|
|
||||||||
Vol. 273, Issue 5, C1571-C1580, November 1997
1 Center for Experimental
Therapeutics and Reperfusion Injury, Intercellular
adhesion molecule 1 (ICAM-1) is an important molecule in promotion of
polymorphonuclear neutrophil transendothelial migration during
inflammation. Coincident with many inflammatory diseases is tissue
hypoxia. Thus we hypothesized that combinations of hypoxia and
inflammatory stimuli may differentially regulate expression of
endothelial ICAM-1. Human endothelial cells were exposed to hypoxia in
the presence or absence of added lipopolysaccharide (LPS) and examined
for expression of functional ICAM-1. Although hypoxia alone did not
induce ICAM-1, the combination of LPS and hypoxia enhanced (3 ± 0.4-fold over normoxia) ICAM-1 expression. Combinations of hypoxia and
LPS significantly increased lymphocyte binding, and such increases were
inhibited by addition of anti-ICAM-1 antibodies or antisense
oligonucleotides. Hypoxic endothelia showed a >10-fold increase in
sensitivity to inhibitors of proteasome activation, and combinations of
hypoxia and LPS enhanced proteasome-dependent cytoplasmic-to-nuclear
localization of the nuclear transcription factor-
leukocyte; endothelium; inflammation; sepsis; intercellular
adhesion molecule 1
IN SETTINGS OF inflammation, tissue hypoxia often
occurs. For instance, the hallmark of septic shock is vascular
hypotension, leading to widespread cell and tissue hypoxia (reviewed in
Ref. 24, 33). Endothelial cells that line blood vessels bear activable receptors for many inflammatory stimuli, including
lipopolysaccharides (LPS). Because endothelia are anatomically
positioned at the interface of the blood and tissue exchange,
endothelia are especially influenced by conditions of hypoxemia (22). A
number of studies have examined the influence of hypoxia on endothelial
cell structure/function (recently reviewed in Ref. 30). Hypoxia-induced
changes are complex and include changes in energy metabolism,
alterations in gene expression, and induction of specific cell surface
proteins (reviewed in Ref. 30).
Tissue injury resulting from reperfusion of hypoxic tissue has been
shown to be mediated, at least in part, by recruitment of leukocytes
(32). Leukocyte recruitment across the intact endothelium occurs
through a concerted series of adhesion and deadhesion events involving
a number of cell surface adhesion proteins (28). Previous studies have
demonstrated that short-term hypoxia/anoxia induces increased adhesion
of leukocytes to vascular endothelial cells, and such adhesion can be
blocked, at least in part, by antibodies directed at intercellular
adhesion molecule 1 (ICAM-1, CD54) (26, 35), a 90- to 110-kDa
glycoprotein found on the surface of endothelial cells that mediates
the firm adherence of leukocytes to the endothelium (28). ICAM-1
expression is readily induced by stimulation of cell surface receptors
for a number of inflammatory mediators, including LPS (28), and is regulated by the nuclear transcription factor (NF)- Thus we hypothesized that hypoxia may augment cell surface expression
of leukocyte adhesion receptors, such as ICAM-1. We report here that,
whereas hypoxia alone does not induce ICAM-1 expression over baseline,
the combination of hypoxia and LPS enhances expression of ICAM-1. Such
enhancement was not universal for other extracellular membrane proteins
and correlated with hypoxia-elicited increases in nuclear content of
the NF- Cell culture.
Human umbilical vein endothelial cells (HUVECs) were obtained
and harvested as described elsewhere (13) using 0.1% collagenase (Worthington Biochemical, Freehold, NJ). Human pulmonary microvascular endothelial cells (HPMVECs) were purchased from Clonetics (San Diego,
CA) as first passage cells and, when used, were cultured under similar
conditions as for HUVECs. Endothelial monolayers were established,
maintained, and subcultured with Dulbecco's modified Eagle's medium
(GIBCO, Grand Island, NY) containing 10% heat-inactivated fetal calf
serum, glucose, pyruvate, glutamine, penicillin, and streptomycin (13).
Confluent endothelial monolayers exhibited typical cobblestone
appearance and uptake of acetylated low-density
lipoprotein (Biomedical Technology, Stoughton, MA; data
not shown). Where indicated, endothelial monolayers were exposed to LPS
(from Escherichia coli; Sigma, St. Louis, MO) at indicated
concentrations.
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
B p65
(Rel A) subunit. Such proteasome
activation correlated with hypoxia-evoked decreases in both
extracellular and intracellular pH. We conclude from these studies that
endothelial hypoxia provides a novel, proteasome-dependent stimulus for
ICAM-1 induction.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
B, a pleiotropic activator of a number of genes related to inflammation (9). Previous
studies have defined a role for the ubiquitin-mediated proteasome
pathway in NF-
B induction, specifically through degradation of p50
and inhibitory (I)-
B (20). At present, it is unclear whether molecules such as ICAM-1 are differentially regulated by a
combination of hypoxia and mediators found within the microenvironment of inflamed tissue.
B p65 subunit. We speculate that in the setting of hypoxia,
inflammatory mediators such as LPS may perpetuate expression of
molecules important in leukocyte trafficking, such as ICAM-1.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Cell surface immunoassay. ICAM-1 cell surface expression was quantified with a cell surface enzyme-linked immunosorbent assay (ELISA), as previously described (7). Endothelial cells were grown and assayed for antibody binding following exposure to normoxia or hypoxia in the presence or absence of LPS, as indicated. Endothelia were lightly fixed with paraformaldehyde (1% wt /vol in phosphate-buffered saline) to preserve cell surface protein. Cells were washed with Hanks' balanced salt solution (HBSS; Sigma) and blocked with medium for 30 min at 4°C. Anti-ICAM-1 monoclonal antibody (MAb) [clone P2A4 (12), obtained from the Developmental Studies Hybridoma Bank (Iowa City, IA) and used as undiluted cell culture supernatant] or R6.5 (27) [a kind gift from Dr. Robert Rothlein, Boehringer Ingelheim Pharmaceuticals (Ridgefield, CT), and used as purified MAb at 20 µg/ml] was added to fixed cells and allowed to incubate for 2 h at 4°C. Where indicated, MAb to major histocompatibility complex (MHC) class I (5) (clone W6/32, obtained from the American Type Culture Collection and used as 1:100 diluted ascitic fluid) was used as a control. After a wash with HBSS, a peroxidase-conjugated sheep anti-mouse secondary antibody (Cappel, West Chester, PA) was added. Secondary antibody (1:1,000 final dilution) was diluted in medium containing 10% fetal bovine serum (FBS). After washing, plates were developed by addition of peroxidase substrate [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), 1 mM final concentration, Sigma] and read on a microtiter plate spectrophotometer at 405 nm (Molecular Devices). Controls consisted of medium only and secondary antibody only. Optical density data at 405 nm (OD405, background subtracted) are presented as means ± SE.
Immunoprecipitation of biotinylated endothelial membranes. HUVECs were grown to confluence on six-well plates, exposed to experimental conditions, and washed with HBSS. Extracellular cell surface proteins were then labeled with biotin (ImmunoPure sulfo-NHS-biotin; 1 mM; Pierce, Rockford, IL) as described previously (18). Unbound biotin was quenched with NH4Cl (50 mM) in HBSS. Labeled HUVECs were lysed [in buffer containing 150 mM NaCl, 25 mM tris(hydroxymethyl)aminomethane (Tris), 1 mM MgCl2, 1% Triton X-100, 1% Nonidet P-40, 5 mM EDTA, 5 µg/ml chymostatin, 2 µg/ml aprotinin, and 1.25 mM phenylmethylsulfonyl fluoride (PMSF), all from Sigma]. Cell debris was removed by centrifugation (10,000 g, 5 min). HUVEC lysates were precleared with 50 µl preequilibrated protein G-Sepharose (Pharmacia, Uppsala, Sweden) for 2 h. For immunoprecipitation of ICAM-1, primary antibody (500 µl of P2A4 cell culture supernatant) was added (immunoprecipitated for 2 h), followed by addition of 50 µl of preequilibrated protein-G Sepharose (immunoprecipitated overnight on an end-over-end rotator). Washed immunoprecipitates were boiled in nonreducing sample buffer [2.5% sodium dodecyl sulfate (SDS), 0.38 M Tris (pH 6.8), 20% glycerol, and 0.1% bromphenol blue], separated by SDS-polyacrylamide gel electrophoresis (PAGE; 10% linear gel) under nonreducing conditions and transferred to nitrocellulose using standard protocols. Biotinylated proteins were labeled with streptavidin-peroxidase and visualized by enhanced chemiluminescence (ECL; Amersham, Arlington Heights, IL). Resulting ICAM-1 bands were quantified from scanned images using National Institutes of Health (NIH) Image software (Bethesda, MD).
Lymphocyte adhesion assay. Peripheral blood mononuclear cells (PBMC) were obtained by centrifugation through Ficoll-Hypaque (1.077). Lymphocyte-enriched fractions were obtained by incubating PBMC in 10% FBS-RPMI 1640 on tissue culture-treated plastic 24-well plates for 1 h at 22°C and collecting nonadherent cells. For studies of adhesion, enriched lymphocyte populations (>95%) were labeled for 30 min at 37°C with 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein-acetoxymethyl ester (BCECF-AM, 5 µM final concentration; Calbiochem, San Diego, CA) and washed three times in HBSS. Labeled lymphocytes (1 × 105/monolayer) were added to washed normoxic or hypoxic monolayers, plates were centrifuged at 150 g for 4 min to uniformly settle lymphocytes, and adhesion was allowed for 10 min at 37°C. Monolayers were gently washed three times with HBSS, and fluorescence intensity (485-nm excitation, 530-nm emission) was measured on a fluorescent plate reader (Cytofluor 2300, Millipore, Bedford, MA). Adherent cell numbers were determined from standard curves generated by serial dilution of known lymphocyte numbers diluted in HBSS. All data were normalized for background fluorescence by subtraction of fluorescence intensity of samples collected from monolayers incubated in buffer only, without addition of lymphocytes.
In subsets of experiments, treated HUVECs were preincubated with MAb directed against domains specific to the lymphocyte functions-associated antigen (LFA)-1 (RR1/1, 20 µg/ml; Ref. 29) and Mac-1 (R6.5, 20 µg/ml; Ref. 11) of ICAM-1 or MHC class I (W6/32, binding control, 20 µg/ml) before lymphocyte adhesion. Anti-ICAM-1 MAb were a kind gift from Dr. R. Rothlein.ICAM-1 antisense oligonucleotide treatment of HUVECs. Antisense oligonucleotide treatment of confluent HUVECs was done exactly as described previously using the oligonucleotides ISIS-1939 (targets the mRNA 3' untranslated region, sequence CCCCCACCACTTCCCCTCTC) or ISIS-3067 (targets the mRNA 5' untranslated region, sequence TCTGAGTAGCAGAGGAGCTC) (6). Oligonucleotides were a kind gift from Dr. C. F. Bennett, ISIS Pharmaceuticals (Carlsbad, CA). Confluent HUVECs were washed in serum-free Opti-MEM (GIBCO) and then in Opti-MEM containing 10 µg/ml N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (Lipofectin solution at 10 µg/ml, GIBCO), followed by the indicated concentrations of filter-sterilized oligonucleotides. Cells were incubated for 4 h at 37°C and then replaced with normal growth medium in the presence or absence of LPS and incubated in normoxia or hypoxia as described above. ICAM-1 expression or MHC class I expression (control) was quantified with the methods described in Cell surface immunoassay. Methods for lymphocyte adhesion to such oligonucleotide-treated cells were carried exactly as described in Lymphocyte adhesion assay.
Proteasome inhibition experiments. Confluent HUVEC monolayers grown on 96-well plates were equilibrated to hypoxia or normoxia for 1 h in the presence of the proteasome inhibitors N-acetyl-Leu-Leu-methioninal (ALLM, calpain inhibitor II, purchased from Boehringer Mannheim, Indianapolis, IN) or N-acetyl-Leu-Leu-norleucinal (ALLN, calpain inhibitor I, purchased from Boehringer Mannheim) at indicated concentrations before addition of LPS. After 18 h in hypoxia or normoxia, cell surface expression of ICAM-1 and MHC class I was examined by cell surface ELISA as described in Cell surface immunoassay.
Measurement of intracellular pH. Intracellular pH was measured as described previously (1) using HUVECs grown to confluence on 96-well plates. Briefly, endothelia were exposed to combinations of hypoxia or normoxia with or without addition of LPS (range was 1-100 ng/ml) for 18 h. Within the setting of normoxia or hypoxia, monolayers were washed with preequilibrated HBSS and loaded with BCECF-AM (10 µM final concentration, Calbiochem) for 30 min at 37°C. Loaded monolayers were washed three times in preequilibrated HBSS, and fluorescence intensity (485-nm excitation, 530-nm emission) was immediately measured on a fluorescent plate reader (Cytofluor 2300, Millipore). Similarly loaded cells were also measured at a reference wavelength (360-nm excitation, 530-nm emission), and the fluorescence ratio of 485:360 was used to determine intracellular pH. Intracellular pH was calibrated using nigericin (10 µg/ml) to equilibrate intracellular and extracellular pH (1), and this calibration was linear in the pH range of 6.7-7.5. In subsets of experiments, pH of extracellular medium was adjusted with HCl in the range of 6.8-7.3 before addition to HUVEC monolayers.
NF-
B p65 Western blotting.
After experimental treatment of HUVECs, nuclear extracts were prepared
as described previously (34). Confluent monolayers of HUVECs in 100-mm
petri dishes were washed in ice-cold phosphate-buffered saline and
lysed by incubation in 500 µl of buffer
A [in mM: 10 N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic
acid (HEPES), pH 8.0, 1.5 MgCl2, 10 KCl, 0.5 dithiothreitol
(DTT), 200 sucrose, and 0.5 PMSF and 1 µg/ml of both leupeptin and
aprotinin and 0.5% Nonidet P-40] for 5 min at 4°C. The crude
nuclei released by lysis were collected by microcentrifugation (15 s).
Nuclei were rinsed once in buffer A
and resuspended in 100 µl of buffer
C [in mM: 20 HEPES (pH 7.9), 1.5 MgCl2, 420 NaCl, 0.2 EDTA, 0.5 PMSF, and 1.0 DTT and 1 µg/ml of both leupeptin and aprotinin].
Nuclei were incubated on a rocking platform at 4°C for 30 min and
clarified by microcentrifugation for 5 min. Proteins were measured
(detergent compatible protein assay, Bio-Rad, Hercules, CA). Samples
(25 µg/lane, as indicated) of HUVEC lysates were separated by
nonreducing SDS-PAGE, transferred to nitrocellulose, and blocked
overnight in blocking buffer (250 mM NaCl, 0.02% Tween 20, 5% goat
serum, and 3% bovine serum albumin). Primary antibody (rabbit
polyclonal specific for p65 subunit of NF-
B; Biomol Research
Laboratories, Plymouth Meeting, PA) was added for 3 h, blots were
washed, and species-matched peroxidase-conjugated secondary antibody
was added. Labeled bands from washed blots were detected by ECL.
Resulting 65-kDa NF-
B bands were quantified from scanned images
using NIH Image software. Such 65-kDa bands were specific for NF-
B,
since preincubation of rabbit polyclonal antibody with standard p65 antigen (provided by Biomol as a control) resulted in a diminution of
the 65-kDa band by more than 70% (data not shown).
Data presentation. Data were compared by analysis of variance (ANOVA) or by Student's t-test. Values are expressed as means ± SE of n experiments.
| |
RESULTS |
|---|
|
|
|---|
Hypoxia enhances LPS-induced ICAM-1 expression. Endothelial monolayers tolerated exposure to hypoxia well (ambient O2 as low as 1%, for up to 24 h). No changes in morphology were observed, and no evidence of cell death was apparent (based on soluble lactate dehydrogenase measurements from supernatants, data not shown). We first examined the induction of ICAM-1 surface expression induced by LPS under conditions of endothelial exposure to hypoxia or to normoxia. In Fig. 1, the dose responses for LPS induction of ICAM-1 on HUVEC and on HPMVEC by cell surface ELISA are shown. As can be seen, unstimulated expression of ICAM-1 was low, and hypoxia alone (1% ambient O2) did not induce cell surface ICAM-1 on either HUVEC or HPMVEC (P = not significant compared with normoxic control). However, in the presence of LPS, more than twofold augmentation in ICAM-1 was evident on both HUVEC (two-way ANOVA, P < 0.025 compared with normoxia) and HPMVEC (two-way ANOVA, P < 0.01 compared with normoxia).
|
|
Hypoxia increases immunoprecipitable ICAM-1. To confirm the findings of our whole cell ELISA, we determined the influence of hypoxia on immunoprecipitable ICAM-1 from biotinylated HUVEC monolayers. As shown in Fig. 3, HUVEC exposure to LPS (5 or 50 ng/ml, 18 h) under normoxic conditions revealed immunoprecipitation of an ~95-kDa biotinylated protein consistent with endothelial ICAM-1. Some expression was apparent from control samples not exposed to LPS, consistent with our ELISA findings (Figs. 1 and 2). Confluent HUVECs exposed to a combination of LPS and hypoxia revealed an immunoprecipitable band of increased density over normoxia at LPS concentrations of 5 and 50 ng/ml (Fig. 3). Consistent with our ELISA findings, no observable increase in ICAM-1 was apparent with hypoxia alone (Fig. 3). Densitometric analysis of these bands (Fig. 3B) revealed a 330% increase at 5 ng/ml LPS and an 83% increase at 50 ng/ml LPS under conditions of hypoxia (Fig. 3B), confirming our ELISA results.
|
Hypoxia enhances ICAM-1-dependent lymphocyte adhesion. We next examined whether hypoxic conditions demonstrated here to enhance ICAM-1 expression on HUVECs were apparent at the functional level. First, as shown in Fig. 4, a significant increase in lymphocyte binding was apparent in HUVECs exposed to a combination of hypoxia and LPS (100 ng/ml) over that of exposure to LPS alone [see conditions of the binding control (MAb W6/32), 2.1 ± 0.4-fold increase with hypoxia, P < 0.001]. Lymphocyte adhesion to LPS-preexposed HUVECs was significantly diminished by addition of anti-ICAM-1 MAb directed against the LFA-1-dependent ICAM-1 site (29) (MAb was RR1.1, adhesion decreased by 79 ± 9% and 70 ± 7% for normoxia and hypoxia in the presence of LPS compared with binding control W6/32, respectively, P < 0.001 for both) but not the Mac-1-dependent ICAM-1 site (11) (MAb was R6.5, adhesion decreased by 11 ± 7% and 13 ± 5% for normoxia and hypoxia in the presence of LPS compared with binding control W6/32, respectively, P = not significant for both), indicating that a primary contribution of lymphocyte binding is LFA-1 binding through ICAM-1. However, even in the presence of saturating concentrations of MAb RR1.1 (20 µg/ml, determined by dilution and cell surface ELISA, data not shown), a nearly twofold increase in lymphocyte binding was apparent in HUVECs exposed to both LPS and hypoxia (Fig. 4). No significant differences existed in lymphocyte binding to HUVECs exposed to hypoxia or normoxia alone (Fig. 4, P = not significant for all).
|
|
Evidence for increased proteasome activation in hypoxic endothelia.
The NF-
B/Rel A family of transcription factors are
important for induction and expression of a number of cellular gene
products, including endothelial ICAM-1 (8). In quiescent endothelia, NF-
B is complexed to the inhibitor I-
B. When activation occurs, proteasome-dependent I-
B degradation (9) allows
cytoplasmic-to-nuclear localization of NF-
B. Thus, as a measure of
proteasome activation, we examined cytoplasm-to-nuclear localization of
NF-
B (p65 subunit) in hypoxic and normoxic endothelia. As shown in
Fig. 6, and similar to our findings with
ICAM-1 surface expression (Fig. 1), endothelial exposure to hypoxia
alone failed to induce p65 nuclear localization. However, in the
presence of LPS (concentration range of 1-100 ng/ml), a four- to
sixfold increase in nuclear-to-cytoplasmic p65 ratio was observed in
cells exposed to a combination of hypoxia and LPS (ANOVA,
P < 0.05 compared with normoxia).
Under these conditions, no observable differences between hypoxia or
normoxia were observed in the cytoplasmic fraction of p65 (Fig.
6).
|
B and imply a hypoxia-evoked increase in
proteasome activation.
|
Role for metabolic acidosis in hypoxia-elicited increases in ICAM-1. A number of recent in vivo and ex vivo studies indicate a role for acidosis in activation of the ubiquitin-proteasome pathway (2, 15, 19). Thus we determined whether cell culture acidosis, measured as pH of extracellular medium and intracellular pH, was associated with our observed increase in ICAM-1 expression. As shown in Fig. 8A, 24-h endothelial exposure to hypoxia alone resulted in a small decrease in medium pH (P < 0.05). The combination of hypoxia and LPS enhanced this decrease in medium pH (ANOVA, P < 0.01) in a concentration-dependent manner. A small but significant fall in medium pH was associated with the highest LPS concentration (100 ng/ml) in normoxia (P < 0.05). Similar to extracellular medium, parallel decreases in intracellular pH were observed with endothelial exposure to hypoxia and LPS (Fig. 8B, ANOVA, P < 0.025).
|
| |
DISCUSSION |
|---|
|
|
|---|
In a variety of disease states, tissue hypoxia occurs in conjunction
with other inflammatory events and is associated with accumulation of
leukocytes. Leukocyte recruitment to such sites involves a concerted
series of adhesion and deadhesion events between leukocytes and
vascular endothelial cells. An important adhesion molecule in this
leukocyte recruitment cascade is ICAM-1. For this reason, we
hypothesized that hypoxia may differentially regulate stimulated
endothelial ICAM-1 expression. Our findings indicate that, whereas
hypoxia alone fails to induce endothelial ICAM-1, in the presence of
LPS, hypoxia enhances both expression of ICAM-1 and lymphocyte
adhesion. With the use of specific inhibitors and
cytoplasmic-to-nuclear translocation of NF-
B, these studies implicate a hypoxia-elicited activation of proteasomes. Finally, our
data reveal that conditions that result in enhanced ICAM-1 expression
are associated with metabolic acidosis, the reversal of which
normalizes ICAM-1 expression.
In settings of tissue hypoperfusion in vivo, endothelial surfaces can be exposed to high concentrations of inflammatory stimuli. A primary example is the state of sepsis in which profound alterations in tissue perfusion are coincident with activation of high circulating levels of LPS and other inflammatory stimuli (33). Thus a relevant in vitro model that addresses focused questions regarding the role of individual perturbations should include combinations of cellular hypoxia and inflammatory stimuli. During development of this model, we consistently observed that hypoxia alone is unlikely to be a relevant signal for induction of ICAM-1 and, as we have recently demonstrated, does not induce endothelial E-selectin (36). Such findings are consistent with previous reports by others in which short-term (minutes) or relatively long-term (hours) exposure of endothelium to hypoxia resulted in no change in surface expression of ICAM-1 (21, 26, 35). The presence of LPS during hypoxia elicited a dose- and time-dependent augmentation of surface ICAM-1 (Figs. 1-3). Moreover, such enhancement by hypoxia was verified at the functional level using lymphocyte adhesion assays (Figs. 4 and 5), and the addition of functionally inhibitable MAb or ICAM-1 mRNA antisense oligonucleotides reduced such adhesion to nearly baseline levels. Interestingly, we consistently observed some enhanced ICAM-1-independent adhesion associated with endothelia exposed to hypoxia (see Figs. 4 and 5). The source of such residual adhesion is not known, although others have described similar ICAM-1-independent, LFA-1-dependent adhesion using endothelial cells exposed to hypoxia (14). Further work will be necessary to reveal the identity of this residual lymphocyte adhesion.
These studies demonstrate that hypoxia augments proteasome activation
in the presence of LPS. First, whereas the calpain inhibitor I (ALLN)
reduced LPS-activated ICAM-1 in both normoxic and hypoxic endothelia,
hypoxic cells showed a greater than one log increase in sensitivity to
this inhibitor (Fig. 7). Second, because proteasome activation is
required for induction of ICAM-1 (9) and cytoplasmic-to-nuclear translocation of NF-
B p65 directly reflects proteasome activity (25), Western blot analysis revealed that hypoxia significantly enhanced the LPS-stimulated nuclear p65 (Fig. 6). The mechanisms that
elicit increased proteasome activation by hypoxia are not known at this
time, but evidence is provided that metabolic acidification (reflected
as a decrease in both extracellular and intracellular pH in our system)
may play a role (Fig. 8). Namely, decreased medium and intracellular pH
by hypoxia correlated with increases in LPS-stimulated ICAM-1, and such
responses were normalized by increasing the buffering capacity of the
extracellular medium; a similar ICAM-1 induction pattern was observed
by adjusting medium pH in the presence of LPS (see
RESULTS). Our results are reflective of recent ex vivo (16, 31) and in vitro (15) studies indicating a
distinct role for both metabolic acidosis and proteasome activation during sepsis. Metabolic acidosis, as reflected by circulating lactate
levels, has in fact been shown to be an excellent clinical indicator
for outcome of septic patients (3, 4). In our model, it is possible
that conditions of metabolic acidification activate proteasomes and
result in persistent decreases in cytoplasmic I-
B, since conditions
that maintain low levels of cytoplasmic I-
B-
have been recently
demonstrated to sustain increased surface expression of ICAM-1,
vascular cell adhesion molecule 1 (CD106), and E-selectin (CD62E) (17).
Our recent studies demonstrated that endothelial exposure to hypoxia mediates increased induction of transcription and translation of E-selectin (36). Such observations correlated with decreased endothelial generation of adenosine 3',5'-cyclic monophosphate (cAMP) under conditions of hypoxia, and this effect is likely mediated by the cAMP-responsive element/activating transcription factor (CRE/ATF) within the E-selectin gene (10). It is unlikely that similar mechanisms explain our present observations with ICAM-1, since no CRE/ATF binding domain has been demonstrated in the ICAM-1 gene (9) and previous observations have shown that agents that influence intracellular cAMP levels modulate surface expression of endothelial E-selectin but not ICAM-1 (23).
At present, it is unclear how universal our findings might be with
regard to other molecules, additional agonists, and ICAM-1 expression
on different cell types. Because E-selectin induction occurs through
activation of NF-
B (9), it is likely that proteasome activation
plays a role in our previous findings with hypoxia and E-selectin (36).
Overall, these findings indicate that tissue hypoxia serves as a
relevant pathophysiological condition during inflammation. Therapeutic
strategies aimed at minimizing tissue hypoxia, and by association
metabolic acidosis, may dampen such responses.
| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge the valuable technical assistance of Margaret Morrissey.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-50189 (to S. P. Colgan) and by National Heart, Lung, and Blood Institute Grants HL-52886 and HL-56086 (to G. L. Stahl), HL-52589 (to F. X. McGowan) and HL-48675 (to P. R. Hickey). G. Zünd is supported by a grant from the Swiss National Foundation.
Address for reprint requests: S. P. Colgan, Center for Experimental Therapeutics and Reperfusion Injury, Brigham and Women's Hospital, 75 Francis St., Boston, MA 02115.
Received 14 March 1997; accepted in final form 15 July 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Alpern, R. J.
Mechanism of basolateral membrane H+/OH
/HCO3 transport in the rat proximal convoluted tubule: a sodium-coupled electrogenic process.
J. Gen. Physiol.
86:
613-636,
1985
2.
Bailey, J. L.,
X. Wang,
B. K. England,
S. R. Price,
X. Ding,
and
W. E. Mitch.
The acidosis of chronic renal failure activates muscle proteolysis in rats by augmenting transcription of genes encoding proteins of the ATP-dependent ubiquitin-proteasome pathway.
J. Clin. Invest.
97:
1447-1453,
1996[Medline].
3.
Bakker, J.,
P. Gris,
M. Coffernils,
R. J. Kahn,
and
J. L. Vincent.
Serial blood lactate levels can predict development of multiple organ failure following septic shock.
Am. J. Surg.
171:
221-226,
1996[Medline].
4.
Bakker, J.,
M. Coffernils,
M. Leon,
P. Gris,
and
J. L. Vincent.
Blood lactate levels are superior to oxygen-derived variables in predicting outcome in human septic shock.
Chest
99:
956-962,
1991
5.
Barnstable, C. J.,
W. F. Bodmer,
G. Brown,
G. Galfre,
C. Milstein,
A. F. Williams,
and
A. Ziegler.
Production of monoclonal antibodies to group A erythrocytes, HLA and other human cell surface antigens
new tools for genetic analysis.
Cell
14:
9-20,
1978[Medline].
6.
Bennett, C. F.,
T. P. Condon,
S. Grimm,
H. Chan,
and
M.-Y. Chiang.
Inhibition of endothelial cell adhesion molecule expression with antisense oligonucleotides.
J. Immunol.
152:
3530-3540,
1994[Abstract].
7.
Bevilacqua, M. P.,
J. S. Pober,
D. L. Mendrick,
R. S. Cotran,
and
M. A. Gimbrone.
Identification of an inducible endothelial-leukocyte adhesion molecule.
Proc. Natl. Acad. Sci. USA
84:
9238-9242,
1987
8.
Collins, T.
Biology of disease; endothelial nuclear factor-
B and the initiation of the atherosclerotic lesion.
Lab. Invest.
68:
499-508,
1993[Medline].
9.
Collins, T.,
M. A. Read,
A. S. Neish,
M. Z. Whitley,
D. Thanos,
and
T. Maniatis.
Transcriptional regulation of endothelial cell adhesion molecules: NK-
B and cytokine-inducible enhancers.
FASEB J.
9:
899-909,
1995[Abstract].
10.
DeLuca, L. G.,
D. R. Johnson,
M. Z. Whitley,
T. Collins,
and
J. S. Pober.
cAMP and tumor necrosis factor competitively regulate transcriptional activation through and nuclear factor binding to the cAMP responsive element/activating transcription factor element of the endothelial leukocyte adhesion molecule-1.
J. Biol. Chem.
269:
19193-19196,
1994
11.
Diamond, M. S.,
D. E. Staunton,
S. D. Marlin,
and
T. A. Springer.
Binding of the integrin Mac-1 (CD11b/CD18) to the third immunoglobulin-like domain of ICAM-1 (CD54) and its regulation by glycosylation.
Cell
65:
961-971,
1991[Medline].
12.
Dittel, B. N.,
E. A. Wayner,
J. B. McCarthy,
and
T. W. LeBien.
Regulation of human B cell precursor adhesion to bone marrow stromal cells by cytokines which exert opposing effects on the expression of vascular cell adhesion molecule-1.
Blood
81:
2272-2282,
1993
13.
Gimbrone, M., Jr.,
E. J. Shefton,
and
S. A. Cruise.
Isolation and primary culture of endothelial cells from human umbilical vessels.
Tissue Cult. Assoc. Man.
4:
813-818,
1978.
14.
Ginis, I.,
S. J. Mentzer,
X. Li,
and
D. V. Faller.
Characterization of a hypoxia-responsive adhesion molecule for leukocytes on human endothelial cells.
J. Immunol.
155:
802-810,
1995[Abstract].
15.
Isozaki, U.,
W. E. Mitch,
B. K. England,
and
S. R. Price.
Protein degradation and increased mRNAs encoding proteins of the ubiquitin-proteasome pathway in BC3H1 myocytes require an interaction between glucocorticoids and acidification.
Proc. Natl. Acad. Sci. USA
93:
1967-1971,
1996
16.
James, J. H.,
C. H. Fang,
S. J. Schrantz,
P. O. Hasselgren,
R. J. Paul,
and
J. E. Fischer.
Linkage of aerobic glycolysis to sodium-potassium transport in rat skeletal muscle. Implications for increased lactate production in sepsis.
J. Clin. Invest.
98:
2388-2397,
1996[Medline].
17.
Johnson, D. R.,
I. Douglas,
A. Jahnke,
S. Ghosh,
and
J. Pober.
A sustained reduction in I
B-
may contribute to persistent NF-
B activation in human endothelial cells.
J. Biol. Chem.
271:
16317-16322,
1996
18.
LeBivic, A.,
X. R. Francisco,
and
E. Rodriguez-Boulan.
Vectorial targeting of apical and basolateral plasma membrane proteins in a human adenocarcinoma epithelial cell line.
Proc. Natl. Acad. Sci. USA
86:
9313-9317,
1989
19.
Mitch, W. E.,
R. Medina,
S. Greiber,
R. C. May,
B. K. England,
S. R. Price,
J. L. Bailey,
and
A. L. Goldberg.
Metabolic acidosis stimulates muscle protein degradation by activating the adenosine triphosphate-dependent pathway involving ubiquitin and proteasomes.
J. Clin. Invest.
93:
2127-2133,
1994.
20.
Palombella, V.,
O. Rando,
A. Goldberg,
and
T. Maniatis.
The ubiquitin-proteasome pathway is required for processing the NK-
B1 precursor protein and the activation of NK-
B.
Cell
78:
773-785,
1994[Medline].
21.
Pietersma, A.,
N. DeJong,
J. F. Koster,
and
W. Sluiter.
Effect of hypoxia on adherence of granulocytes to endothelial cells in vitro.
Am. J. Physiol.
267 (Heart Circ. Physiol. 36):
H874-H879,
1994
22.
Pober, J. S.,
and
R. S. Cotran.
Overview: the role of endothelial cells in inflammation.
Transplantation
50:
537-541,
1990[Medline].
23.
Pober, J. S.,
M. R. Slowik,
L. G. DeLuca,
and
A. J. Ritchie.
Elevated cyclic AMP inhibits endothelial cell synthesis and expression of TNF-induced endothelial leukocyte adhesion molecule-1, and vascular cell adhesion molecule-1, but not intercellular adhesion molecule-1.
J. Immunol.
150:
5114-5123,
1993[Abstract].
24.
Raetz, C. R.
Biochemistry of endotoxins.
Annu. Rev. Biochem.
59:
129-170,
1990[Medline].
25.
Read, M. A.,
A. S. Neish,
F. W. Luscinskas,
V. J. Palomella,
T. Maniatis,
and
T. Collins.
The proteasome pathway is required for cytokine-induced endothelial-leukocyte adhesion molecule expression.
Immunity
2:
493-506,
1995[Medline].
26.
Shreeniwas, R.,
S. Koga,
M. Karakurum,
D. Pinsky,
E. Kaiser,
J. Brett,
B. A. Wolitzky,
C. Norton,
J. Plocinski,
W. Benjamin,
D. K. Burns,
A. Goldstein,
and
D. Stern.
Hypoxia-mediated induction of endothelial cell interleukin-1-
: an autocrine mechanism promoting expression of leukocyte adhesion molecules on the vessel surface.
J. Clin. Invest.
90:
2333-2339,
1992.
27.
Smith, C. W.,
S. D. Marlin,
R. Rothlein,
C. Toman,
and
D. C. Anderson.
Cooperative interactions of LFA-1 and Mac-1 with intercellular adhesion molecule-1 in facilitating adherence and transendothelial migration of human neutrophils in vitro.
J. Clin. Invest.
83:
2008-2017,
1989.
28.
Springer, T. A.
Adhesion receptors of the immune system.
Nature
346:
425-430,
1990[Medline].
29.
Staunton, D. E.,
M. L. Dustin,
H. P. Erickson,
and
T. A. Springer.
The arrangement of the immunoglobulin-like domains of ICAM-1 and the binding sites for LFA-1 and rhinovirus.
Cell
61:
243-254,
1990[Medline].
30.
Stevens, T.,
and
D. M. Rodman.
The effect of hypoxia on endothelial cell function.
Endothelium
3:
1-11,
1995.
31.
Tiao, G.,
S. Hobler,
J. J. Wand,
T. A. Meyer,
F. A. Luchette,
J. E. Fischer,
and
P.-O. Hasslegren.
Sepsis is associated with increased mRNA's of the ubiquitin-proteasome proteolytic pathway in human skeletal muscle.
J. Clin. Invest.
99:
163-168,
1997[Medline].
32.
Welbourne, C. R. B.,
G. Goldman,
C. R. Valeri,
D. Shepro,
and
H. B. Hechtman.
Pathophysiology of ischaemia reperfusion injury: central role of the neutrophil.
Br. J. Surg.
78:
651-655,
1991[Medline].
33.
West, M. A.,
and
C. Wilson.
Hypoxic alterations in cellular signal transduction in shock and sepsis.
New Horizons
4:
168-178,
1996[Medline].
34.
Whitley, M. Z.,
D. Thanos,
M. A. Read,
T. Maniatis,
and
T. Collins.
A striking similarity in the organization of the E-selectin and beta interferon gene promoters.
Mol. Cell. Biol.
14:
6464-6475,
1994
35.
Yoshida, N.,
D. N. Granger,
D. C. Anderson,
R. Rothlein,
C. Lane,
and
P. R. Kvietys.
Anoxia/reoxygenation-induced neutrophil adherence to cultured endothelial cells.
Am. J. Physiol.
265 (Heart Circ. Physiol. 34):
H699-H703,
1992.
36.
Zünd, G.,
D. P. Nelson,
E. J. Neufeld,
A. L. Dzus,
J. Bischoff,
J. E. Mayer,
and
S. P. Colgan.
Hypoxia enhances stimulus-dependent induction of E-selectin on aortic endothelial cells.
Proc. Natl. Acad. Sci. USA
93:
7075-7080,
1996
This article has been cited by other articles:
![]() |
A. Agusti and J. B. Soriano Dynamic hyperinflation and pulmonary inflammation: a potentially relevant relationship? Eur. Respir. Rev., December 1, 2006; 15(100): 68 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lang, P. Dong, E. K. Hosszu, and I. R. Doyle Effect of CO2 on LPS-induced cytokine responses in rat alveolar macrophages Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L96 - L103. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. K. Eltzschig, L. F. Thompson, J. Karhausen, R. J. Cotta, J. C. Ibla, S. C. Robson, and S. P. Colgan Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism Blood, December 15, 2004; 104(13): 3986 - 3992. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Altay, E. R. Gonzales, T. S. Park, and J. M. Gidday Cerebrovascular inflammation after brief episodic hypoxia: modulation by neuronal and endothelial nitric oxide synthase J Appl Physiol, March 1, 2004; 96(3): 1223 - 1230. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |