefore be of interest to determine whether the expression of other synaptic proteins is also altered in response to mechanical stimulation.

    ACKNOWLEDGEMENTS

We are grateful to Dr. David J. Parry for advice about the primary cultures of rat myotubes.

    FOOTNOTES

This work was supported by grants from the Medical Research Council of Canada (MRC) and the Ontario Thoracic Society to B. J. Jasmin. B. J. Jasmin is a Scholar of the MRC.

Address for reprint requests: B. J. Jasmin, Dept. of Physiology, Faculty of Medicine, University of Ottawa, 451 Smyth Rd., Ottawa, ON, Canada K1H 8M5.

Received 29 May 1997; accepted in final form 8 August 1997.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1.   Banes, J. A., M. Tsuzaki, J. Yamamoto, T. Fischer, B. Brigman, T. Brown, and L. Miller. Mechanoreception at the cellular level: the detection, interpretation, and diversity of responses to mechanical signals. Biochem. Cell Biol. 73: 349-365, 1995[Medline].

2.   Boudreau-Larivière, C., V. Gisiger, R. N. Michel, D. A. Hubatsch, and B. J. Jasmin. Fast and slow skeletal muscle fibers express a common basic profile of acetylcholinesterase molecular forms. Am. J. Physiol. 272 (Cell Physiol. 41): C68-C76, 1997[Abstract/Free Full Text].

3.   Boudreau-Larivière, C., H. Sveistrup, D. J. Parry, and B. J. Jasmin. Ciliary neurotrophic factor: regulation of acetylcholinesterase in skeletal muscle and distribution of messenger RNA encoding its receptor in synaptic versus extrasynaptic compartments. Neuroscience 73: 613-622, 1996[Medline].

4.   Butler, I. J., D. B. Drackman, and A. M. Goldberg. The effect of disuse on cholinergic enzymes. J. Physiol. (Lond.) 274: 593-600, 1978[Abstract/Free Full Text].

5.   Chromiak, J. A., and H. H. Vandenburgh. Glucocorticoid-induced skeletal muscle atrophy in vitro is attenuated by mechanical stimulation. Am. J. Physiol. 262 (Cell Physiol. 31): C1471-C1477, 1992[Abstract/Free Full Text].

6.   Ellman, G. L., D. K. Courtney, V. Andres, and R. M. Featherstone. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7: 88-95, 1961[Medline].

7.   Fernandez, H. L, and J. A. Donoso. Exercise selectively increases G4 AChE activity in fast-twitch muscle. J. Appl. Physiol. 65: 2245-2252, 1988[Abstract/Free Full Text].

8.   Fernandez-Valle, C., and R. L. Rotundo. Regulation of acetylcholinesterase synthesis and assembly by muscle activity. J. Biol. Chem. 264: 14043-14049, 1989[Abstract/Free Full Text].

9.   Fuentes, M. E., and P. Taylor. Control of acetylcholinesterase gene expression during myogenesis. Neuron 10: 679-687, 1993[Medline].

10.   Gisiger, V., and H. R. Stephens. Localization of a pool of G4 acetylcholinesterase characterizing fast muscles and its alteration in murine muscular dystrophy. J. Neurosci. Res. 19: 62-78, 1988[Medline].

11.   Goldspink, G., and F. W. Booth. Mechanical signals and gene expression in muscle. Am. J. Physiol. 262 (Regulatory Integrative Comp. Physiol. 31): R327-R328, 1992.

12.   Hodges-Savola, C. A., and H. L. Fernandez. A role for calcitonin gene-related peptide in the regulation of rat skeletal muscle G4 acetylcholinesterase. Neurosci. Lett. 190: 117-120, 1995[Medline].

13.   Jasmin, B. J., P. F. Gardiner, and V. Gisiger. Muscle acetylcholinesterase adapts to compensatory overload by a general increase in its molecular forms. J. Appl. Physiol. 70: 2485-2489, 1991[Abstract/Free Full Text].

14.   Jasmin, B. J., and V. Gisiger. Regulation by exercise of the pool of G4 acetylcholinesterase characterizing fast muscles: opposite effect of running training in antagonist muscles. J. Neurosci. 10: 1444-1454, 1990[Abstract].

15.   Jasmin, B. J., R. K. Lee, and R. L. Rotundo. Compartmentalization of acetylcholinesterase mRNA and enzyme at the vertebrate neuromuscular junction. Neuron 11: 467-477, 1993[Medline].

16.   Kendall, G., E. Ensor, A. Brar-Rai, J. Winter, and D. S. Latchman. Nerve growth factor induces expression of immediate-early genes NGFI-A (Egr-1) and NGFI-B (nur 77) in adult rat dorsal root ganglion neurons. Mol. Brain Res. 25: 73-79, 1994.[Medline]

17.   Komuro, I., and Y. Yazaki. Control of cardiac gene expression by mechanical stress. Annu. Rev. Physiol. 55: 55-75, 1993[Medline].

18.   Legay, C., S. Bon, and J. Massoulié. Expression of a cDNA encoding the glycolipid-anchored form of rat acetylcholinesterase. FEBS Lett. 315: 163-166, 1993[Medline].

19.   Li, Y., S. Camp, T. L. Rachinsky, C. Bongiorno, and P. Taylor. Promoter elements and transcriptional control of the mouse acetylcholinesterase gene. J. Biol. Chem. 268: 3563-3572, 1993[Abstract/Free Full Text].

20.   Loughna, P. T., and C. Brownson. Two myogenic regulatory factor transcripts exhibit muscle specific responses to disuse and passive stretch in adult rats. FEBS Lett. 390: 304-306, 1996[Medline].

21.   Luo, Z., M. E. Fuentes, and P. Taylor. Regulation of acetylcholinesterase mRNA stability by calcium during differentiation from myoblasts to myotubes. J. Biol. Chem. 269: 27216-27223, 1994[Abstract/Free Full Text].

22.   Massoulié, J., L. Pezzementi, S. Bon, E. Krejci, and F. M. Vallette. Molecular and cellular biology of cholinesterases. Prog. Neurobiol. 41: 31-91, 1993[Medline].

23.   McMahan, U. J., J. R. Sanes, and L. M. Marshall. Cholinesterase is associated with the basal lamina at the neuromuscular junction. Nature 271: 172-174, 1978[Medline].

24.   Michel, R. N., C. Q. Vu, W. Tetzlaff, and B. J. Jasmin. Neural regulation of acetylcholinesterase mRNAs at mammalian neuromuscular synapses. J. Cell Biol. 127: 1061-1069, 1994[Abstract/Free Full Text].

25.   Rubin, L. L. Increases in muscle Ca2+ mediate changes in acetylcholinesterase and acetylcholine receptors caused by muscle contraction. Proc. Natl. Acad. Sci. USA 82: 7121-7125, 1985[Abstract/Free Full Text].

26.   Santo Neto, H., O. T. Nguyen, and J. W. Lichtman. Protein synthesis inhibition in postsynaptic cells is followed within several days by elimination of nerve terminals (Abstract). Soc. Neurosci. Abstr. 22: 1690, 1996.

27.   Shyu, K. G., J. J. Chen, N. L. Shih, D. L. Wang, H. Chang, W. P. Lien, and C. C. Liew. Regulation of human cardiac myosin heavy chain genes by cyclical mechanical stimulation stretch in cultured myocytes. Biochem. Biophys. Res. Commun. 210: 567-573, 1995[Medline].

28.   Stewart, D. M. The role of tension in muscle growth. In: Regulation of Organ and Tissue Growth, edited by R. J. Goss. New York: Academic, 1972, p. 77-100.

29.   Sveistrup, H., R. Y. Y. Chan, and B. J. Jasmin. Chronic enhancement of neuromuscular activity increases acetylcholinesterase gene expression in skeletal muscle. Am. J. Physiol. 269 (Cell Physiol. 38): C856-C862, 1995[Abstract/Free Full Text].

30.   Vandenburgh, H. H. Mechanical forces and their second messengers in stimulating cell growth in vitro. Am. J. Physiol. 262 (Regulatory Integrative Comp. Physiol. 31): R350-R355, 1992[Abstract/Free Full Text].

31.   Vandenburgh, H. H., S. Hatfaludy, P. Karlisch, and J. Shansky. Skeletal muscle growth is stimulated by intermittent stretch-relaxation in tissue culture. Am. J. Physiol. 256 (Cell Physiol. 25): C674-C682, 1989[Abstract/Free Full Text].

32.   Vandenburgh, H. H., S. Hatfaludy, P. Karlisch, and J. Shansky. Mechanically-induced alterations in cultured skeletal muscle growth. J. Biomech. 24: 91-99, 1991.

33.   Vandenburgh, H. H., J. Shansky, P. Karlisch, and R. L. Solerssi. Mechanical stimulation of skeletal muscle generates lipid-related second messengers by phospholipase activation. J. Cell. Physiol. 155: 63-71, 1993[Medline].

34.   Vandenburgh, H. H., J. Shansky, R. Solerssi, and J. Chromiak. Mechanical stimulation of skeletal muscle increases prostaglandin F2alpha production, cyclooxygenase activity, and cell growth by a pertussis toxin sensitive mechanism. J. Cell. Physiol. 163: 285-294, 1995[Medline].

35.   Wilson, E., Q. Mai, K. Sudhir, R. H. Weiss, and H. E. Ives. Mechanical strain induces growth of vascular smooth muscle cells via autocrine action of PDGF. J. Cell Biol. 123: 741-747, 1993[Abstract/Free Full Text].


AJP Cell Physiol 273(6):C2002-C2009
0363-6143/97 $5.00 Copyright © 1997 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Rauch and P. T. Loughna
Static stretch promotes MEF2A nuclear translocation and expression of neonatal myosin heavy chain in C2C12 myocytes in a calcineurin- and p38-dependent manner
Am J Physiol Cell Physiol, March 1, 2005; 288(3): C593 - C605.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
W. Matar, J. A. Lunde, B. J. Jasmin, and J.-M. Renaud
Denervation enhances the physiological effects of the KATP channel during fatigue in EDL and soleus muscle
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2001; 281(1): R56 - R65.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. Boudreau-Lariviere, D. J. Parry, and B. J. Jasmin
Myotubes originating from single fast and slow satellite cells display similar patterns of AChE expression
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2000; 278(1): R140 - R148.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hubatsch, D. A.
Right arrow Articles by Jasmin, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hubatsch, D. A.
Right arrow Articles by Jasmin, B. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online